© 2002 by European Society of Cardiology
Copyright © 2002, European Society of Cardiology
Inhibition of nuclear factor-
B activation by IRFI 042, protects against endotoxin-induced shock
aDepartment of Clinical and Experimental Medicine and Pharmacology, Section of Pharmacology School of Medicine, University of Messina, Torre Biologica, Azienda Ospedaliera Universitaria G Martino, Via C. Valeria, Gazzi, 98125 Messina, Italy
bDepartment of Internal Medicine, University of Messina, Messina, Italy
cDepartment of Physiology and Pharmacology, University of Messina, Messina, Italy
dDepartment of Neurosciences, Psychiatry and Anesthesiology, University of Messina, Messina, Italy
francesco.squadrito{at}unime.it
* Corresponding author. Tel.: +39-90-221-3648; fax: +39-90-221-3300
Received 17 September 2001; accepted 21 January 2002
| Abstract |
|---|
|
|
|---|
Background: The aim of our study was to investigate the effect of IRFI 042, a novel dual vitamin E-like antioxidant, on nuclear factor-
B (NF-
B) activation, TNF-
gene priming and on the release of the mature protein during endotoxin shock. Methods: Endotoxin shock was produced in male rats by a single intravenous (i.v.) injection of 20 mg kg–1 of Salmonella enteritidis lipopolysaccharide (LPS). Survival rate, mean arterial blood pressure, serum TNF-
and plasma malondialdehyde (MAL) levels were investigated. We then evaluated in the liver TNF-
mRNA levels, NF-
B binding activity and the inhibitory protein I
B
. Moreover we studied in LPS stimulated (50 µg ml–1) peritoneal macrophages (M
), NF-
B activation, cytoplasmic I
B-
degradation, the message for TNF-
, and TNF-
and MAL levels. Results: LPS administration reduced survival rate (0%, 72 h after LPS administration), decreased mean arterial blood pressure, augmented serum TNF-
(60±11 ng ml–1) and enhanced plasma malondialdehyde (MAL) levels (55±7.1 nmol l–1). LPS shocked rats also had increased TNF-
mRNA levels, augmented liver NF-
B binding activity in the nucleus and decreased levels of the inhibitory protein I
B
. In addition, in vitro LPS stimulation (50 µg ml–1) significantly induced NF-
B activation and cytoplasmic I
B
degradation in M
, enhanced TNF-
mRNA levels and increased M
TNF-
and MAL. Treatment with IRFI 042 (20 mg kg–1, i.v., 5 min after endotoxin challenge) protected against LPS-induced lethality (90% survival rate 24 h and 80% survival rate 72 h after LPS injection, respectively), reduced hypotension, blunted plasma MAL (9.0±0.9 nmol l–1) and decreased serum TNF-
(15±3 ng ml–1). The antioxidant also inhibited the loss of I
B
protein from the hepatic cytoplasm, blunted the increased NF-
B binding activity in the liver and decreased hepatic liver mRNA for TNF-
. Furthermore in vitro IRFI 042 (50 µM) significantly inhibited activation of NF-
B through inhibition of I
B
degradation, reduced the amount of TNF-
mRNA, decreased LPS-induced TNF-
release and blunted lipid peroxidation (MAL) in LPS stimulated M
. Conclusions: These data suggest that IRFI 042 blocks the activation of NF-
B, reduces TNF-
mRNA levels, and finally reverses endotoxic shock.
KEYWORDS Cytokines; Endotoxins; Free radicals; Gene expression; Macrophages; Septic shock; Signal transduction
| 1. Introduction |
|---|
|
|
|---|
Endotoxin shock is a leading cause of morbidity and mortality among hospitalized patients. The underlying pathobiochemical alterations consist of a dramatic increase in eicosanoid and platelet activation factor production; a release of cytokines, in particular interleukin (IL)-1, IL-3, IL-6, IL-8, IL-10 and tumor necrosis factor (TNF-
); an activation of the L-arginine–nitric oxide (NO) pathway; the formation of oxygen-centered free radicals; activation of the plasmatic coagulation cascade, fibrinolysis and complement pathway [1]. All these substances represent key mediators of the multiple organ injury that occurs during endotoxin shock. They interact each other and mutually modulate their production and release. In particular endotoxin shock is characterized by a marked oxidant stress [2] and by a rapid production of different cytokines [3–6]: the production of these latter may be blunted by quenching oxidative stress. Nuclear factor-
B (NF-
B) is an intracellular messenger that could represent a good candidate to explain such an interaction.
NF-
B is a transcription factor which plays a central role in the modulation of the inflammatory and immune response and induces the expression of many genes codifying for cytokines involved in the pathogenesis of septic shock. In fact, it has been shown that bacterial endotoxin can cause cells to activate NF-
B thereby increasing the transcription, production and release of TNF-
which in turn stimulates the production of other mediators [7]. Alternatively the transcription factor may also be turned on by oxidative stress. NF-
B therefore represents an important target to develop new strategies to halt the inflammatory response.
Vitamin E has been suggested to act as potential inhibitor of NF-
B activation [8]. Nevertheless the marked lipophilicity of this vitamin limits its therapeutic potential: acute administration results in fact in a very low circulating levels and poor distribution. A number of less lipophilic
-tocoferol analogues endowed with radical scavenging activity have been described in the literature. One of the vitamin E analogue IRFI-042 (±)-5-emisuccinoyl-2-[2-(acetylthio)ethyl]-2,3-dihydro-4,6,7-trimethylbenzofuran is more active than other previously investigated compounds [8]. The combination in the same molecule of a chain-breaking moiety (characteristic of phenols related to
-tocopherol) with the reducing ability of thiol groups (dual antioxidant) may result in powerful and peculiar biological actions, especially in those oxidative stress-mediated situations in which a significant depletion of endogenous thiols is observed. This compound shows no systemic toxicity even following high dosage (up to 1 g/kg). Recently it has been shown that IRFI 042 inhibits NF-
B activation and protects against myocardial ischaemia–reperfusion injury [9].
In light of these findings we investigated the effect of IRFI 042 on NF-
B activity and on the pathological sequelae associated with endotoxic shock.
| 2. Methods |
|---|
|
|
|---|
The investigation conforms with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of health (NIH Publication No. 85-23, revised 1996).
2.1 Endotoxin shock procedure and survival evaluation
Male Sprague–Dawley rats (200–220 g), fed on a standard diet and with tap water ad libitum, were used. Environmental conditions were standardized, including a room temperature of 22±2 °C and 12 h artificial lighting. Endotoxin shock was induced by administering a single intravenous (i.v.) dose of 20 mg kg–1 of Salmonella enteritidis lipopolysaccharide. Control rats received an equal volume of vehicle (0.9% NaCl). Five minutes after endotoxin injection, control rats received an i.v. bolus of vehicle (dimethylsulfoxide:NaCl 0.9%; 1 ml kg–1), and treated rats were injected with IRFI 042 (20 mg kg–1). Survival rate was evaluated in a first group of rats (n=40) for 72 h after endotoxin administration.
2.2 Arterial blood pressure
A second group of rats (n=12) was used to monitor blood pressure. Briefly, the animals were anesthetized with urethane (1.3 g kg–1) and a cannula (PE 50) was inserted into the left common carotid artery and connected to a pressure transducer. The pressure pulse triggered a cardiotachometer, and arterial blood pressure, was monitored for 6 h and displayed on channels of a polygraph (Ugo Basile, Varese, Italy). Arterial blood pressure is reported as mean arterial pressure (MAP) in mmHg. These rats were treated as described above.
2.3 Isolated aortic rings
A third group of rats (n=24) was used to evaluate vascular reactivity, and the circulating levels of TNF-
and malondialdehyde (MAL). These animals were treated as described above and they were sacrificed 3 h after endotoxin challenge. Thoracic aortae from control and IRFI 042-treated rats were removed 3 h after LPS injection and placed in cold Kreb's solution of the following composition (mM): NaCl 118.4, KCl 4.7, MgSO4 1.2, CaCl2 2.5, KH2PO4 1.2, NaHCO3 25.0 and glucose 11.7. Then aortas were cleaned of adherent connective and fat tissue and cut into rings of approximately 2 mm in length. In some rings the vascular endothelium was removed mechanically by gently rubbing the luminal surface with a thin wooden stick. The rings were then placed under 1 g of tension in an organ bath containing 10 ml of Krebs* solution at 37 °C and bubbled with 95% O2 and 5% CO2 (pH 7.4). All experiments were carried out in the presence of indomethacin (10 µM) in order to exclude the involvement of prostaglandins and their metabolites. Developed tension was measured with an isometric force transducer and recorded on a polygraph (Ugo Basile, Varese, Italy). After an equilibration period of 60 min during which time the rings were washed with fresh Krebs* solution at 15–20-min intervals and basal tension was readjusted to 1 g, the tissue was exposed to phenylephrine (PE, 100 nM). When the contraction was stable, the presence or absence of endothelium was assessed by administering acetylcholine (ACh, 100 nM). Concentration–response curves were obtained by cumulative concentrations of PE (1 nM–10 µM).
2.4 Malondialdehyde measurement
Determination of the MAL levels was carried out in plasma samples. Samples (0.2 ml) of arterial blood were drawn from the carotid catheter at 3 h following LPS injection. The blood was collected in polyethylene tubes to which had been added 10 µl of heparin solution (1000 i.u.). The plasma samples, obtained after centrifugation at 3000xg for 10 min at 4 °C, were frozen at –70 °C until the analysis. The assay was carried out by using a colorimetric commercial Kit (Lipid peroxidation assay kit, cat. No. 437634, Calbiochem–Novabiochem, USA).
Briefly, 0.65 ml of 10.3 mM N-methyl-2-phenyl-indole in acetonitrile were added to 0.2 ml of samples. After vortexing for 3–4 s and adding 0.15 ml of HCl 37%, samples were mixed well and closed with a tight stopper and incubated at 45 °C for 60 min. The samples were then cooled on ice and the absorbance was measured spectrophotometrically at 586 nm. A calibration curve of an accurately prepared standard MAL solution (from 2 to 128 nmol ml–1) was also run for quantitation.
2.5 Plasma TNF-
levels
Blood (750 µl) was drawn 3 h following endotoxin challenge. Plasma TNF-
concentrations were determined by an ELISA kit (Genzyme).
2.6 Isolation of nuclear and cytoplasmatic proteins
A fourth group of rats (n=18) was used to study NF-
B activity. Animals were treated as described above. Liver sections were obtained 1 h after endotoxin challenge. Briefly 70 mg of pulverized liver samples were homogenized in 0.8 ml ice-cold hypotonic buffer (10 mM Hepes, pH 7.9, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothreitol (DTT); protease inhibitors: 0.5 mM phenylmethylsulfonyl fluoride, aprotinin, pepstatin, leupeptin (10 µg/ml each); and phosphatase inhibitors: 50 mM NAF, 30 mM β-glycerophosphate, 1 mM Na3VO4 and 20 mM p-nitrophenyl phosphate). The homogenates were centrifuged for 30 s at 2000 rpm at 4 °C to eliminate any unbroken tissues. The supernatants were incubated on ice for 20 min, vortexed for 30 s after addition of 50 µl of 10% Nonidet P-40 and then centrifuged for 1 min at 4 °C in an Eppendorf centrifuge. Supernatants containing cytoplasmatic protein were collected and stored at –80 °C. The pellets after a single wash with the hypotonic buffer without Nonidet P-40, were suspended in an ice-cold hypertonic salt buffer (20 mM Hepes, pH 7.9, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, protease inhibitors, and phosphatase inhibitors), incubated on ice for 30 min, mixed frequently, and centrifuged for 15 min at 4 °C. The supernatants were collected as nuclear extracts and stored at –80 °C. The concentration of total proteins in the samples was determined by a commercially available protein assay reagent. To estimate possible contamination of the nuclear extracts with the cytoplasmatic extracts, when preparing the nuclear and cytoplasmatic proteins, lactate dehydrogenase (LDH) activity was determined by a commercially available kit for the quantitative kinetic determination of LDH activity (Sigma, St. Louis, MO). Values were expressed as LDH activity units per milligram of protein. To establish that the nuclear extracts contained mainly nuclear proteins, 40 µg of nuclear protein preparations were subjected to Western blot analysis for histone H3, a nuclear protein, with anti-histone H3 antibody (Upstate Biotechnology, Lake Placid, NY).
2.7 Electrophoretic mobility shift assay
NF-
B binding activity was performed in a 15-µl binding reaction mixture containing 1% binding buffer (50 µg/ml of double-stranded poly(dI–dC), 10 mM Tris–HCl (pH 7.5), 50 mM NaCl, 0.5 mM EDTA, 0.5 mM DTT, 1 mM MgCl2, and 10% glycerol), 15 µg of nuclear proteins, and 35 fmol (50 000 cpm, Cherenkov counting) of double-stranded NF-
B consensus oligonucleotide (5'-AGT TGA GGG GAC TTT CCC AGG C-8'; Promega, Madison, WI, USA) which was end-labeled with [
-32P]ATP (3000 Ci/mmol at 10 mCi/ml; Amersham Life Sciences, Arlington Heights, IL) using T4 polynucleotide kinase. The specificity of the binding reaction was assessed using an excess (50-fold over the probe) of unlabeled oligonucleotides added into the reaction mixture. The latter eliminated competitively the induced bands. The binding reaction mixture was incubated at room temperature for 20 min and analyzed by electrophoresis on 5% not denaturing polyacrylamide gels. After electrophoresis, the gels were dried using a gel-drier and exposed to Kodak X-ray films at –70 °C. The binding bands were quantified by scanning densitometry of a bio-image analysis system (Bio-Profil Celbio, Milan, Italy). The results of each group were expressed as relative integrated intensity compared with the sham operated group liver measured in the same batch because the integrated intensity of group samples from different electrophoretic mobility shift assay (EMSA) batches would be affected by the half-life of the isotope, exposure time, and background levels.
2.8 Western blot analysis of I
B
in cytoplasm
Cytoplasmatic proteins (40 µg) from each sample were mixed with 2x SDS sample buffer (62 mM Tris (pH 6.8), 10% glycerol, 2% SDS, 5% β-mercaptoethanol, 0.003% bromophenol blue), heated at 95 °C for 5 min, and separated by SDS–polyacrylamide gel electrophoresis. After electrophoresis on 12.5% polyacrylamide gels, the separated proteins were transferred from the gels into Hybond electrochemiluminiscence membranes (Amersham) using a Bio-Rad semidry transfer system (Bio-Rad) for 2 h. The membranes were blocked with 5% not-fat dry milk in TBS–0.05% Tween for 1 h at room temperature, washed three times for 10 min each in TBS–0.05% Tween 20, and incubated with a primary I
B
antibody (Santa Cruz Biotechnology) in TBS–0.05% Tween 20 containing 5% not-fat dry milk for 1–2 h at room temperature. After being washed three times for 10 min each in TBS–0.05% Tween 20, the membranes were incubated with a second antibody peroxidase-conjugated goat anti-rabbit immunoglobulin G (Sigma) for 1 h at room temperature. After washing, the membranes were analyzed by the enhanced chemiluminescence system according to the manufacturer's protocol (Amersham). The I
B
protein signal was quantified by scanning densitometry using a bio-image analysis system (Bio-Profil Celbio, Milan Italy). The results from each experimental group were expressed as relative integrated intensity compared with normal liver measured in the same batch.
2.9 RNA isolation and reverse transcriptase-polymerase chain reaction (RT-PCR)
A fifth group of rats (n=18) was used to study hepatic mRNA for TNF-
. These animals were treated as described before. Total cellular RNA was extracted from liver sections 2 h after endotoxin challenge. The methods used in the current study have been described elsewhere [10]. In brief, approximately 100 mg of liver was homogenized with 800 µl RNAZOL STAT (Teltest, Firendswood, TX) in a microfuge tube, after which 80 µl chloroform was added. After vortexing and centrifugation, the aqueous phase was transferred to a new microfuge tube containing an equal volume of cold isopropanol and the RNA recovered by precipitation by chilling at –80 °C for 15 min. The pellet was washed with cold ethanol 70%, centrifuged, dried in speed vacuum, centrifuged a second time and then dissolved in 20 µl of buffer. A 2-µg portion of total RNA was subjected to first strand cDNA synthesis in a 20 µl reaction mixture containing the AMV reverse transcriptase (Superscript II; BRL, USA), each dNTP, the specific primers, Tris–HCl and MgCl2.
After dilution of the product with distilled water, 5 µl were used for each polymerase chain reaction (PCR) which contained the Taq polymerase (Perkin-Elmer), the buffer as supplied with the enzyme, each dNTP and the specific primers, designed to cross introns and to avoid confusion between mRNA expression and genomic contamination.
The following oligonucleotide pairs were used (5' oligo/3'oligo), each sequence as 5' to 3':
- TNF-
: CACGCTCTTCTGTCTTACTGA/GGACTCCGTGATGTCTAAGT
- GAPDH: ACCACCATGGAGAAGGTCGG/CTCAGTGTAGCCCAGGATGGC.
- GAPDH: ACCACCATGGAGAAGGTCGG/CTCAGTGTAGCCCAGGATGGC.
The optimal cycle number for TNF-
was 25 and we used a PCR-negative and a PCR-positive control without cDNA or with a known cDNA, respectively. A portion of the PCR product was electrophoresed and transferred to a nylon membrane which was prehybridized with oligonucleotide probes, radiolabeled with [32P]ATP by a T4 oligonucleotide kinase. After an overnight hybridization at 55 °C, filters underwent the autoradiography in a dark-room with a fixed camera. The captured image, sent to an image analysis software (Bio-Profil, Celbio, Milan, Italy) was subjected to densitometric analysis.
2.10 Macrophage culture
Peritoneal macrophages were harvested from control normal rats by washing the abdominal cavity with RPMI 1640. The cells were centrifuged twice and suspended again in the same medium at a concentration of 1x106 ml–1. Peritoneal macrophages were obtained after 2 h adhesion to plastic Petri dishes (Nunc, Denmark) at 37 °C in an atmosphere of 5% CO2 in air. The homogeneity and the viability of macrophages were greater than 98% as determined by differential staining and trypan blue exclusion. In order to study the effects of IRFI 042 on TNF-
production and on macrophage MAL, peritoneal macrophages were incubated for 4 h with S. enteritidis LPS (50 µg ml–1) alone or together with IRFI 042 (12, 25 and 50 µM). TNF-
production and MAL content were evaluated as reported above.
The activation of NF-
B and the degradation of cytoplasmic I
B-
were evaluated in macrophages following 1 h of LPS stimulation in the presence or absence of IRFI 042 (50 µM). NF-
B activity was investigated as reported above.
2.11 Drug
IRFI 042 was supplied by Biomedica Foscama Research Centre, Ferentino (FR), Italy. The compound was dissolved in dimethylsulphoxide:NaCl 0.9% (1:1, v/v) and prepared fresh daily.
2.12 Statistical analysis
Data are expressed as means±S.E. mean and were analyzed by analysis of variance for multiple comparison of results. Duncan's multiple range test was used to compare group means. In all cases, a probability error of less than 0.05 was selected as criterion for statistical significance.
| 3. Results |
|---|
|
|
|---|
3.1 Survival rate
Table 1 shows the ratio of animals surviving in each group to the total number of animals throughout the experimental period. The endotoxin shocked rats had 1 and 0 survivors out of 10, 48 and 72 h after LPS challenge, respectively. IRFI 042 (20 mg kg–1) administered 5 min after LPS injection significantly protected against endotoxin induced lethality.
|
3.2 Arterial blood pressure
Rats injected with endotoxin showed a sharp and long-lasting decrease in mean arterial blood pressure (Fig. 1). IRFI 042 (20 mg kg–1, 5 min after LPS injection) significantly blunted the sustained decrease in MAP.
|
3.3 Contractile response to phenylephrine
Fig. 2 represents the contractile response to phenylephrine (PE; 1 nM–10 µM) of intact and endothelium denuded aortic rings obtained from control or endotoxin shocked rats. Aortic rings obtained from endotoxin shocked rats showed a decreased responsiveness to phenylephrine (Fig. 2) with respect to control rats. Administration of IRFI 042 (20 mg kg–1, 5 min after LPS) significantly improved the constrictor response to PE in aortic rings obtained from endotoxin shocked rats.
|
3.4 Plasma MAL analysis and serum TNF-

Determination of plasma malonylaldheyde (MAL) was performed to evaluate free radical damage on biological membranes after LPS injection. Table 2 shows a significant increase of MAL concentration in plasma obtained 3 h following endotoxin challenge. The administration of IRFI 042 (20 mg kg–1, 5 min after LPS) significantly decreased plasma MAL levels (Table 2).
|
In endotoxin shocked rats serum TNF-
was significantly increased 3 h after LPS injection (Table 2). In vivo treatment with IRFI 042 reduced TNF-
levels in the serum of shocked rats.
3.5 Activation of NF-
B in the liver
NF-
B activation in the nuclear extracts of liver was determined by EMSA 1 h after endotoxin challenge. The top of Fig. 3a shows representative EMSA picture indicating activation of NF-
B. The bottom of the figure shows quantitative data. NF-
B binding activity was present at very low levels in sham shocked animals. NF-
B was, in contrast, markedly increased in the liver of LPS treated animals (Fig. 3a). The administration of IRFI-042 markedly reduced NF-
B binding activity (Fig. 3a).
|
3.6 Loss of I
B
protein in the liver cytoplasmNF-
B activation was also indirectly investigated by studying its inhibitory protein I
B
in the liver cytoplasm. The top of Fig. 3b shows representative Western blot analysis indicating reduction of I
B
protein in the cytoplasm of liver obtained from sham shocked animals and rats subjected to endotoxin shock and treated with vehicle or IRFI 042. The bottom of Fig. 3b represents quantitative data. I
B
levels showed a significant reduction in the liver cytoplasm of septic rats treated with vehicle. The administration of IRFI 042 blunted the consistent loss of I
B
protein from the cytoplasm (Fig. 3b).
3.7 Liver TNF-
mRNA expression
Liver TNF-
mRNA was evaluated 2 h after LPS administration. The top of Fig. 4 shows representative autoradiograms highlighting mRNA expression for liver TNF-
in rats subjected to endotoxin shock and treated with vehicle or IRFI 042. The bottom of Fig. 4 depicts quantitative data and indicates relative amount of liver TNF-
mRNA in septic rats treated with vehicle or the antioxidant.
|
Liver mRNA levels for TNF-
were significantly elevated in endotoxin rats treated with vehicle.
Administration of IRFI-042 (Fig. 4) blunted hepatic TNF-
mRNA expression in LPS shocked rats.
3.8 Activation of NF-
B in peritoneal macrophages
NF-
B binding activity in nuclear extracts of peritoneal macrophages was determined by EMSA. Peritoneal macrophages were stimulated with LPS (50 µg ml–1) alone or together with IRFI 042 (50 µM) for 1 h. As shown in Fig. 5, un-stimulated macrophages express low basal levels of NF-
B activity. NF-
B binding activity was significantly increased in peritoneal macrophages challenged with LPS. IRFI 042 significantly reduced NF-
B activity (Fig. 5).
|
3.9 Effects of IRFI 042 on I
B
degradation in peritoneal macrophagesNF-
B activation was also indirectly studied by the reduction of its inhibitory protein I
B
Cytoplasmic proteins were extracted and analyzed by Western blot analysis using an anti-I
B
antibody. As shown in Fig. 6, LPS induced a significant degradation of the protein but, in contrast, loss of cytoplasmic I
B
was blocked by IRFI 042 (Fig. 6).
|
3.10 Effects of IRFI 042 on macrophage TNF-
and MALFig. 7 shows representative autoradiograms of mRNA expression for TNF-
in peritoneal macrophages stimulated with LPS or H2O2 in the presence or absence of IRFI 042 for 4 h. Increased mRNA levels of TNF-
were found in macrophages incubated with LPS (50 µg ml–1) or H2O2 (250 µM). Treatment with IRFI 042 (50 µM) markedly suppressed macrophage TNF-
expression.
|
As shown in Table 3, in vitro LPS induced a significant release of TNF-
by macrophages. IRFI 042 added in vitro (12, 25 and 50 µM) reduced the cytokine levels in macrophage supernatants. In vitro LPS also caused a marked production of MAL that was suppressed in a dose-dependent manner by IRIF 042 (Table 3).
|
| 4. Discussion |
|---|
|
|
|---|
In the last few years, several studies have been carried out in order to find a new therapeutic target for the treatment of endotoxic shock. It has been demonstrated that treatment with antioxidants, corticosteroids, proteasome inhibitors, and the induction of endotoxin tolerance can suppress TNF-
gene up-regulation and the production of other pro-inflammatory mediators through inhibition of NF-
B activation [11–13]. Modulation of NF-
B activation may be an important strategy for the treatment of endotoxin-induced multiple organ injury [14]. There is, in fact, increasing evidence suggesting that NF-
B is an important mediator in the pathophysiology of disease states characterized by elevated levels of cytokines and reactive oxygen intermediates (ROI) such as in sepsis and in inflammation. LPS activates nuclear translocation of NF-
B either indirectly (via the production of a strong oxidant stress) or directly by modifying its inhibitory subunit, I
B. As a direct consequence of this observation, several antioxidant agents have been tested in experimental models of endotoxin shock.
In a murine model of endotoxic shock, green tea polyphenols blocked TNF-
gene expression by modulating NF-
B activation through their antioxidant activity [15]. Moreover, U-74389G a new lazaroid with chain-breaking properties, reduced TNF-
production through inhibition of NF-
B activation and it has been proposed for the treatment of endotoxic shock [16]. Furthermore another antioxidant, N-acetyl cysteine has been shown to suppress NF-
B and TNF-
production in peritoneal macrophages activated with endotoxin [17]. Finally pyrrolidine dithiocarbamate, an antioxidant that selectively inhibits NF-
B activation [18], prevented in vivo expression of pro-inflammatory genes following LPS injection [19].
Theoretically vitamin E could also represent a good candidate to inhibit NF-
B activation. However, its poor pharmacokinetic profile precludes the use in pathological situations that require an acute administration. This justifies the search for alternative analogues that could overcome this problem. Experimental evidence suggests that vitamin E analogues such as its derivative pentamethyl-hydroxychromane effectively inhibits activation of NF-
B [20]. In agreement with these findings it has been recently shown that the vitamin E analogue IRFI 042 reduces the inflammatory response in myocardial ischaemia–reperfusion injury by inhibiting the activation of nuclear factor kappa B [9].
The in vitro results of the present study confirm this preliminary report and extend it: as a matter of fact IRFI 042, under in vitro conditions blocked the activation of NF-
B induced by LPS. The inhibition of NF-
B translocation to the nucleus is likely the consequence of a drug-induced modification of the inhibitory protein I
B
. NF-
B activation, in fact, requires sequential phosphorylation, ubiquitination and degradation of I
B
that, as a final result, disappears from the cytoplasm. Indeed IRFI 042 prevented the loss of the inhibitory protein from the cytoplasm, thereby suggesting that this drug blocks NF-
B activation through inhibition of I
B
degradation. Furthermore IRFI 042 suppressed macrophage production of TNF-
and markedly reduced the cellular oxidant injury, evaluated by the means of MAL, an end-product of lipid peroxidation. The ability of IRFI-042 to block NF-
B translocation to the nucleus was nicely reproduced under in vivo conditions. In fact, administration of this antioxidant agent 5 min after endotoxin challenge inhibited in the liver NF-
B translocation to the nucleus and prevented the loss of the inhibitory protein I
Ba from the cytoplasm. As a consequence, liver TNF-
mRNA and the circulating levels of the mature protein were dramatically reduced by IRFI 042 treatment that also caused a marked reduction in MAL plasma levels, thus suggesting a strong inhibition of the systemic oxidant stress response.
IRFI-042 restored the vascular failure and the hyporeactivity of the vasculature to vasoconstrictor agents, phenomena that represent an important aspect in the pathophysiology of circulatory shock. The effect likely results from inhibition of TNF-
. This latter, in fact, could impair by several mechanism the vasculature [21,22].
In conclusion IRFI 042 represents a strong inhibitor of oxidative stress and LPS induced activation of NF-
B and may represent a promising drug for modulating the inflammatory response during endotoxin shock and sequential multiple organ failure/dysfunction syndrome (MOF/MODS).
Time for primary review 23 days.
| References |
|---|
|
|
|---|
- Klosterhalfen B, Bhardwaj R.S. Septic shock. Gen Pharmacol (1998) 31:25–32.[Web of Science][Medline]
- Altavilla D, Squadrito F, Campo G.M, Squadrito G, Arlotta M, Urna G, Sardella A, Quartarone C, Saitta A, Caputi A.P. The Lazaroid, U74389G, inhibits inducible nitric oxide synthase activity, reverses vascular failure and protects against endotoxin shock. Eur J Pharmacol (1999) 369:49–55.[CrossRef][Web of Science][Medline]
- Altavilla D, Squadrito F, Serrano M, Campo G.M, Squadrito G, Arlotta M, Urna G, Sardella A, Saitta A, Caputi A.P. Inhibition of tumour necrosis factor and reversal of endotoxin-induced shock by U-83836E, a second generation lazaroid in rats. Br J Pharmacol (1998) 124:1293–1299.[CrossRef][Web of Science][Medline]
- Sironi M, Pozzi P, Polentarutti N, Benigni F, Coletta I, Guglielmotti A, Milanese C, Ghezzi P, Vecchi A, Pinza A, Mantovani A. Inhibition of inflammatory cytokine production and protection against endotoxin toxicity by benzydamine. Cytokine (1996) 8:710–716.[CrossRef][Web of Science][Medline]
- Zuckerman S.H, Bryan-Poole N, Evans G.F, Short L, Glasebrook A.L. In vivo modulation of murine serum tumour necrosis factor and interleukin-6 levels during endotoxemia by oestrogen agonists and antagonists. Immunology (1995) 86:18–24.[Web of Science][Medline]
- Carvalho G.L, Wakabayashi G, Shimazu M, Karahashi T, Yoshida M, Yamamoto S, Matsushima K, Mukaida N, Clark B.D, Takabayashi T, Brandt C.T, Kitajima M. Anti-interleukin-8 monoclonal antibody reduces free radical production and improves hemodynamics and survival rate in endotoxic shock in rabbits. Surgery (1997) 122:60–68.[CrossRef][Web of Science][Medline]
- Blackwell T.S, Christman J.W. The role of nuclear factor-kB in cytokine gene regulation. Am J Respir Cell Mol Biol (1997) 17:3–9.
[Abstract/Free Full Text] - Campo G.M, Ceccarelli S, Squadrito F, Altavilla D, Dorigotti L, Caputi A.P. Raxofelast (IRFI 016): a new hydrophilic vitamin E-like antioxidant agent. Cardiovasc Drug Rew (1997) 15:157–173.[CrossRef]
- Altavilla D, Deodato B, Campo G.M, Arlotta M, Miano M, Squadrito G, Saitta A, Cucinotta D Ceccarelli S, Ferlito M, Tringali M, Minutoli L, Caputi A.P, Squadrito F. IRFI 042, a novel dual vitamin E-like antioxidant, inhibits activation of nuclear factor-kB and reduces the inflammatory response in myocardial ischaemia-reperfusion injury. Cardiovasc Res (2000) 47:515–528.
[Abstract/Free Full Text] - Yamada T, Matsumori A, Sasayama S. Therapeutic effects of anti-tumor necrosis factor-alpha antibody on the murine model of viral myocarditis induced by encephalomyocarditis virus. Circulation (1994) 8:846–851.
- Christman J.W, Lancaster L.H, Blackwell T.S. Nuclear factor kappa B: a pivotal role in the systemic inflammatory response syndrome and new target for therapy. Intensive Care Med (1998) 24:1131–1138.[CrossRef][Web of Science][Medline]
- Lauzurica P, Martinez-Martinez S, Marazuela M, Gomez Del Arco P, Martinez C, Sanchez-Madrid F, Redondo J.M. Pyrrolidine dithiocarbamate protects mice from lethal shock induced by LPS or TNF-alpha. Eur J Immunol (1999) 29:1890–1900.[CrossRef][Web of Science][Medline]
- Schow S.R, Joly A. N-Acetyl-leucinyl-norleucinal inhibits lipopolysaccharide-induced NF-kappaB activation and prevents TNF and IL-6 synthesis in vivo. Cell Immunol (1997) 175:199–202.[CrossRef][Web of Science][Medline]
- Guglielmotti A, Aquilini L, Rosignoli M.T, Landolfi C, Soldo L, Coletta I, Pinza M. Benzydamine protection in a mouse model of endotoxemia. Inflamm Res (1997) 46:332–335.[CrossRef][Web of Science][Medline]
- Yang F, De Villiers W.J, Mcclain C.J, Varilek G.W. Green tea polyphenols block endotoxin-induced tumor necrosis factor-production and lethality in a murine model. J Nutr (1998) 128:2334–2340.
[Abstract/Free Full Text] - Fukuma K, Marubayashi S, Okada K, Yamada K, Kimura A, Dohi K. Effect of lazaroid U-74389G and methylprednisolone on endotoxin-induced shock in mice. Surgery (1999) 125:421–430.[Web of Science][Medline]
- Pahan K, Sheikh F.G, Singh I. N-Acetyl cysteine inhibits induction of NO production by endotoxin or cytokine stimulated rat peritoneal macrophages, C6 glial cells and astrocytes. Free Radic Biol Med (1998) 24:39–48.[CrossRef][Web of Science][Medline]
- Parrillo J.E. Pathogenetic mechanisms of septic shock. New Engl J Med (1993) 328:1471–1477.
[Free Full Text] - Liu S.F, Ye X, Malik A.B. Inhibition of NF-
B activation by pyrrolidine dithiocarbamate prevents in vivo expression of proinflammatory genes. Circulation (1999) 100:1330–1337.[Abstract/Free Full Text] - Hattori S, Hattori Y, Banba N, Kasai K, Shimoda S. Pentamethyl-hydroxychromane, a vitamin E derivative, inhibits induction of nitric oxide by bacterial lipopolysaccharide. Biochem Mol Biol Int (1995) 35:117–183.[Web of Science][Medline]
- Szabo C, Thiemermann C. Invited opinion: role of nitric oxide in hemorrhagic, traumatic and anaphylactic shock. Shock (1994) 2:145–155.[Web of Science][Medline]
- Busse R, Mulsh A. Induction of nitric oxide synthase by cytokines in vascular smooth muscle cells. FEBS Lett (1990) 275:87–90.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
J. Ding, D. Song, X. Ye, and S. F. Liu A Pivotal Role of Endothelial-Specific NF-{kappa}B Signaling in the Pathogenesis of Septic Shock and Septic Vascular Dysfunction J. Immunol., September 15, 2009; 183(6): 4031 - 4038. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. H. Kim, E. Roh, H. Y. Lee, I.-J. Lee, B. Ahn, S.-H. Jung, H. Lee, S.-B. Han, and Y. Kim Benzoxathiole Derivative Blocks Lipopolysaccharide-Induced Nuclear Factor-{kappa}B Activation and Nuclear Factor-{kappa}B-Regulated Gene Transcription through Inactivating Inhibitory {kappa}B Kinase {beta} Mol. Pharmacol., April 1, 2008; 73(4): 1309 - 1318. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chatterjee, C. Dimitropoulou, F. Drakopanayiotakis, G. Antonova, C. Snead, J. Cannon, R. C. Venema, and J. D. Catravas Heat Shock Protein 90 Inhibitors Prolong Survival, Attenuate Inflammation, and Reduce Lung Injury in Murine Sepsis Am. J. Respir. Crit. Care Med., October 1, 2007; 176(7): 667 - 675. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. F. Liu and A. B. Malik NF-{kappa}B activation as a pathological mechanism of septic shock and inflammation Am J Physiol Lung Cell Mol Physiol, April 1, 2006; 290(4): L622 - L645. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Messina, D. Altavilla, M. Aguennouz, P. Seminara, L. Minutoli, M. C. Monici, A. Bitto, A. Mazzeo, H. Marini, F. Squadrito, et al. Lipid Peroxidation Inhibition Blunts Nuclear Factor-{kappa}B Activation, Reduces Skeletal Muscle Degeneration, and Enhances Muscle Function in mdx Mice Am. J. Pathol., March 1, 2006; 168(3): 918 - 926. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Marsik, M. Graninger, N. Mackman, B. Osterud, T. Luther, and B. Jilma Effects of enalapril on disseminated intravascular thrombin formation during systemic inflammation Cardiovasc Res, October 15, 2003; 60(1): 131 - 135. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||












