Skip Navigation

Cardiovascular Research 2002 53(4):1029-1034; doi:10.1016/S0008-6363(01)00534-X
© 2002 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Vickers, M. A
Right arrow Articles by Keavney, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vickers, M. A
Right arrow Articles by Keavney, B.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2002, European Society of Cardiology

Genotype at a promoter polymorphism of the interleukin-6 gene is associated with baseline levels of plasma C-reactive protein

Mark A Vickersa,1, Fiona R Greenb,1, Catherine Terryb, Bongani M Mayosib, Cecile Julierc, Mark Lathropd, Peter J Ratcliffee, Hugh C Watkinsb and Bernard Keavneyf,*

aDepartment of Medicine and Therapeutics, University of Aberdeen, Aberdeen, UK
bDepartment of Cardiovascular Medicine, Oxford University, Oxford, UK
cInstitut Pasteur, Paris, France
dCentre National de Genotypage, Evry, France
eNuffield Department of Medicine, Oxford University, Oxford, UK
fInstitute of Human Genetics, University of Newcastle-upon-Tyne, Newcastle-upon-Tyne, UK

b.d.keavney{at}ncl.ac.uk

* Corresponding author. Institute of Human Genetics, International Centre for Life, Central Parkway, Newcastle-upon-Tyne NE1 3BZ, UK. Tel.: +44-191-2227-149; fax: +44-191-2220-723

Received 30 August 2001; accepted 2 November 2001


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
Objective: Baseline concentrations of plasma C-reactive protein (CRP) are associated with coronary heart disease. Interleukin-6 (IL-6) regulates CRP gene expression; a promoter polymorphism (–174G/C) of the IL-6 gene has been shown to influence IL-6 transcription but the relationship between genotype at this polymorphism and circulating levels of inflammatory markers remains unclear. We hypothesised that plasma CRP would be a heritable phenotype that would be influenced by genotype at this polymorphism. Methods: We measured baseline plasma CRP and determined genotypes at the –174G/C polymorphism of the IL-6 gene in 588 members of 98 nuclear families. The heritability of plasma CRP and the association of plasma CRP with genotype were determined using variance components methods. Results: Baseline CRP levels were highly heritable (h2=0.39, P<0.0000001). Presence of the –174C allele was associated with higher baseline CRP levels, both in the whole population (P=0.01), and in the founders only (n=128, P=0.001). Family-based analyses confirmed the association (P=0.02) suggesting that it arises from chromosomal proximity or identity of the typed polymorphism with a genetic variant influencing baseline CRP levels. Conclusions: Baseline plasma CRP is a significantly heritable cardiovascular risk factor. Levels are associated with genotype at the –174G/C polymorphism of the IL-6 gene.

KEYWORDS Atherosclerosis; Cytokines; Epidemiology; Infection/inflammation; Sequence (DNA/RNA/prot)


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
To date, 11 prospective studies involving a total of nearly 2000 cases of disease have demonstrated association between the baseline level of plasma C-reactive protein (CRP) and coronary heart disease (CHD) [1]. It is uncertain whether this association is causal; several mechanisms whereby CRP might directly influence atherogenesis have been proposed, but none has been proven [2]. Recent data from intervention trials also suggests that baseline CRP may be a useful marker to identify subjects without overt hyperlipidaemia or previous coronary events who may nevertheless derive benefit from statin therapy, which is thought to be due to a direct anti-inflammatory effect of statins on atheromatous plaques [3]. There is therefore considerable interest in establishing the degree to which baseline CRP is genetically determined, and in identifying genetic polymorphisms that are associated with CRP levels. Baseline plasma CRP levels (that is, plasma CRP levels measured in the absence of any clinically recognised pathology liable to stimulate the acute phase response) have very recently been reported to exhibit high heritability in one study [4], but no genetic polymorphisms associated with baseline levels of plasma CRP have yet been reported. If genetic variability between individuals could be shown to contribute substantially to the overall population variability of CRP, then CRP could potentially be used as an intermediate phenotype for genetic analysis that might be more tractable than the more complex phenotype of clinical CHD, which would be expected to result from a wider variety of genetic and environmental factors. Genetic variants associated with baseline levels of plasma CRP would be strong candidates as CHD susceptibility alleles.

Interleukin-6 (IL-6) is a major determinant of the acute phase response. Expression of the CRP gene during the acute-phase reaction is regulated by IL-6, although the importance of IL-6 in determining baseline plasma levels of CRP is unknown. Genotypes at a recently described polymorphism of the IL-6 promoter (–174G/C), which influences IL-6 gene transcription in vitro, have been examined for association with plasma IL-6 levels in a number of studies, but the results of these studies have been widely discrepant [5–9]. This may be chiefly as a result of random error in relatively modest sample sizes, but may also be partly due to the marked (sixfold) diurnal variability of plasma IL-6, which may limit the intra-individual replicability of plasma IL-6 measurements [10–12]. Baseline CRP concentrations are not subject to such circadian variation and show high reproducibility within individuals over a period of up to 5 years [13–15]. This may explain the apparent superiority of CRP to IL-6 as a predictor of vascular risk that has been observed in some prospective studies, and suggests that CRP may be a more suitable phenotype than IL-6 for investigation regarding any possible genetically determined level of baseline inflammatory activity that may contribute to the risk of atherothrombotic events [16,17]. The relationship between the IL-6 –174G/C polymorphism and baseline plasma CRP levels has been examined in some of those studies that investigated the association between genotype and plasma IL-6 levels. Although no evidence of an association has been found thus far, in some studies the sensitivity of the CRP assay used was limited [9], whilst in others all individuals enrolled were patients with established atherosclerotic disease which may itself have influenced the measured levels of plasma CRP [6,8].

All studies to date that have examined association between the IL-6 –174 G/C polymorphism and plasma levels of inflammatory markers have been conducted in unrelated individuals. Such studies are potentially susceptible to problems arising from genetic inhomogeneity of the study subjects; although the practical magnitude of this concern is uncertain, it can be avoided if families are studied [18]. Additionally, family studies offer the advantages that they permit the heritability of a phenotype to be estimated, and the requirement for Mendelian transmission provides an in-built check on genotyping accuracy.

We hypothesised that plasma CRP would be a heritable phenotype influenced by the IL-6 –174G/C polymorphism, and have tested this in a large family study.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
2.1. Family collection
Ninety-eight British Caucasian families were ascertained on a proband with essential hypertension found to be in the top 5% of the population blood pressure distribution before the age of 65 years. Probands were identified from a hospital hypertension service or via their family physicians. Families of the probands were collected when a sibship of three members available for phenotyping and blood sampling was available, if a parent of the sibship was also available for blood sampling. When no parent was available, a sibship of four was required. The sibship could be in the generation of the proband or of his/her offspring, and when suitable sibships existed in both generations, they were both collected. There was no requirement for any member of the family other than the proband to be classified as hypertensive. However, when a member of a sibship so collected could be determined to be hypertensive (by the same criteria as the probands), then, if a suitable sibship existed in the generation of his/her offspring, that sibship was also collected.

Research personnel administered a detailed questionnaire regarding current and previous health, including the presence of any acute or chronic inflammatory conditions, to all participants. Height, weight and blood pressure (using a Takeda TM2421 automated sphygmomanometer) were measured in all subjects. Blood was drawn for baseline biochemical analysis and urine dipstick testing for haematuria and albuminuria was carried out. All proband and family data were clinically evaluated by one of the investigators (B.K.) to detect the presence of secondary hypertension, including Mendelian forms of genetic hypertension; where this could not be confidently excluded in a family, the family was excluded from the study.

The study conforms with the principles outlined in the Declaration of Helsinki.

2.2. Genotyping
The G/C polymorphism at position –174 of the interleukin-6 gene was typed by polymerase chain reaction (PCR) amplification using primer pairs 5'CACTCCACCTGGAGACGCCT3'and 5'TCCCTCACACAGGGCTCGAC3' under standard conditions using 2 mM MgCl2, followed by restriction digestion with NlaIII and agarose gel electrophoresis. Control individuals of known genotype were included in each plate, and genotyping was carried out blinded to plasma CRP levels. Mendelian inheritance within families was confirmed using the PedCheck programme [19] and inconsistencies resolved by re-examination of the raw data, and re-genotyping where necessary.

2.3. CRP measurement
Baseline CRP levels were determined by enzyme-linked immunosorbent assay (ELISA) in plasma anticoagulated with 1:10 0.32% trisodium citrate. Both capture and detection antibodies were rabbit polyclonal anti-human CRP antibodies (Dako), the latter conjugated with horseradish peroxidase. Binding was visualised with urea hydrogen peroxide and 3,3',5,5'-tetramethylbenzidine. The reaction was calibrated against international standard 85/506 CRP (NIBSC), threefold serially diluted over a range of 0.1 to 0.00123 mg/l although the range from which samples were read was usually 0.033–0.0037 mg/l. Samples were initially tested at three threefold serially diluted concentrations and each dilution tested in duplicate. For the reading to be valid two of the dilutions had to lie within the appropriate portion of the standard curve and had to be within 10% of one another. If these conditions were not met, the assay was repeated at more appropriate dilutions. The intra-plate relative standard deviation (RSD) was measured by measuring CRP in an aliquoted normal plasma pool on single plates using all available positions. Each sample plate measured at least three dilutions of normal pool and these values were used to correct for differences between plates. The inter-plate RSD was calculated by comparing valid values obtained for samples between plates; each plate had an average of 14.3 comparisons made with other plates. The intra- and inter-assay RSDs were 10.4 and 15.9%, respectively. The lower detection limit of the assay was 0.02 mg/l. Samples were assayed without regard to family relationships to avoid systematic bias.

2.4. Statistical methods
The presence and significance of covariates of log plasma CRP was assessed by stepwise linear regression using SPSS statistical software (SPSS). Log CRP levels were analysed for association with genotype in the entire population and, separately, in the founders of the families only (i.e., those whose parents did not appear in the pedigree) by analysis of variance. Family-based tests of association of log plasma CRP with the typed marker were carried out using a variance components approach implemented in the QTDT program [20]. The heritability of log plasma CRP was determined using SOLAR [21].


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
The 98 families comprised 588 members with reliable measurements of baseline plasma CRP and genotype information. Seventy-five percent of families comprised between four and seven available members. Characteristics of the subjects studied are shown in Table 1. CRP levels corresponded closely with those described in other populations without inflammatory disease (median 1.26 mg/l, interquartile range 0.51–3.07 mg/l). CRP levels were skewed, and were therefore transformed for further analysis by taking the natural logarithm, which resulted in an approximately Normal distribution (Kolmogorov–Smirnov/Lillefors statistic=0.027, P=0.2; Fig. 1). No subject reported symptoms of current inflammatory disease that might have invalidated their baseline CRP measurement. Six subjects had previous histories of inflammatory conditions (inflammatory arthropathy in four cases and inflammatory bowel disease in two cases) that were clinically inactive at the time of blood collection. With one exception, all these subjects had CRP levels below the median. Analyses were conducted both including and excluding these individuals; the significance of the results was unaltered. Age and body mass index (BMI) were highly significant covariates of log CRP (P<0.001) while age-squared, sex, age-by-sex, and smoking were not (P>0.05 for all). Prior to adjustment for age and BMI, there was a trend towards association between systolic blood pressure and log plasma CRP (P=0.05); however, after adjustment for age and BMI, there was no significant association either between systolic or diastolic blood pressure as continuous variables and log CRP, or between hypertension affection status and log CRP (P>0.1 for all). Log CRP values were therefore adjusted for age and BMI by linear regression prior to genetic analysis. Since no significant relationship had been demonstrated between blood pressure, for which these families had been ascertained, and log CRP, no ascertainment correction was applied to the data. Log CRP adjusted for age and BMI was highly heritable in these families (h2=0.39, P<0.0000001).


View this table:
[in this window]
[in a new window]

 
Table 1 Characteristics of 588 subjects in 98 families studied

 

Figure 1
View larger version (31K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Distribution of log-transformed baseline plasma CRP in 98 families.

 
The frequency of the commoner G allele at the IL6 –174G/C polymorphism was 0.57 (in agreement with previous reports in Caucasian populations), and genotype frequencies did not differ significantly from Hardy–Weinberg proportions in the total population or in the 128 genotyped founders. Among 588 subjects with G/G, G/C and C/C genotypes, the age and BMI adjusted log CRP levels were 0.01 (S.E. 0.10), 0.29 (0.07) and 0.28 (0.16), respectively, suggesting that the C allele was behaving in a dominant fashion to increase log CRP (Fig. 2). As our initial hypothesis had been that any association would follow a codominant model, this model was tested first. There was significant evidence for association between genotypes and log CRP level in the whole population (F=3.348, P=0.036; Table 2) and in the founders (F=5.640, P=0.005; Table 2). However, under a dominant model (GG versus GC and CC), there was stronger evidence of association between genotype and log CRP level in the whole population (F=6.523, P=0.011; Table 2) and in the founders (F=11.33, P=0.001; Table 2). We accounted for multiple hypothesis testing by applying a Bonferroni correction for two analyses; following this, associations observed under the dominant model remained significant. Under the dominant model in the founders, genotype explained 14% of the observed variation in log plasma CRP. Family-based analyses using QTDT gave further support for association between genotype and log CRP (F=5.18, P=0.0232). There was a tendency towards higher baseline CRP levels in the founders (mean log CRP of 0.72 in founders compared with 0.05 in nonfounders) but after adjustment for age and BMI this difference was non-significant (P=0.38), and there was no evidence for heterogeneity between founders and non-founders regarding the influence of genotype on log CRP (P=0.4).


Figure 2
View larger version (10K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Relationship between log plasma CRP and genotype at interleukin-6 (–174) G/C polymorphism in 588 individuals.

 

View this table:
[in this window]
[in a new window]

 
Table 2 Association of IL-6-(-174) G/C polymorphism with log plasma CRP levels in entire population and founder individuals

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
Our study shows that baseline plasma CRP level is a highly heritable phenotype which is associated with genotype at the IL-6 –174G/C polymorphism. The high heritability (0.39) of baseline CRP that we have observed in families ascertained on a hypertensive proband closely agrees with a recent report by Pankow et al. [4] who studied randomly ascertained families and found a heritability of 0.35–0.4 for baseline CRP. This confirms the suitability of our families for such analyses, and indicates that CRP is determined to a significant degree by genetic factors rather than exclusively by random, individual-specific responses to concurrent inflammatory stimuli. In view of the association between CRP and atherothrombotic events, the high heritability of CRP suggests that CRP may have value as an intermediate phenotype in genetic studies of CHD susceptibility. In addition to our findings regarding the heritability of CRP, this study is the first to our knowledge that demonstrates association between any genetic polymorphism and the baseline plasma level of CRP. The study is also the largest thus far to investigate the relationship between the IL-6 –174 G/C polymorphism and any inflammatory cytokine. Its family-based design allows estimation of the heritability of plasma CRP, and acts as a control for population stratification.

The IL6 –174G/C polymorphism is a credible biological candidate for involvement in the regulation of the inflammatory response; it is situated close to a binding site for the glucocorticoid receptor and the nucleotide substitution creates a potential binding site for the transcription factor NF-1 [22]. However, previous population genetic studies are inconclusive regarding which of the alleles is associated with higher plasma levels of inflammatory cytokines. Fishman et al. showed in 92 healthy subjects that the mean plasma IL-6 level was lower in those of CC genotype than in those of GG or GC genotype (P=0.02), suggesting a recessive effect of the C allele in lowering plasma IL-6 [5]. However, Rauramaa et al. found no effect of the polymorphism on baseline plasma IL-6 levels in 92 asymptomatic males [7]. Subsequently Jones et al. presented data on 231 patients with abdominal aortic aneurysms and showed a borderline significant (P=0.047) codominant effect of the polymorphism on plasma IL-6 levels, the presence of the C allele being associated with higher plasma IL-6 levels in a codominant fashion [6]. That study also investigated the effect of genotype at this polymorphism on plasma CRP; no significant association was observed. Margaglione et al. found no association between genotype and plasma levels of either CRP or IL-6 in 598 randomly ascertained individuals, but the reproducibility of the plasma assays used in that study was low at lower levels of CRP and IL-6; this resulted in the use of the plasma phenotypes as dichotomous rather than continuous variables, which may have diminished the power of that study to detect any genetic effect [9]. Most recently, Brull et al. found no association between genotype and plasma IL-6 levels in a study of 127 patients undergoing CABG, although a recessive effect of the C allele to increase plasma IL-6 levels 6 h after CABG appeared to be present (P=0.04) [8]. Those studies that have examined clinical vascular phenotypes with respect to these genotypes have likewise tended to be discrepant: the C allele was associated with a lesser severity of carotid artery atherosclerosis in the study of Rauramaa et al., but it was associated with a higher cardiovascular mortality in aortic aneurysm patients in the study of Jones et al.

The reasons for the discrepancies among these other studies, and between those studies and the present study, are unclear. However, most of the previous studies have involved substantially smaller samples than the present study, and the levels of statistical significance of the observed associations have typically been modest, so the discrepancies may be due to random error. The tendency to random error may have been exacerbated by the marked diurnal variability of plasma IL-6, since timed samples were not taken in most of these studies. Some studies enrolled healthy individuals, whereas other studies enrolled patients with clinically apparent atherosclerotic disease, in whom the presence of the disease itself may have confounded any genetic influence on plasma CRP or IL-6 levels. All studies have all been performed in European Caucasian populations and the allele frequencies in these studies have been in good agreement with each other; however, only the present study has a family-based design, which can eliminate the risk of false-positive results due to undetected subtle population stratification. Our data show highly significant association between the C allele and baseline plasma CRP levels, and provide the strongest evidence so far for an effect of this polymorphism on the regulation of baseline plasma cytokine levels.

One limitation of our study is that plasma IL-6 levels were not measured (as it was not possible to obtain blood samples from all subjects at standardised times), which means that the mechanism of the association remains uncertain. We hypothesise that the IL-6 –174C allele increases baseline plasma CRP via an influence on IL-6 gene transcription and the consequent effects of differing levels of that cytokine on CRP gene expression. However, in the absence of IL-6 levels, alternative explanations, such as linkage disequilibrium between this polymorphism and others either within the IL-6 gene affecting IL-6 protein function rather than concentration, or within other genes neighbouring IL-6 that directly affect CRP gene transcription in other ways, cannot be ruled out. Further studies will therefore be necessary to clarify the mechanism of the association.

Somewhat surprisingly, we observed an apparent dominant effect of the C allele on baseline plasma CRP levels, which potentially invokes a threshold effect of IL-6 gene transcription on CRP levels. This does not diminish the likelihood of our result being correct: there are many examples of genetic effects on quantitative traits that are not co-dominant (for example, the association between the MTHFR C677T mutation and plasma homocysteine levels, which has been observed in over 5000 cases of cardiovascular disease and controls [23]). We typed a polymorphism in the IL-6 rather than the CRP gene: although some polymorphisms in the CRP gene have been described [24], none appear to be such good candidates as regulatory variants when compared with IL6 –174 G/C whose importance has been demonstrated in vitro [5,22]. However, in view of the current results, further investigations of the effect of haplotypes at both the IL-6 and CRP genes on baseline plasma levels of CRP would be of interest.

When robust associations such as that we describe between genetic polymorphisms and hypothesised novel cardiovascular risk factors such as baseline CRP can be identified, genotyping of such polymorphisms together with measurement of the novel factor in studies involving large numbers (several thousands) of cases of disease and healthy controls could potentially assist in determining whether such novel factors cause CHD. If the novel factor were causal, the polymorphism might be expected to show association with disease that would be of a magnitude commensurate with the sizes of the associations between polymorphism and risk factor, and between risk factor and disease. Moreover, since the differences in the risk factor were genetically determined, such differences in risk would be free of confounding. Our study thus also provides strong justification for the typing of this polymorphism together with plasma CRP measurement in suitable large case-control studies of cardiovascular events.

Time for primary review 22 days.


    Acknowledgments
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
Sources of Support: British Heart Foundation, Wellcome Trust, Medical Research Council.


    Notes
 
1 M.A.V. and F.R.G. contributed equally to this work. Back


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 

  1. Danesh J, Whincup P, Walker M, et al. Low grade inflammation and coronary heart disease: prospective study and updated meta-analyses. Br. Med. J. (2000) 321:199–204.[Abstract/Free Full Text]
  2. Lagrand W.K, Visser C.A, Hermens W.T, et al. C-Reactive protein as a cardiovascular risk factor: more than an epiphenomenon? Circulation (1999) 100:96–102.[Abstract/Free Full Text]
  3. Ridker P.M, Rifai N, Clearfield M, et al. Measurement of C-reactive protein for the targeting of statin therapy in the primary prevention of acute coronary events. New Engl J Med (2001) 344(26):1959–1965.[Abstract/Free Full Text]
  4. Pankow J.S, Folsom A.R, Cushman M, et al. Familial and genetic determinants of systemic markers of inflammation: the NHLBI family heart study. Atherosclerosis (2001) 154:681–689.[CrossRef][Web of Science][Medline]
  5. Fishman D, Faulds G, Jeffery R, et al. The effect of novel polymorphisms in the interleukin-6 (IL-6) gene on IL-6 transcription and plasma IL-6 levels, and an association with systemic-onset juvenile chronic arthritis. J Clin Invest. (1998) 102:1369–1376.[Web of Science][Medline]
  6. Jones K.G, Brull D.J, Brown L.C, et al. Interleukin-6 (IL-6) and the prognosis of abdominal aortic aneurysms. Circulation (2001) 103:2260–2265.[Abstract/Free Full Text]
  7. Rauramaa R, Vaisanen S.B, Luong L.A, et al. Stromelysin-1 and interleukin-6 gene promoter polymorphisms are determinants of asymptomatic carotid artery atherosclerosis. Arterioscler Thromb Vasc Biol. (2000) 20:2657–2662.[Abstract/Free Full Text]
  8. Brull D.J, Montgomery H.E, Sanders J, et al. Interleukin-6 gene –174G/C and –572G/C promoter polymorphisms are strong predictors of plasma interleukin-6 levels after coronary artery bypass surgery. Arterioscler. Thromb. Vasc. Biol. (2001) 21(9):1458–1463.[Abstract/Free Full Text]
  9. Margaglione M, Bossone A, Cappucci G, et al. The effect of interleukin-6 C/G-174 polymorphism and circulating interleukin-6 on fibrinogen plasma levels. Haematologica (2001) 86:199–204.[Abstract/Free Full Text]
  10. Sothern R.B, Roitman-Johnson B, Kanabrocki E.L, et al. Circadian characteristics of circulating interleukin-6 in men. J Allergy Clin Immunol. (1995) 95:1029–1035.[CrossRef][Web of Science][Medline]
  11. Vgontzas A.N, Papanicolaou D.A, Bixler E.O, et al. Circadian interleukin-6 secretion and quantity and depth of sleep. J Clin Endocrinol Metab. (1999) 84:2603–2607.[Abstract/Free Full Text]
  12. Kanabrocki E.L, Sothern R.B, Messmore H.L, et al. Circadian interrelationships among levels of plasma fibrinogen, blood platelets, and serum interleukin-6. Clin. Appl. Thromb. Haemost. (1999) 5:37–42.[CrossRef]
  13. Meier-Ewert H.K, Ridker P.M, Rifai N, et al. Absence of diurnal variation of C-reactive protein concentrations in healthy human subjects. Clin Chem. (2001) 47:426–430.[Abstract/Free Full Text]
  14. Kayaba K, Ishikawa S, Gotoh T, et al. Five-year intra-individual variability in C-reactive protein levels in a Japanese population-based study: the Jichi Medical School Cohort Study at Yamato, 1993–1998. Jpn Circ J. (2000) 64:303–308.[CrossRef][Medline]
  15. Ockene I.S, Matthews C.E, Rifai N, et al. Variability and classification accuracy of serial high-sensitivity C-reactive protein measurements in healthy adults. Clin Chem. (2001) 47:444–450.[Abstract/Free Full Text]
  16. Ridker P.M, Rifai N, Stampfer M.J, Hennekens C.H. Plasma concentration of interleukin-6 and the risk of future myocardial infarction among apparently healthy men. Circulation (2000) 101:1767–1772.[Abstract/Free Full Text]
  17. Ridker P.M, Hennekens C.H, Buring J.E, Rifai N. C-Reactive protein and other markers of inflammation in the prediction of cardiovascular disease in women. New Engl J Med. (2000) 342:836–843.[Abstract/Free Full Text]
  18. Lander E.S, Schork N.J. Genetic dissection of complex traits. Science (1994) 265:2037–2048.[Abstract/Free Full Text]
  19. O'Connell J.R, Weeks D.E. PedCheck: a program for identification of genotype incompatibilities in linkage analysis. Am J Hum Genet. (1998) 63:259–266.[CrossRef][Web of Science][Medline]
  20. Abecasis G.R, Cardon L.R, Cookson W.O. A general test of association for quantitative traits in nuclear families. Am J Hum Genet. (2000) 66:279–292.[CrossRef][Web of Science][Medline]
  21. Almasy L, Blangero J. Multipoint quantitative-trait linkage analysis in general pedigrees. Am J Hum Genet. (1998) 62:1198–1211.[CrossRef][Web of Science][Medline]
  22. Terry C.F, Loukaci V, Green F.R. Cooperative influence of genetic polymorphisms on interleukin 6 transcriptional regulation. J Biol Chem. (2000) 275:18138–18144.[Abstract/Free Full Text]
  23. Brattstrom L, Wilcken D.E, Ohrvik J, Brudin L. Common methylenetetrahydrofolate reductase gene mutation leads to hyperhomocysteinemia but not to vascular disease: the result of a meta-analysis. Circulation (1998) 98:2520–2526.[Abstract/Free Full Text]
  24. Cao H, Hegele R.A. Human C-reactive protein (CRP) 1059G/C polymorphism. J Hum Genet. (2000) 45:100–101.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nephrol Dial TransplantHome page
S. Aker, C. Bantis, P. Reis, N. Kuhr, C. Schwandt, B. Grabensee, P. Heering, and K. Ivens
Influence of interleukin-6 G-174C gene polymorphism on coronary artery disease, cardiovascular complications and mortality in dialysis patients
Nephrol. Dial. Transplant., September 1, 2009; 24(9): 2847 - 2851.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
J. Shen and J. M. Ordovas
Impact of Genetic and Environmental Factors on hsCRP Concentrations and Response to Therapeutic Agents
Clin. Chem., February 1, 2009; 55(2): 256 - 264.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
D. Corella, J. I. Gonzalez, M. Bullo, P. Carrasco, O. Portoles, J. Diez-Espino, M. I. Covas, V. Ruiz-Gutierrez, E. Gomez-Gracia, F. Aros, et al.
Polymorphisms Cyclooxygenase-2 -765G>C and Interleukin-6 -174G>C Are Associated with Serum Inflammation Markers in a High Cardiovascular Risk Population and Do Not Modify the Response to a Mediterranean Diet Supplemented with Virgin Olive Oil or Nuts
J. Nutr., January 1, 2009; 139(1): 128 - 134.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
M. Fornage, Y. A. Chiang, E. S. O'Meara, B. M. Psaty, A. P. Reiner, D. S. Siscovick, R. P. Tracy, and W.T. Longstreth Jr
Biomarkers of Inflammation and MRI-Defined Small Vessel Disease of the Brain: The Cardiovascular Health Study
Stroke, July 1, 2008; 39(7): 1952 - 1959.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
M. Kolz, W. Koenig, M. Muller, M. Andreani, S. Greven, T. Illig, N. Khuseyinova, D. Panagiotakos, G. Pershagen, V. Salomaa, et al.
DNA variants, plasma levels and variability of C-reactive protein in myocardial infarction survivors: results from the AIRGENE study
Eur. Heart J., May 2, 2008; 29(10): 1250 - 1258.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. C. Edberg, J. Wu, C. D. Langefeld, E. E. Brown, M. C. Marion, G. McGwin Jr, M. Petri, R. Ramsey-Goldman, J. D. Reveille, S. G. Frank, et al.
Genetic variation in the CRP promoter: association with systemic lupus erythematosus
Hum. Mol. Genet., April 15, 2008; 17(8): 1147 - 1155.
[Abstract] [Full Text] [PDF]


Home page
Int J EpidemiolHome page
M. Baker, T. Rahman, D. Hall, P. J Avery, B. M Mayosi, J. M C Connell, M. Farrall, H. Watkins, and B. Keavney
The C-532T polymorphism of the angiotensinogen gene is associated with pulse pressure: A possible explanation for heterogeneity in genetic association studies of AGT and hypertension
Int. J. Epidemiol., December 1, 2007; 36(6): 1356 - 1362.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
F. G. Hage and A. J. Szalai
C-Reactive Protein Gene Polymorphisms, C-Reactive Protein Blood Levels, and Cardiovascular Disease Risk
J. Am. Coll. Cardiol., September 18, 2007; 50(12): 1115 - 1122.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
L. A. Lange, C. S. Carlson, L. A. Hindorff, E. M. Lange, J. Walston, J. P. Durda, M. Cushman, J. C. Bis, D. Zeng, D. Lin, et al.
Association of Polymorphisms in the CRP Gene With Circulating C-Reactive Protein Levels and Cardiovascular Events
JAMA, December 13, 2006; 296(22): 2703 - 2711.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
D. C. Crawford, C. L. Sanders, X. Qin, J. D. Smith, C. Shephard, M. Wong, L. Witrak, M. J. Rieder, and D. A. Nickerson
Genetic Variation Is Associated With C-Reactive Protein Levels in the Third National Health and Nutrition Examination Survey
Circulation, December 5, 2006; 114(23): 2458 - 2465.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
C. P. Hersh, D. T. Miller, D. J. Kwiatkowski, and E. K. Silverman
Genetic determinants of C-reactive protein in COPD
Eur. Respir. J., December 1, 2006; 28(6): 1156 - 1162.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. Imrie, M. Freel, B. M. Mayosi, E. Davies, R. Fraser, M. Ingram, H. J. Cordell, M. Farrall, P. J. Avery, H. Watkins, et al.
Association between Aldosterone Production and Variation in the 11{beta}-Hydroxylase (CYP11B1) Gene
J. Clin. Endocrinol. Metab., December 1, 2006; 91(12): 5051 - 5056.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Q. Wang, S. C. Hunt, Q. Xu, Y. E. Chen, M. A. Province, J. H. Eckfeldt, J. S. Pankow, and Q. Song
Association study of CRP gene polymorphisms with serum CRP level and cardiovascular risk in the NHLBI Family Heart Study
Am J Physiol Heart Circ Physiol, December 1, 2006; 291(6): H2752 - H2757.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
T. A. Lakka, T. Rankinen, T. Rice, A. S. Leon, D. C. Rao, J. S. Skinner, and C. Bouchard
Quantitative trait locus on chromosome 20q13 for plasma levels of C-reactive protein in healthy whites: the HERITAGE Family Study
Physiol Genomics, October 11, 2006; 27(2): 103 - 107.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
C. Ladenvall, K. Jood, C. Blomstrand, S. Nilsson, C. Jern, and P. Ladenvall
Serum C-Reactive Protein Concentration and Genotype in Relation to Ischemic Stroke Subtype
Stroke, August 1, 2006; 37(8): 2018 - 2023.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
G. Biolo, A. Amoroso, S. Savoldi, A. Bosutti, M. Martone, D. Pirulli, F. Bianco, S. Ulivi, S. Bertok, M. Artero, et al.
Association of interferon-{gamma} +874A polymorphism with reduced long-term inflammatory response in haemodialysis patients
Nephrol. Dial. Transplant., May 1, 2006; 21(5): 1317 - 1322.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
L. B. Sansbury, A. W. Bergen, K. L. Wanke, B. Yu, N. E. Caporaso, N. Chatterjee, L. Ratnasinghe, A. Schatzkin, T. A. Lehman, A. Kalidindi, et al.
Inflammatory cytokine gene polymorphisms, nonsteroidal anti-inflammatory drug use, and risk of adenoma polyp recurrence in the polyp prevention trial.
Cancer Epidemiol. Biomarkers Prev., March 1, 2006; 15(3): 494 - 501.
[Abstract] [Full Text] [PDF]


Home page
Psychosom. Med.Home page
J. M. McCaffery, N. Frasure-Smith, M.-P. Dube, P. Theroux, G. A. Rouleau, Q. Duan, and F. Lesperance
Common genetic vulnerability to depressive symptoms and coronary artery disease: a review and development of candidate genes related to inflammation and serotonin.
Psychosom Med, March 1, 2006; 68(2): 187 - 200.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
Y. Liu, Y. Berthier-Schaad, M. D. Fallin, N. E. Fink, R. P. Tracy, M. J. Klag, M. W. Smith, and J. Coresh
IL-6 Haplotypes, Inflammation, and Risk for Cardiovascular Disease in a Multiethnic Dialysis Cohort
J. Am. Soc. Nephrol., March 1, 2006; 17(3): 863 - 870.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. P.S. Sie, F. A. Sayed-Tabatabaei, H.-H. S. Oei, A. G. Uitterlinden, H. A.P. Pols, A. Hofman, C. M. van Duijn, and J. C.M. Witteman
Interleukin 6 -174 G/C Promoter Polymorphism and Risk of Coronary Heart Disease: Results from the Rotterdam Study and a Meta-Analysis
Arterioscler Thromb Vasc Biol, January 1, 2006; 26(1): 212 - 217.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
C. Grimm, L. Six, C. Tomovski, P. Speiser, E. Joura, R. Zeillinger, G. Sliutz, A. Reinthaller, and L. A. Hefler
A Common Interleukin-6 Promoter Polymorphism in Patients With Vulvar Cancer
Reproductive Sciences, December 1, 2005; 12(8): 617 - 620.
[Abstract] [PDF]


Home page
J. Leukoc. Biol.Home page
H. Bruunsgaard
Physical activity and modulation of systemic low-level inflammation
J. Leukoc. Biol., October 1, 2005; 78(4): 819 - 835.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
B. M. Mayosi, P. J. Avery, M. Baker, N. Gaukrodger, H. Imrie, F. R. Green, M. Farrall, H. Watkins, and B. Keavney
Genotype at the -174G/C Polymorphism of the Interleukin-6 Gene Is Associated With Common Carotid Artery Intimal-Medial Thickness: Family Study and Meta-Analysis
Stroke, October 1, 2005; 36(10): 2215 - 2219.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
L. A. Hefler, C. Grimm, T. Lantzsch, D. Lampe, S. Leodolter, H. Koelbl, G. Heinze, A. Reinthaller, D. Tong-Cacsire, C. Tempfer, et al.
Interleukin-1 and Interleukin-6 Gene Polymorphisms and the Risk of Breast Cancer in Caucasian Women
Clin. Cancer Res., August 15, 2005; 11(16): 5718 - 5721.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
M. Di Napoli, M. Schwaninger, R. Cappelli, E. Ceccarelli, G. Di Gianfilippo, C. Donati, H. C.A. Emsley, S. Forconi, S. J. Hopkins, L. Masotti, et al.
Evaluation of C-Reactive Protein Measurement for Assessing the Risk and Prognosis in Ischemic Stroke: A Statement for Health Care Professionals From the CRP Pooling Project Members
Stroke, June 1, 2005; 36(6): 1316 - 1329.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
D. Campa, R. J. Hung, D. Mates, D. Zaridze, N. Szeszenia-Dabrowska, P. Rudnai, J. Lissowska, E. Fabianova, V. Bencko, L. Foretova, et al.
Lack of Association between Polymorphisms in Inflammatory Genes and Lung Cancer Risk
Cancer Epidemiol. Biomarkers Prev., February 1, 2005; 14(2): 538 - 539.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. Keavney, B. Mayosi, N. Gaukrodger, H. Imrie, M. Baker, R. Fraser, M. Ingram, H. Watkins, M. Farrall, E. Davies, et al.
Genetic Variation at the Locus Encompassing 11-{beta} Hydroxylase and Aldosterone Synthase Accounts for Heritability in Cortisol Precursor (11-Deoxycortisol) Urinary Metabolite Excretion
J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1072 - 1077.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
A. Huber, C. Grimm, S. Jirecek, R. Zeillinger, K. Heim, P. Husslein, and L. Hefler
An lnterleukin-6 Gene Promoter Polymorphism and Unexplained Late Intrauterine Fetal Death: A Multicenter Study
Reproductive Sciences, January 1, 2005; 12(1): 33 - 36.
[Abstract] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. P.M. de Maat, E. M. Bladbjerg, J. von Bornemann Hjelmborg, L. Bathum, J. Jespersen, and K. Christensen
Genetic Influence on Inflammation Variables in the Elderly
Arterioscler Thromb Vasc Biol, November 1, 2004; 24(11): 2168 - 2173.
[Abstract] [Full Text] [PDF]


Home page
PediatricsHome page
D. R. Harding, S. Dhamrait, A. Whitelaw, S. E. Humphries, N. Marlow, and H. E. Montgomery
Does Interleukin-6 Genotype Influence Cerebral Injury or Developmental Progress After Preterm Birth?
Pediatrics, October 1, 2004; 114(4): 941 - 947.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. O. Obisesan, C. Leeuwenburgh, T. Phillips, R. E. Ferrell, D. A. Phares, S. J. Prior, and J. M. Hagberg
C-Reactive Protein Genotypes Affect Baseline, but not Exercise Training-Induced Changes, in C-Reactive Protein Levels
Arterioscler Thromb Vasc Biol, October 1, 2004; 24(10): 1874 - 1879.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
G. H. Gibbons, C. C. Liew, M. O. Goodarzi, J. I. Rotter, W. A. Hsueh, H. M. Siragy, R. Pratt, and V. J. Dzau
Genetic Markers: Progress and Potential for Cardiovascular Disease
Circulation, June 29, 2004; 109(25_suppl_1): IV-47 - IV-58.
[Full Text] [PDF]


Home page
CirculationHome page
J. R. Greenfield, K. Samaras, A. B. Jenkins, P. J. Kelly, T. D. Spector, J. R. Gallimore, M. B. Pepys, and L. V. Campbell
Obesity Is an Important Determinant of Baseline Serum C-Reactive Protein Concentration in Monozygotic Twins, Independent of Genetic Influences
Circulation, June 22, 2004; 109(24): 3022 - 3028.
[Abstract] [Full Text] [PDF]


Home page
Int J EpidemiolHome page
B. Keavney
Commentary: Katan's remarkable foresight: genes and causality 18 years on
Int. J. Epidemiol., February 1, 2004; 33(1): 11 - 14.
[Full Text] [PDF]


Home page
CarcinogenesisHome page
D. Campa, S. Zienolddiny, V. Maggini, V. Skaug, A. Haugen, and F. Canzian
Association of a common polymorphism in the cyclooxygenase 2 gene with risk of non-small cell lung cancer
Carcinogenesis, February 1, 2004; 25(2): 229 - 235.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
A. J. MacGregor, J. R. Gallimore, T. D. Spector, and M. B. Pepys
Genetic Effects on Baseline Values of C-Reactive Protein and Serum Amyloid A Protein: A Comparison of Monozygotic and Dizygotic Twins
Clin. Chem., January 1, 2004; 50(1): 130 - 134.
[Abstract] [Full Text] [PDF]


Home page
QJMHome page
G.M. Hirschfield and M.B. Pepys
C-reactive protein and cardiovascular disease: new insights from an old molecule
QJM, November 1, 2003; 96(11): 793 - 807.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
C. Kluft and M. P.M. de Maat
Genetics of C-Reactive Protein: New Possibilities and Complications
Arterioscler Thromb Vasc Biol, November 1, 2003; 23(11): 1956 - 1959.
[Full Text] [PDF]


Home page
PediatricsHome page
D. Harding, S. Dhamrait, A. Millar, S. Humphries, N. Marlow, A. Whitelaw, and H. Montgomery
Is Interleukin-6 -174 Genotype Associated With the Development of Septicemia in Preterm Infants?
Pediatrics, October 1, 2003; 112(4): 800 - 803.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Landi, V. Moreno, L. Gioia-Patricola, E. Guino, M. Navarro, J. de Oca, G. Capella, and F. Canzian
Association of Common Polymorphisms in Inflammatory Genes Interleukin (IL)6, IL8, Tumor Necrosis Factor {alpha}, NFKB1, and Peroxisome Proliferator-activated Receptor {gamma} with Colorectal Cancer ,
Cancer Res., July 1, 2003; 63(13): 3560 - 3566.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. A. Hefler, C. Grimm, S. Ackermann, S. Malur, A. R. Radjabi-Rahat, S. Leodolter, M. W. Beckmann, R. Zeillinger, H. Koelbl, and C. B. Tempfer
An Interleukin-6 Gene Promoter Polymorphism Influences the Biological Phenotype of Ovarian Cancer
Cancer Res., June 15, 2003; 63(12): 3066 - 3068.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
P. Jerrard-Dunne, M. Sitzer, P. Risley, D. A. Steckel, A. Buehler, S. von Kegler, and H. S. Markus
Interleukin-6 Promoter Polymorphism Modulates the Effects of Heavy Alcohol Consumption on Early Carotid Artery Atherosclerosis: The Carotid Atherosclerosis Progression Study (CAPS)
Stroke, February 1, 2003; 34(2): 402 - 407.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
B. M. Mayosi, B. Keavney, A. Kardos, C. H. Davies, P. J. Ratcliffe, M. Farrall, and H. Watkins
Electrocardiographic measures of left ventricular hypertrophy show greater heritability than echocardiographic left ventricular mass
Eur. Heart J., December 2, 2002; 23(24): 1963 - 1971.
[Abstract] [PDF]


Home page
Postgrad. Med. J.Home page
P J Sheridan and D C Crossman
Critical review of unstable angina and non-ST elevation myocardial infarction
Postgrad. Med. J., December 1, 2002; 78(926): 717 - 726.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Vickers, M. A
Right arrow Articles by Keavney, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vickers, M. A
Right arrow Articles by Keavney, B.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?