Skip Navigation

Cardiovascular Research 2002 54(3):669-675; doi:10.1016/S0008-6363(02)00257-2
© 2002 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Bauersachs, J.
Right arrow Articles by Fleming, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bauersachs, J.
Right arrow Articles by Fleming, I.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2002, European Society of Cardiology

Cytochrome P450 2C expression and EDHF-mediated relaxation in porcine coronary arteries is increased by cortisol

J. Bauersachsa,*, M. Christb, G. Ertla, U.R. Michaelisc, B. Fisslthalerc, R. Bussec and I. Flemingc

aMedizinische Klinik der Julius-Maximilians-Universität Würzburg, Joseph-Schneider-Str. 2, D-97080 Würzburg, Germany
bKlinik für Innere Medizin-Kardiologie, Philipps-Universität Marburg, Marburg, Germany
cInstitut für Kardiovaskuläre Physiologie, Klinikum der J. W. Goethe-Universität, Frankfurt/Main, Germany

* Corresponding author. Tel.: +49-931-201-59111; fax: +49-931-201-5302 j.bauersachs{at}medizin.uni-wuerzburg.de

Received 21 December 2001; accepted 22 January 2002


    Abstract
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 Acknowledgments
 References
 
Objectives/methods: In addition to nitric oxide (NO) and prostacyclin, endothelium-dependent dilation is mediated by the endothelium-derived hyperpolarizing factor (EDHF) which, in the coronary circulation, has been characterised as a metabolite of arachidonic acid synthesised by an cytochrome P450 (CYP) epoxygenase homologous to CYP 2C8/9. As the promotor regions of CYP 2C8 and 2C9 contain consensus sequences for glucocorticoid response elements, we determined the effect of cortisol on EDHF-mediated relaxations as well as on the expression of CYP 2C in isolated segments of porcine coronary artery. Results: Bradykinin-induced NO-mediated relaxation of KCl-constricted arterial rings was slightly attenuated following exposure to cortisol. However, EDHF-mediated relaxations of U46619 [GenBank] -constricted arterial rings assessed in the presence of the cyclo-oxygenase inhibitor diclofenac and the NO synthase inhibitor N{omega}nitro-L-arginine (0.3 mM), were significantly enhanced (maximum relaxation: 66±7%, P<0.05 vs. control rings: 36±8%). Cortisol treatment (0.1 µM, 24 h) did not affect the endothelium-independent relaxation elicited by sodium nitroprusside and acute incubation with cortisol (0.1 µM, 30 min) did not alter either NO- or EDHF-mediated responses. The expression of CYP 2C (quantified by RT-PCR, Western blot analysis and confocal microscopy) was enhanced in porcine coronary endothelial cells following incubation with cortisol for 18–24 h. Conclusions: These results demonstrate the concomitant upregulation of EDHF-mediated relaxations and CYP 2C expression by long-term treatment with cortisol. These observations support the concept that an epoxygenase homologous to CYP 2C8/9 plays a crucial role in the generation of EDHF-mediated responses in the coronary endothelium.

KEYWORDS Endothelial function; Endothelial factors; Coronary circulation; Vasoconstriction/dilation; Nitric oxide


    1 Introduction
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 Acknowledgments
 References
 
Local vascular tone is generally determined by a variety of factors such as neuro-transmitters released from autonomic nerves, circulating vasoactive compounds, tissue metabolites and endothelium-derived autacoids. The best characterised autacoids are the potent vasodilators nitric oxide (NO) and prostacyclin (PGI2) and the vasoconstrictor peptide endothelin. Several studies have, however, convincingly demonstrated the existence of an NO/PGI2-independent component of endothelium-dependent relaxation in various arterial beds. Since the NO/PGI2-independent vasodilatation originally described was coincident with vascular smooth muscle hyperpolarisation, and was abolished by depolarising concentrations of potassium, it was proposed to be mediated by an endothelium-derived hyperpolarizing factor or ‘EDHF’ [1].

The link between cytochrome P450 (CYP) activity and the generation of an EDHF has been intensively investigated over the last decade. Several EDHFs, demonstrating distinct pharmacological properties, have been reported in different vascular beds and in different species but the hyperpolarizing factor produced by coronary and renal arteries from humans, pigs, cows, dogs, rats and rabbits displays characteristics similar to those of a CYP-derived metabolite of arachidonic acid [2–13]. Endothelial CYP enzymes generate epoxyeicosatrienoic acids (5,6-; 8,9-; 11,12- and 14,15-EET) which elicit hyperpolarization by activating large conductance calcium-dependent K+ (K+Ca) channels [7,14], as well as the Na-K-ATPase [15].

Originally, a role for CYP-dependent metabolites of arachidonic acid in EDHF-mediated responses was implied on the basis of the fact that CYP inhibitors, such as clotrimazole, miconazole and 17-octadecynoic acid, markedly attenuated NO/PGI2-independent hyperpolarization and relaxation in a number of vascular preparations. Recently, data relying on techniques other than the pharmacological inhibition of CYP have considerably strengthened the hypothesis that CYP activation is an integral component of the EDHF response in coronary arteries [16,17]. Indeed, incubation of porcine coronary arteries with antisense, but not sense or scrambled, oligonucleotides against CYP 2C8/9, markedly reduced the endothelial expression of CYP 2C protein and attenuated bradykinin-induced, EDHF-mediated hyperpolarization and relaxation [16]. A similar approach was used to show that EDHF-mediated responses in isolated resistance arteries from hamster gracilis muscle can also be attributed to the activation of a CYP 2C epoxygenase homologous to CYP 2C8/9 [18].

Little is known about the mechanisms controlling the expression of CYP 2C in endothelial cells, although enzyme expression is reported to be enhanced by cyclic stretch [19]. As the promoter regions of both CYP 2C8 and CYP 2C9 contain consensus sequences for glucocorticoid response elements [20] the aim of the present investigation was to determine the consequences of long- and short-term exposure of endothelial cells to corticosteroids on the expression of CYP 2C as well as on EDHF-mediated relaxation of isolated porcine coronary arteries.


    2 Methods
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 Acknowledgments
 References
 
2.1 Organ culture and vascular reactivity studies
Porcine coronary arteries (obtained from the local slaughterhouse) were cleaned of connective tissue and cut into rings (3–4 mm in length). Rings were then incubated in Medium 199 (cc pro, Neustadt, Germany) containing polymyxin B (100 U/ml) and either cortisol (0.1 µM), estradiol (0.1 µM), aldosterone (0.1 µM), or solvent (ethanol, concentration<0.01%) for 24 h. Thereafter, rings were mounted in organ baths (Föhr Medical Instruments, Seeheim, Germany) containing oxygenated (95% O2; 5% CO2) Krebs–Henseleit solution (pH 7.4, 37 °C) of the following composition: NaCl 118 mM, KCl 4.7 mM, MgSO4 1.2 mM, CaCl2 1.6 mM, K2HPO4 1.2 mM, NaHCO3 25 mM, glucose 12 mM, and the cyclo-oxygenase inhibitor diclofenac (1 µM), for isometric force measurement as described [21]. Following equilibration for 30 min under a resting tension of 3 g, rings were repeatedly contracted with KCl (100 mM) until reproducible responses were obtained. Thereafter, the rings were preconstricted with the thromboxane mimetic U46619 [GenBank] (10–100 µM) to about 70% of the maximal constriction and the relaxation to cumulative doses of bradykinin (0.1 nM–1 µM) and to sodium nitroprusside (1 nM–1 µM) was assessed with or without prior inhibition of NO synthase using N{omega}nitro-L-arginine (L-NA, 0.3 mM, 30 min). For the determination of acute effects, cortisol (0.1 µM), estradiol (0.1 µM), aldosterone (0.1 µM), or solvent (ethanol, concentration<0.01%) were applied to the organ chamber for 30 min.

2.2 Expression studies
Porcine epicardial artery segments (40 mm long) were excised, side branches were sealed with surgical clips, and the segments were cannulated at both ends, placed into vessel chambers and perfused with MEM containing either solvent or cortisol (0.1 µM, 18–24 h). Endothelial cells or total RNA were isolated through intraluminal incubation with either dispase (2.4 U/ml) or guanidine isothiocyanate. Random hexanucleotide primers were used for reverse transcription (RT) of equal amounts of RNA as described [17]. The oligonucleotides used for polymerase chain reaction (PCR) were derived from a porcine CYP 2C34 sequence (Genebank accession no.: U35843 [GenBank] ), upstream primer: AGACAACGAGCACCACTCTG, downstream primer: CTTGGGGATGAGGTAGTTT) which exhibited a high homology to the human 2C8 sequence (Genebank accession no.: Y00498 [GenBank] ) and elongation factor (EF-2) upstream primer: GACATCACCAAGGGTGTGCAG, downstream primer: GCGGTCAGCACACTGGCATA.

PCR products were separated on a agarose gel and visualized by staining with ethidium bromide. For the verification of the DNA fragment, the PCR-products were transferred to nylon membranes and hybridized with 32P-labelled DNA fragments derived from a plasmid containing the coding sequence of CYP 2C8. Phenol-soluble protein or microsomal fractions (100 000 g pellets) prepared from isolated porcine coronary endothelial cells were subjected to SDS–PAGE (8%) and Western blotting using a polyclonal antibody generated using a CYP 2C9 peptide sequence (54-3-669LPPGPTPLPIC).

2.3 Immunofluorescence experiments
After treatment with solvent or cortisol, coronary artery segments were fixed with formaldehyde (2% in phosphate buffered saline). Following extensive washing the segments were permeabilised with Triton X-100 (0.2%) and incubated in glycine (100 mM) for 10 min. Thereafter, segments were co-incubated with a specific polyclonal CYP 2C antibody (kindly provided by Dr E. Morgan, Atlanta) and a monoclonal actin antibody (Sigma) for 2 h, Following incubation with fluorescein and Texas Red-coupled secondary antibodies (Dianova, Hamburg, Germany) for 60 min, the preparations were mounted and viewed using a confocal microscope.

2.4 Materials
All chemicals were obtained in the highest purity available from Sigma (Deisenhofen, Germany).

2.5 Statistics
Relaxations are given as percentage of the response to U46619. [GenBank] All data in the figures and in the text are expressed as mean±S.E.M. of n experiments with segments from different arteries. Statistical analysis was performed by one-way analysis of variance (ANOVA) followed by a Bonferroni t-test or by the two-tailed Student's t-test for unpaired data, where appropriate. Differences were considered to be statistically significant when P<0.05.


    3 Results
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 Acknowledgments
 References
 
3.1 Vasodilator responses
In coronary rings pre-contracted with U46619 [GenBank] in the presence of diclofenac, bradykinin elicited concentration-dependent relaxations, which were slightly enhanced in rings exposed to cortisol (0.1 µM) for 24 h (Fig. 1A).


Figure 1
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Bradykinin-induced relaxations of porcine coronary arteries during contractions to U46619 in control solution (A, NO- plus EDHF-mediated relaxation), in the presence of NG-nitro-L-arginine (0.3 mM, B, EDHF-mediated relaxation) and during constriction with KCl (C, NO-mediated relaxation). The rings were incubated for 24 h either with cortisol (0.1 µM, bullet), or with control medium ({circ}). The results are expressed as the mean±S.E.M. from eight to 10 separate experiments. The asterisk indicates statistically significant differences with control (P<0.05).

 
Inclusion of L-NA in the organ chamber to inhibit NO production and reveal that component of the response mediated by an EDHF, attenuated the maximal bradykinin-induced relaxation (Fig. 1B). However, in cortisol-treated coronary artery rings the maximal L-NA- and diclofenac-resistant relaxation was significantly greater than that observed in rings incubated for 24 h in the absence of the steroid.

In arterial rings precontracted with KCl to inhibit the effects of EDHF, cortisol treatment slightly, albeit not significantly, diminished bradykinin-induced, NO-mediated relaxations (Fig. 1C).

Sodium nitroprusside elicited a concentration-dependent relaxation of coronary artery rings which was not affected by prolonged incubation with cortisol (0.1 µM, Fig. 2A).


Figure 2
View larger version (18K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 (A) Sodium nitroprusside (SNP)-induced relaxations of porcine coronary arteries constricted with the thromboxane mimetic U46619. The rings were incubated for 24 h either with cortisol (0.1 µM, bullet), or with control medium ({circ}). (B) Bradykinin-induced, EDHF-mediated relaxation of porcine coronary arteries constricted with the thromboxane mimetic U46619 in the presence of NG-nitro-L-arginine (0.3 mM, 30 min). The rings were either incubated for 30 min with cortisol (0.1 µM, bullet), or with vehicle ({circ}). The results are expressed as the mean±S.E.M. from six to eight separate experiments.

 
Short-term exposure to cortisol (0.1 µM, 30 min) did not affect the relaxation of coronary arteries elicited by sodium nitroprusside or bradykinin (Fig. 2B).

Neither short-term nor long-term exposure to estradiol or aldosterone had any effect on endothelium-dependent or -independent vascular reactivity (data not shown).

3.2 Expression of cytochrome P450
Low levels of CYP 2C mRNA were expressed in porcine coronary endothelial cells recovered from arterial segments incubated for 24 h under control conditions. Cortisol (0.1 µM, 24 h) increased the expression of CYP 2C mRNA and protein (Fig. 3).


Figure 3
View larger version (65K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Effect of cortisol on the expression of CYP 2C in native porcine coronary artery endothelial cells. Segments of porcine coronary artery were incubated with either solvent or cortisol (0.1 µM) for 24 h. Thereafter, endothelial cells were isolated and CYP 2C expression assessed using (A) RT-PCR and Southern blotting or (B) by Western blot analysis. The results shown are representative of data obtained in two additional experiments. CTL, control; nc, negative control (no reverse transcriptase); pc, positive control (porcine liver extract); EF, elongation factor.

 
Confocal microscopy was used to localise the expression of CYP 2C within the vessel wall. These experiments showed that in porcine coronary artery segments, CYP 2C9 is expressed exclusively in the endothelial cell layer (Fig. 4). No CYP 2C immunostaining was detected in either smooth muscle cells or in the adventitia. Exposure of coronary segments to cortisol, markedly increased the CYP 2C fluorescent signal when compared with that observed in vessels which were perfused in the absence of the steroid.


Figure 4
View larger version (84K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Effects of cortisol on the expression of CYP 2C in native coronary artery endothelial cells. Immunohistochemical staining using confocal microscopy of CYP 2C (green fluorescence) and actin (red) in sections of the same porcine coronary artery 18 h after treatment with solvent or cortisol (0.1 µM). The results presented are representative of data obtained in two further experiments. Arteries were fixed and prepared as described in Methods.

 

    4 Discussion
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 Acknowledgments
 References
 
The results of the present study demonstrate that chronic, but not acute, treatment of porcine coronary arteries with cortisol markedly increases the expression of CYP 2C mRNA and protein in endothelial cells. Moreover, cortisol-treatment selectively enhanced the endothelium-dependent, NO/PGI2-independent (EDHF-mediated) relaxation elicited by bradykinin, without significantly affecting either NO-mediated relaxation or endothelium-independent relaxation to a nitrovasodilator. In contrast, exposure to estradiol or aldosterone did not affect endothelium-dependent or -independent vascular reactivity.

Our data demonstrate that the long-term incubation of porcine coronary arteries with cortisol significantly enhanced bradykinin-induced EDHF-mediated relaxation. The enhanced EDHF-mediated relaxation induced by cortisol treatment was accompanied by an increased expression of CYP 2C mRNA and protein in porcine coronary artery endothelial cells as demonstrated by two different approaches. Firstly, in native endothelial cells isolated from porcine coronary arteries perfused for 18 h, Western blotting as well as RT-PCR revealed a cortisol-induced up-regulation of CYP 2C expression. Secondly, immunofluorescent analysis using a specific antibody against CYP 2C demonstrated that prolonged incubation with cortisol selectively increased the fluorescence signal in endothelial cells. The effect of cortisol is therefore comparable to that of nifedipine, which induced a parallel increase in the expression of CYP 2C, EET generation and EDHF-mediated responses [17]. Although it was not possible to demonstrate a one to one relation between EDHF and CYP 2C in the present study, our results support the hypothesis that CYP 2C plays a crucial role in mediating EDHF-dependent relaxation. The functional consequences of endothelial CYP2C/EDHF synthase regulation by cortisol are potentially wide reaching, since in addition to activating K+Ca channels and modulating arterial tone, the EETs regulate multiple endothelial and smooth muscle signalling pathways and may promote both endothelial cell proliferation [22] and angiogenesis [23] as well as exerting potent anti-inflammatory properties [24].

Native and cultured endothelial cells express the arachidonic acid epoxygenases, CYP 2J and CYP 2C [16,17,24,25]. While CYP 2J is constitutively expressed in cultured endothelial cells, CYP 2C levels are highly variable and often no signal is detectable using RT-PCR. For example, although native porcine coronary artery endothelial cells clearly express CYP 2C protein, CYP 2C mRNA and protein are barely detectable in primary cultures of these cells when maintained under static conditions [16,17]. The particular interest in CYP 2C is related to the fact that enhancing endothelial CYP 2C expression enhances EDHF-mediated responses [16] and that CYP-derived EETs hyperpolarize and relax porcine coronary arteries [7,8,17]. The changes in CYP 2C expression do not occur concomitantly with changes in the expression of any of the other endothelial epoxygenases identified to date. Therefore although CYP 2J potentially generates EETs in endothelial cells there is no evidence linking its activity or expression to the regulation of vascular tone by an EDHF-dependent mechanism.

Cortisol-treatment had no effect on endothelium-independent relaxation, but slightly attenuated the NO-mediated relaxation of arterial rings contracted with KCl. A number of mechanisms may account for this finding. For example, cortisol may affect the expression of the endothelial NO synthase (eNOS) and dexamethasone-induced hypertension has previously been linked with attenuated eNOS expression in rats [26]. However, we did not observe an alteration of eNOS expression in porcine aortic endothelial cells after chronic treatment with cortisol [27], and endothelial NO synthase activity is reported not to be affected by exposure to corticosteroids [28]. However, as reactive oxygen species are generated by CYP 2C8/9 and radical production is enhanced by agonist stimulation [29], it appears more likely that cortisol treatment attenuated the bioavailability of NO as a consequence of the CYP-dependent generation of oxygen-derived radicals.

In contrast to the effect of prolonged cortisol incubation, the acute addition of cortisol to arterial rings in the organ chamber was without effect on EDHF-mediated relaxation. This absence of an acute effect of cortisol on vascular reactivity implies that the increase in CYP 2C expression/EDHF-mediated relaxation is mediated by genomic actions of the steroid. This observation is consistent with reports of multiple consensus sequences for glucocorticoid regulatory elements in the CYP 2C8/9 promoter region [20], the CYP enzymes thought to be highly homologous with the enzyme expressed in porcine endothelial cells [30]. There is little additional information concerning the regulation of the CYP 2C8/9 promoter, apart from the identification of a novel transcriptional silencer [31]. It is however likely that numerous transcription factors regulate CYP 2C expression as CYP 2C has recently been identified as a mechanosensitive gene product and prolonged exposure to a physiological level of cyclic stretch can profoundly increase CYP 2C mRNA and protein expression [19].

The observation of increased CYP 2C expression by cortisol is of considerable clinical relevance. In patients treated with glucocorticoids, enhanced EET generation may not only contribute to anti-inflammatory properties of cortisol [24], but also enhance endothelial-dependent vasodilator capacity and angiogenesis [23].

In conclusion, we have demonstrated the concomitant upregulation of EDHF-mediated relaxation and CYP 2C8/9 expression by prolonged treatment with cortisol. These observations support the concept that an epoxygenase homologous to CYP 2C8/9 plays a crucial role in the generation of EDHF-mediated responses in the coronary endothelium.

Time for primary review 21 days.


    Acknowledgments
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 Acknowledgments
 References
 
This study was supported by the Heinrich and Fritz Riese-Stiftung, Deutsche Forschungsgemeinschaft (FI 830/1-1; SFB 355, B10) and by the Institut de Recherches Internationales Servier. The authors are indebted to Claudia Liebetrau and Stergiani Hauk for expert technical assistance.


    References
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 Acknowledgments
 References
 

  1. Quilley J., Fulton D., McGiff J.C. Hyperpolarizing factors. Biochem Pharmacol (1997) 54:1059–1070.[CrossRef][Web of Science][Medline]
  2. Hecker M., Bara A., Bauersachs J., Busse R. Characterization of endothelium-derived hyperpolarizing factor as a cytochrome P450-derived arachidonic acid metabolite in mammals. J Physiol (Lond) (1994) 481(2):407–414.[Abstract/Free Full Text]
  3. Miura H., Guttermann D.D. Human coronary arteriolar dilation to arachidonic acid depends on cytochrome P-450 monoxygenase and Ca2+-activated K+ channels. Circ Res (1998) 83:501–507.[Abstract/Free Full Text]
  4. Miura H., Wachtel R.E., Liu Y., et al. Flow-induced dilation of human coronary arterioles: important role of Ca2+-activated K+ channels. Circulation (2001) 103:1992–1998.[Abstract/Free Full Text]
  5. Bauersachs J., Hecker M., Busse R. Display of the characteristics of endothelium-derived hyperpolarizing factor by a cytochrome P450-derived arachidonic acid metabolite in the coronary microcirculation. Br J Pharmacol (1994) 113:1548–1553.[Web of Science][Medline]
  6. Fulton D., Mahboubi K., McGiff J.C., Quilley J. Cytochrome P450-dependent effects of bradykinin in the rat heart. Br J Pharmacol (1995) 114:99–102.[Web of Science][Medline]
  7. Campbell W.B., Gebremedhin D., Pratt P.F., Harder D.R. Identification of epoxyeicosatrienoic acids as endothelium-derived hyperpolarizing factors. Circ Res (1996) 78:415–423.[Abstract/Free Full Text]
  8. Popp R., Bauersachs J., Hecker M., Fleming I., Busse R. A transferable, β-naphthoflavone-inducible, hyperpolarising factor is synthesised by porcine coronary endothelial cells. J Physiol (Lond) (1996) 497:699–709.[Abstract/Free Full Text]
  9. Arima S., Endo Y., Yohita H., et al. Possible role of P-450 metabolite of arachidonic acid in vasodilator mechanism of angiotensin II type 2 receptor in the isolated microperfused rabbit afferent arteriole. J Clin Invest (2001) 100:2816–2823.[CrossRef]
  10. Weintraub N.L., Fang X., Kaduce T.L., et al. Potentiation of endothelium-dependent relaxation by epoxyeicosatrienoic acids. Circ Res (1997) 81:258–267.[Abstract/Free Full Text]
  11. Fulton D., McGiff J.C., Quilley J. Pharmacological evaluation of an epoxide as the putative hyperpolarizing factor mediating the nitric oxide-independent vasodilator effect of bradykinin in the rat heart. J Pharmacol Exp Ther (1998) 287:497–503.[Abstract/Free Full Text]
  12. Miura H., Liu Y., Guttermann D.D. Human coronary arteriolar dilation to bradykinin depends on membrane hyperpolarization. Contribution of nitric oxide and Ca2+-activated K+ channels. Circulation (1999) 99:3132–3138.[Abstract/Free Full Text]
  13. Nikishawa Y., Stepp D.W., Chilian W.M. In vivo location and mechanism of EDHF-mediated vasodilation in canine coronary microcirculation. Am J Physiol (1999) 277:H1252–H1259.[Web of Science][Medline]
  14. Hu S., Kim H.S. Activation of K+ channel in vascular smooth muscles by cytochrome P450 metabolites of arachidonic acids. Eur J Pharmacol (1993) 230:215–221.[CrossRef][Web of Science][Medline]
  15. Pratt P.F., Li P., Hillard C.J., Kurian J., Campbell W.B. Endothelium-independent, ouabain-sensitive relaxation of bovine coronary arteries by EETs. Am J Physiol Heart Circ Physiol (2001) 280:H1113–H1121.[Abstract/Free Full Text]
  16. Fisslthaler B., Popp R., Kiss L., et al. Cytochrome P450 2C is an EDHF synthase in coronary arteries. Nature (1999) 401:493–497.[CrossRef][Medline]
  17. Fisslthaler B., Hinsch N., Chataigneau T., et al. Nifedipine increases cytochrome P4502C expression and EDHF-mediated responses in coronary arteries. Hypertension (2000) 36:270–275.[Abstract/Free Full Text]
  18. Bolz S.S., Fisslthaler B., Pieperhoff S., et al. Antisense oligonucleotides against cytochrome P450 2C8 attenuate EDHF-mediated Ca(2+) changes and dilation in isolated resistance arteries. FASEB J (2000) 14:255–260.[Abstract/Free Full Text]
  19. Fisslthaler B., Popp R., Michaelis U., et al. Cyclic stretch enhances the expression and activity of the coronary endothelium-derived hyperpolarizing factor synthase. Hypertension (2001) 38:1427–1432.[Abstract/Free Full Text]
  20. Morais S.M., Schweikl H., Blaisdell J., Goldstein J.A. Gene structure and upstream regulatory regions of human CYP2C9 and CYP2C18. Biochem Biophys Res Commun (1993) 194:194–201.[CrossRef][Web of Science][Medline]
  21. Bauersachs J., Fleming I., Scholz D., Popp R., Busse R. Endothelium-derived hyperpolarizing factor, but not nitric oxide, is reversibly inhibited by Brefeldin A. Hypertension (1997) 30:1598–1605.[Abstract/Free Full Text]
  22. Fleming I., Fisslthaler B., Michaelis U., Kiss L., Popp R., Busse R. The coronary EDHF stimulates multiple signalling pathways and proliferation in vascular cells. Pflug Arch Eur J Physiol (2001) 442:511–518.[CrossRef][Web of Science][Medline]
  23. Munzenmeier D.H., Harder D.R. Cerebral microvascular endothelial cell tube formation: role of astrocytic epoxyeicosatrienoic acid release. Am J Physiol Heart Circ Physiol (2000) 278:H1163–H1167.[Abstract/Free Full Text]
  24. Node K., Huo Y., Ruan X., et al. Anti-inflammatory properties of cytochrome P450 epoxygenase-derived eicosanoids. Science (1999) 285:1276–1279.[Abstract/Free Full Text]
  25. Lin J.H.C., Kobari Y., Zhu Y., Stemermann M.B., Pritchard K.A. Jr. Human umbilical vein endothelial cells express P450 2C8 mRNA: cloning of endothelial P450 epoxygenase. Endothelium (1998) 4:219–229.[CrossRef]
  26. Wallerath T., Witte K., Schafer S.C., et al. Down-regulation of the expression of endothelial NO synthase is likely to contribute to glucocorticoid-mediated hypertension. Proc Natl Acad Sci USA (1999) 96:13357–13362.[Abstract/Free Full Text]
  27. Christ M, Bauersachs J, Heck M, Wehling M. Glucocorticoids attenuate endothelial-dependent, NO-mediated vasodilation by modulation of receptor-dependent calcium-signaling. Circulation 1999;100(Suppl 1):I-416.
  28. Radomski M.W., Palmer R.M.J., Moncada S. Glucocorticoids inhibit the expression of an inducible, but not the constitutive, nitric oxide synthase in vascular endothelial cells. Proc Natl Acad Sci USA (1990) 87:10043–10047.[Abstract/Free Full Text]
  29. Fleming I., Michaelis U.R., Bredenkotter D., et al. Endothelium-derived hyperpolarizing factor synthase (Cytochrome P450 2C9) is a functionally significant source of reactive oxygen species in coronary arteries. Circ Res (2001) 88:44–51.[Abstract/Free Full Text]
  30. Ged C., Beaune P. Isolation of the human cytochrome P-450 IIC8 gene: multiple glucocorticoid responsive elements in the 5' region. Biochim Biophys Acta (1991) 1088:433–435.[Medline]
  31. Xiang S., Parsons H.K., Murray M. Identification of a novel transcriptional silencer in the protein coding region of the human CYP2C9 gene. Gene (1998) 209:123–129.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
IOVSHome page
U. R. Michaelis, N. Xia, E. Barbosa-Sicard, J. R. Falck, and I. Fleming
Role of Cytochrome P450 2C Epoxygenases in Hypoxia-Induced Cell Migration and Angiogenesis in Retinal Endothelial Cells
Invest. Ophthalmol. Vis. Sci., March 1, 2008; 49(3): 1242 - 1247.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
H. Wang, Y. Zhao, J. A. Bradbury, J. P. Graves, J. Foley, J. A. Blaisdell, J. A. Goldstein, and D. C. Zeldin
Cloning, Expression, and Characterization of Three New Mouse Cytochrome P450 Enzymes and Partial Characterization of Their Fatty Acid Oxidation Activities
Mol. Pharmacol., May 1, 2004; 65(5): 1148 - 1158.
[Abstract] [Full Text]


Home page
CirculationHome page
S. Fichtlscherer, S. Dimmeler, S. Breuer, R. Busse, A. M. Zeiher, and I. Fleming
Inhibition of Cytochrome P450 2C9 Improves Endothelium-Dependent, Nitric Oxide-Mediated Vasodilatation in Patients With Coronary Artery Disease
Circulation, January 20, 2004; 109(2): 178 - 183.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
T. Thum and J. Borlak
Mechanistic Role of Cytochrome P450 Monooxygenases in Oxidized Low-Density Lipoprotein-Induced Vascular Injury: Therapy Through LOX-1 Receptor Antagonism?
Circ. Res., January 9, 2004; 94 (1): e1 - e13.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Coll. Nutr.Home page
S. Viswanathan, B. D. Hammock, J. W. Newman, P. Meerarani, M. Toborek, and B. Hennig
Involvement of CYP 2C9 in Mediating the Proinflammatory Effects of Linoleic Acid in Vascular Endothelial Cells
J. Am. Coll. Nutr., December 1, 2003; 22(6): 502 - 510.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
B. M. Mitchell, A. M. Dorrance, and R. C. Webb
GTP Cyclohydrolase 1 Downregulation Contributes to Glucocorticoid Hypertension in Rats
Hypertension, March 1, 2003; 41(3): 669 - 674.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Bauersachs, J.
Right arrow Articles by Fleming, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bauersachs, J.
Right arrow Articles by Fleming, I.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?