Skip Navigation

Cardiovascular Research 2002 53(2):524-532; doi:10.1016/S0008-6363(01)00491-6
© 2002 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Lei, Z.-B.
Right arrow Articles by Li, X.-Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lei, Z.-B.
Right arrow Articles by Li, X.-Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2001, European Society of Cardiology

OxLDL upregulates CXCR2 expression in monocytes via scavenger receptors and activation of p38 mitogen-activated protein kinase

Zhu-Bin Leia,*, Zhe Zhangb, Qing Jingc, Yong-Wen Qinc, Gang Peib, Beng-Zhen Caoa and Xiao-Yan Lia

aDepartment of Cardiology, General Hospital of Jinan Military Area, Jinan 250031, China
bShanghai Institute of Cell Biology and Shanghai Research Center of Life Sciences, Chinese Academy of Sciences, Shanghai, China
cChanghai Hospital, Second Military Medical University, Shanghai, China

* Corresponding author. Tel.: +86-531-798-6563 leizhubin88{at}email.com.cn

Received 16 May 2001; accepted 25 September 2001


    Abstract
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 Acknowledgments
 References
 
Objective: Chemokine receptor CXCR2 has been implied to play a substantial role in pathogenesis of atherosclerosis, but the underlying molecular mechanisms remain to be clarified. In the present study, we examined the modulating effect of oxLDL on expression of CXCR2 and its functional effect in monocytes. Methods and results: OxLDL (20-µg protein/ml), but not LDL (80-µg protein/ml), upregulated the surface expression of the CXC chemokine receptor CXCR2 (measured by flow cytometry) in both human freshly peripheral blood monocytes and human monocytic U937 cells. OxLDL, but not LDL, increased CXCR2 mRNA determined by RT-PCR in both cells. Treatment of oxLDL (40-µg protein/ml) enhanced chemotaxis of U937 cells to IL-8 and their adhesion to an endothelial cell line, ECV304 (both P<0.05 vs. control). Pretreatment of monocytes with scavenger receptor inhibitors, polyinosinic acid (100 µg/ml) and dextran sulfate (50 µg/ml) attenuated CXCR2 expression, but pertussis toxin or cholera toxin had no effect. OxLDL induced the activation of p38MAPK in monocytes, and this effect of oxLDL was blocked by the scanvenger receptor inhibitors. Furthermore, p38 MAPK inhibitors SB203580 or SK&F86002 markedly reduced oxLDL-induced CXCR2 expression. Conclusions: This observation demonstrated that oxLDL upregulates CXCR2 expression in monocytes and promotes the chemotaxis and adhesion of monocytes. The effect of oxLDL is mediated through scavenger receptor and p38 MAPK activation.

KEYWORDS Cytokines; Leukocytes; Lipoproteins; Receptors; Signal transduction


    1 Introduction
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 Acknowledgments
 References
 
Atherosclerosis is characterized at its early stage by the fatty streak, which is composed of cholesterol-loaded foam cells mostly derived from circulating monocytes that have taken up oxidized low-density lipoprotein (oxLDL) in subendothelial space [1,2]. Chemokines, which are classified into four distinct subfamilies as CXC, CC, C and CX3C according to the arrangement of the di-cysteine motif [3,4], have been demonstrated to be critically involved in the recruitment of monocytes into atherosclerotic lesion [5,6]. It has been shown that oxLDL induces substantial expression of CXC chemokines IL-8 in monocyte-macrophages and endothelial cell, and growth-regulated oncogene (GRO) in endothelial cells [7,8]. CXC chemokines IL-8 and GRO elicit their biological impact through CXCR2, which is normally expressed in circulating monocytes and T cells [9–11]. It is also showed that a leukocyte homologue of IL-8 receptor CXCR2 mediated the accumulation of macrophages in atherosclerotic lesion in LDL receptor-deficient mice [12]. Therefore, it is possible that oxLDL may promote atherosclerosis through regulation of chemokine receptors such as CXCR2 in addition to its regulation of chemokines.

Activation of protein kinases play important roles in regulating cell growth, migration, differentiation and responding to extracelluar stimuli. Among these kinases, mitogen-activated protein kinase (MAPK) appears to be a family of most essential ones. Three major subfamilies of structurally related MAPK have been identified in mammalian cells: p38 MAPK, p42/44 MAPK and JNKs/SAPKs. p38 MAPK subfamily, containing at least four members, is strongly activated in response to various stimuli, which has been implicated to play a critical role in the development of atherosclerosis [13]. We have previously demonstrated that oxLDL can activate p38 MAPK in vascular smooth muscle cells, which correlates with oxLDL-induced cytotoxicity [14].

The present study was designed to investigate the potential effect of oxLDL on the expression of CXCR2 in freshly collected peripheral blood monocytes (PBM) and U937 cells, a monocytic cell line as well as the functional role of CXCR2 expression. In addition, Scavenger receptors and activation of p38 MAPK in response to oxLDL was also examined in this study.


    2 Methods
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 Acknowledgments
 References
 
2.1 Materials
FCS, 1640 RPMI and horseradish peroxidase-conjugated goat anti-rabbit secondary antibody were purchased from GIBCO-BRL. IL-8, phycoerythrin-conjugated mouse antibody IgG1 (AbIgG1), and phycoerythrin-conjugated mouse anti-human CXCR2 monoclonal antibody (AbCXCR2) were from Pharmigen. The rabbit polyclonal phospho-p38 MAPK antibody specific for dual-phosphorylated 180Thr and 182Tyr of p38 MAPK, total-p38 MAPK antibody, and p38 MAPK assay kit were purchased from New England Biolabs Inc. Nitrocellulose membranes (Hybond) and enhanced chemiluminescence detecting system were obtained from Amersham Pharmacia Biotech. SB203580 and SK&F86002 [14,15] were from Calbiochem Inc. All other reagents, unless indicated, were from Sigma Chemical Co.

2.2 Lipoprotein isolation and oxidation
Endotoxin-free LDL and oxLDL were obtained as previously described [14]. LDL were separated from freshly drawn normal plasma by sequential ultracentrifugation and extensively dialyzed at 4°C against 0.15 mol/l NaCL and 0.01%EDTA (pH 8.0). After the EDTA was removed, LDL was undertaken to oxidative modification by Cu2+ incubation (5 µmol/l CuSO4, 20 h at 37°C). Then the Cu2+ was removed by extensive dialysis. The extent of modification was assessed by the measurement of thiobarbituric acid-reactive substances (TBARS) and by determination of electrophoresis motility on agarose gels in barbital buffer at pH 8.6. The obtained oxLDL possessed a TBARS value of 25 nmol/mg of protein, whereas the LDL showed no detectable TBARS. The oxLDL moved 2–3 times faster on agarose gel electrophoresis than the LDL did.

2.3 Cell culture
Human PBM from healthy donor blood packs were obtained by Ficoll–Hypague method and then by adherence to plastic, and cultured for 2 h at 37°C in a 5% CO2 incubator. After removing the non-adherent cells, the adhered cells were 90% monocytes. A monocytic cell line, U937 [16] and an endothelial cell line, ECV304 [17], were cultured in RPMI 1640 supplemented with 10%-inactivited fetal serum, 100 u/ml penicillin, 100 µg/ml streptomycin, and 2 mM glutamine.

2.4 Flow cytometric analysis
Cells were washed three times with cold buffer (PBS/1% FCS/0.1% sodium azide), resuspended at 5x105 cells in 100 µl binding buffer supplemented with 1 µg phycoerythrin-conjugated anti-CXCR2 mAb, or 1 µg phycoerythrin-conjugated isotype anti-IgG1 mAb control, and incubated on ice in the dark for 45 min. Subsequently, the cells were washed twice and analyzed using flow cytometry (Becton Dickson). Only PBM were accounted according to their light scatter and size during flow cytometry. Mean Fluorescence Intensity was determined by subtracting the Mean Fluorescence Intensity of cells stained with AbIgG1 control from the Mean Fluorescence Intensity of cells stained with AbCXCR2 [18].

2.5 Reverse transcription-PCR (RT-PCR) analysis
Total mRNA from 106 cells was isolated with TRIzol (Gibco). First strand cDNA was then synthesized from 2 µg total RNA using reverse transcriptase (Gibco). A parallel control for DNA contamination was carried out without adding reverse transcriptase in the first strand synthesis. Primers were synthesized according to motif: CGGAATTCAAATGGAAGATTTTAACATGGAG (CXCR2, sense), CCGCTCGAGTTAGAGAGTAGTGGAAGTGTG (CXCR2, antisense), TCCATGACAACTTTGGCATCGTGG (GAPDH, sense), and GTTGCTGTTGAAGTCACAGGAGAC (GAPDH, antisense). cDNA was amplified by 30 cycles set to 94°C denaturation (60 s), 58°C annealing (60 s) and 72°C extension (60 s). PCR products were analyzed by 2% agarose gel electroresis. The specificity of the amplification was confirmed by DNA sequencing. The concentration of the reverse transcribed cDNA in the PCR mixture was adjusted to assure a liner correlation between template and product. The housekeeping gene GAPDH was used as a control template for normalizing relative changes of CXCR2 mRNA in RT-PCR.

2.6 Chemotaxis assay
Chemotaxis was assessed using a modification of trans-endothelial migration assay. The endothelial cell used for this assay was the endothelial cell line, ECV304. Endothelial cells were cultured on 6.5 mm diameter Transwell culture inserts (Costar) with an 8.0-µm-pore size. ECV304 (2x105) were plated onto each insert of the 24-well chemotactic plate and incubated at 37°C for 48–96 h. IL-8 was added to the 24-well tissue culture plate in a final volume of 600 µl. U937 cells were resuspended in RPMI 1640 containing 1 mg/ml BSA. The plate was then incubated at 37°C in 5% CO2/95% air for 1 h. The cells that had migrated to the bottom chamber were counted using microscope.

2.7 Static cell adhesion assays
ECV304 cells were plated in 96-well plates (3–4x104 cells/well) and incubated for 48 h. U937 cells were pretreated with 40-µg protein/ml oxLDL for 24 h and then added to each well (2–3x106 cells/well). The plate was incubated for additional 30 min at 37°C. Non-adherent U937 cells were removed by washing twice with PBS. Adherent U937 cells were counted in four low-powered microscopic fields for each treatment.

2.8 Western blotting
U937 cells, after different treatment, were lysed with the SDS sample buffer containing 62.5 mmol/l Tris (pH 6.8), 2% SDS (w/v), and 10% glycerol. Sample were heated at 95°C for 5 min and centrifuged (13 000 g, 5 min) at 4°C, and supernatant (20 µg protein/lane) was analyzed by SDS–PAGE in a 10% acrylamide gel. Proteins were transferred to nitrocellulose membranes and the membranes were blocked with 5% non-fat dry milk in TBST (20 mmol/l Tris [pH 8.0], 0.1% tween-20, and 150 mmol/l). The membranes were blotted with the primary antibody (phospho-p38 MAPK or total p38 MAPK) [19], then horseradish peroxidase-conjugated antibody, and detected by enhanced chemiluminescence detecting system according to the manufacturer's instruction. For repeated immunoblotting, membranes were stripped in 62.5 mmol/l Tris (pH 6.7), 2% SDS, 0.1% tween-20, and 0.1 mmol/l 2-mercaptoethanol for 30 min at 70°C.

2.9 Statistical analysis
All data represent the mean±S.D. of at least three independent experiments. Student t-test was used for the statistical analysis of the results. Values of P<0.05 were considered to significant.


    3 Results
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 Acknowledgments
 References
 
3.1 OxLDL upregulated expression of CXCR2 in U937 cells
As shown in Fig. 1A, unstimulated U937 cells expressed CXCR2 at the lowest detectable level. Treatment of U937 with oxLDL, but not LDL, induced the upregulation of CXCR2 in a concentration- and time-dependent manner (Fig. 1B and C). As shown in Fig. 1D, treatment of U937 cells with oxLDL significantly induced expression of CXCR2 mRNA compared with control group. In contrast, the expression of CXCR2 remained unchanged in LDL-treated U937 cells.


Figure 1
View larger version (33K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Effect of oxLDL on CXCR2 expression in U937 cells. (A) Histograms of U937 cells stained with control AbIgG1 (dotted line) or AbCXCR2 (solid line). Cells were incubated in absence or presence of 80 µg/ml LDL or oxLDL for 24 h. (B) Dose effect of LDL and oxLDL on CXCR2 expression. Cells were incubated with LDL or oxLDL for 24 h at concentrations of 20, 40, 80-µg protein/ml. (C) Time courses of LDL and oxLDL on CXCR2 expression. Cells were incubated with LDL or oxLDL at a concentration of 40-µg protein/ml for the indicated time. CXCR2 expression was determined by flow cytometry, and represented as Mean Fluorescence Intensity±S.D., n=4 (B, C). (D) Electrophoresis of RT-PCR amplified CXCR2 mRNA transcripts in U937 cells after treatment without or with LDL or oxLDL (40-µg protein/ml for 24 h). Data are shown from one representative of four similar experiments (A, D).

 
3.2 OxLDL upregulated expression of CXCR2 in PBM
Consistent with the results obtained from U937 cells, treatment of PBM with oxLDL stimulated expression of CXCR2 in concentration- and time-dependent manners as compared to the unstimulated control (Fig. 2A, B, C). CXCR2 mRNA was also significantly upregulated by oxLDL treatment, while the untreated PBM expressed no detectable CXCR2 mRNA (Fig. 2D). Similarly, treatment of PBM with LDL did not affect the expression of CXCR2 either at protein or mRNA level (Fig. 2). These results indicated that the upregulatory effect of oxLDL on CXCR2 expression was not limited to U937 cells, which can thus serve as a good model for PBM study.


Figure 2
View larger version (37K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Effect of oxLDL on CXCR2 expression in PBM. (A) Histograms of PBM stained with control AbIgG1 (dotted line) or AbCXCR2 (solid line). Cells were incubated in absence or presence of 80 µg/ml LDL or oxLDL for 24 h. (B) Dose effect of LDL and oxLDL on CXCR2 expression. Cells were incubated with LDL or oxLDL for 24 h at concentrations of 20, 40, 80-µg protein/ml. (C) Time courses of LDL and oxLDL on CXCR2 expression. Cells were incubated with LDL or oxLDL at a concentration of 40-µg protein/ml for the indicated time. CXCR2 expression was determined by flow cytometry, and represented as Mean Fluorescence Intensity±S.D., n=4 (B, C). (D) Electrophoresis of RT-PCR amplified CXCR2 mRNA transcripts in PBM after treatment without or with LDL or oxLDL (40-µg protein/ml for 24 h). Data are shown from one representative of four similar experiments (A, D).

 
3.3 OxLDL enhanced chemotaxis of U937 cells to IL-8
The physiological role of increased CXCR2 expression was tested using a sensitive transendothelial chemotaxis assay by assessing the response of U937 cells to IL-8. IL-8 induced chemotaxis of unstimulated U937 cells to a maximal response at a concentration of 500 ng/ml. To determine the effect of oxLDL on chemotactic activity, treatment of U937 cells with oxLDL (40-µg protein/ml for 24 h), which significantly upregulated the surface CXCR2 as shown in Fig. 1, resulted in an enhanced chemotactic response at 500 ng/ml IL-8 about 2–3 folds as compared with that in the unstimulated cells (Fig. 3). Again, LDL treatment did not lead to any enhancement of chemotaxis of U937 cells to IL-8 (Fig. 3).


Figure 3
View larger version (25K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Effect of oxLDL on chemotaxis of U937 cells to IL-8. Cells were pretreated without or with 40-µg protein/ml LDL or oxLDL for 24 h, and chemotaxis of cells to IL-8 was determined as described in Section 2. Data are presented as mean±S.D., n=4.

 
3.4 OxLDL enhanced adhesion of U937 cells to endothelial cells
Adhesion of U937 cells to endothelial ECV304 cells was determined to assess the functional role of CXCR2 upregulation by oxLDL. As shown in Fig. 4, exposure of U937 cells to oxLDL (40-µg protein/ml for 24 h) resulted in a marked increase in number of the U937 cells bound to ECV304 cells. Preincubation of the oxLDL-treated U937 cells with CXCR2 antibodies significantly reduced the oxLDL's effect (by about 50%), while addition of the control IgG1 antibodies exhibited no effect on the U937 cell binding. Our data suggested that upregulated CXCR2 by oxLDL was responsible for most of the enhanced binding of U937 cells to endothelial cells.


Figure 4
View larger version (28K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Effect of oxLDL on the adhesion of U937 cells to the endothelial ECV304 cells. Cells were incubated with none, or 40 µg/ml oxLDL for 24 h, and then exposed to none, AbCXCR2 or AbIgG1 antibodies (both 10 µg/ml) for 15 min. Adhesion of U937 cells to ECV304 cells was determined as described in Section 2. HPF indicates high-powered field. Values are presented as mean±S.D., n=3. *P<0.05 vs. oxLDL alone.

 
3.5 Scavenger receptors likely mediated the oxLDL-induced effects
To test whether the oxLDL-induced upregulation of CXCR2 was mediated by Scavenger receptors (SR), U937 cells were pretreated with SR inhibitors (polyinosinic acid (polyI) or dextran sulfate) before addition of oxLDL. The results showed that polyI and dextran sulfate (Fig. 5A) diminished CXCR2 upregulation induced by oxLDL to 56% and 41%, respectively. Pretreatment with either Gs protein inhibitor cholera toxin (CTX) or Gi/o protein inhibitor pertussis toxin (PTX) did not affect the oxLDL-induced CXCR2 upregulation (Fig. 5A), indicating an involvement of SR but not G protein-coupled receptors in the oxLDL-induced upregulation of CXCR2 in U937 cells.


Figure 5
View larger version (17K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Blockage of oxLDL's effects by scavenger receptor inhibitors. Cells were stimulated with 40 µg/ml oxLDL for 24 h without or with pretreatment of polyinosinic acid (polyI) (100 µg/ml, 15 min), dextran sulfate (50 µg/ml, 15 min), pertussis toxin (PTX) (100 ng/ml, 12 h) or cholera toxin (CTX) (100 ng/ml, 12 h). CXCR2 expression was determined by flow cytometry (A), and p38 MAPK activity was determined with dual phospho-specific p38 MAPK antibodies by Western blot analysis (B, C) as described in Section 2. Data are presented as mean±S.D. from three independent experiments. *P<0.05 vs. treatment of oxLDL alone. Dextran indicates dextran sulfated and ox represents oxLDL.

 
In current study, it was shown that exposure of U937 cells to oxLDL could significantly enhance the activation of p38 MAPK but not the protein level of total p38 MAPK (Fig. 5B and C), and the p38 MAPK activation was in a dose-dependent manner (data not shown). Experiments also revealed that both polyI and dextran sulfate, not PTX or CTX, could effectively block p38 MAPK activation by oxLDL (Fig. 5B, C), demonstrating that SR likely mediated oxLDL-enhanced activation of p38 MAPK.

3.6 p38 MAPK was involved in oxLDL-induced upregulation of CXCR2
Since it was shown that oxLDL effectively induced p38 MAPK activation that was mediated by SR, next we tested whether oxLDL-induced p38 MAPK activation was critical for its upregulation of CXCR2 expression. Two specific p38 MAPK inhibitors SB203580 and SK&F86002, which have been widely used in the study of p38 MAPK, were applied in this study. Our results demonstrated that incubation of U937 cells with either SB203580 or SK&F86002 dose-dependently diminished oxLDL-induced upregulation of CXCR2 expression (Fig. 6). Additional results showed that SB203580 or SK&F86002 dose-dependently blocked p38 MAPK activation at similar potency (data not shown). Our data thus indicated that p38 MAPK was indeed critically involved in the mediation of oxLDL-induced CXCR2 upregulation.


Figure 6
View larger version (38K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 Effect of p38 MAPK inhibitors on oxLDL-induced upregulation of CXCR2 expression. U937 cells were pretreated with the specific p38 MAPK inhibitors, SB203580 and SK&F86002, 15 min before incubated with 40 µg/ml oxLDL for 24 h. Mean Fluorescence Intensity of CXCR2 was recorded by flow cytometry. Data are presented as mean±S.D., n=3.

 

    4 Discussion
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 Acknowledgments
 References
 
In the present study, we demonstrated that oxLDL upregulates the expression of CXCR2 mRNA and protein in monocytes. The upregulation of CXCR2 causes chemotaxis of monocytes and increases monocyte adhesion to endothelial cells. The effect of oxLDL is mediated by scavenger receptors on monocytes since scavenger receptor blockers attenuate the action of oxLDL. In this process, oxLDL-induced activation of p38 MAPK plays an important role in signaling transduction.

According to earlier reports, U937 cells migration was consistently greater in the presence of IL-8 at 50 ng/ml, although this did not reach statistical significance (P=0.01) [20]. We reported that IL-8 at 500 ng/ml induced an increase in U937 cells chemotaxis with a statistical significance, which was comparable to that of human PBM [10]. The absence of high-affinity binding sites on the monocytes might explain why higher concentration IL-8 was needed during monocytes chemotaxis by IL-8. Further functional studies will be necessary to assess the potential role of IL-8 in monocyte chemotaxis.

GRO{alpha} has the capacity to modulate monocyte-endothelial adhesion in vitro [7]. The effects of GRO{alpha} on monocytes appear to be mediated in part by rapid stimulation of the activation states and the ability to bind selected matrix constituents of specific leukocyte integrins [21,22]. It is possible that CXCR2 mediated effects of GRO{alpha} on monocyte adhesion to endothelium [7,23,24]. Thus, it will be of interest to further define the basic mechanisms and precise functional consequences of enhanced monocyte-macrophage CXCR2 expression.

It is well known that scavenger receptors on monocytes mediate the uptake of oxLDL. These receptors include SR-AI/II, CD36, SR-BI, macrosialin/CD68, LOX-1, and SREC [25]. SRAI/SRAII, the first scavenger receptor to be fully characterized, can bind a broad range of modified lipoproteins and other ligands, including PolyI or dextran sulfate. Studies showed that the SR-AI/SRAII/apoE double-knockout mice developed smaller atherosclerotic lesions as compared to the apoE knockout mice [26]. These findings provide direct evidence that SR-A is involved in the development of atherosclerosis. The studies also showed that the other scavenger receptors, such as CD36, play important role in atherosclerosis [27] In the present study, we found that oxLDL upregulates CXCR2 gene expression that leads to chemotaxis of monocytes and monocyte adhesion to endothelial cells. Importantly, we found that these effects of oxLDL were mediated by its scavenger receptors. This became evidence since polyI or detran sulfate inhibited oxLDL-induced CXCR2 upregulation.

Studies have shown that oxLDL induces the activation of intracellular protein kinases, such as protein kinase C (PKC) [28], protein tyrosine kinase (PTK) [29] and mitogen-activated protein kinases (MAPKs) [19]. These protein kinases mediate oxLDL-caused gene expression and cell injury [30]. In the present study, we found that oxLDL upregulates CXCR2 gene expression that leads to chemotaxis of monocytes and monocyte adhesion to endothelial cells. Importantly, we found that these effects of oxLDL were mediated by activation of p38 MAPK. Inhibition of p38 MAPK activation by its specific inhibitors SB203580 or SK&F86002 significantly reduced oxLDL-induced CXCR2 upregulation in monocytes. The role of p38 MAPK activation in oxLDL signaling pathway was further confirmed by SR-A antagonists, polyI or dextran sulfate that inhibited the activation of p38 MAPK in response to oxLDL. Many studies [31–33] have shown that oxLDL induces the activation of p38 MAPK and p42/p44 MAPK that further trigger transcription factor NF-kappaB activation leading to gene expression.

In summary, we demonstrate that oxLDL upregulated CXCR2 expression in human PBM and U937 cells in concentration- and time-dependent manners, and oxLDL's effect was mediated through SR and activation of p38 MAPK. The upregulated expression of CXCR2 by oxLDL was functionally associated with oxLDL-enhanced chemotaxis of monocytes to IL-8 and their adhesion to endothelium.

Time for primary review 29 days.


    Acknowledgments
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 Acknowledgments
 References
 
This work is supported by the grants from the Chinese People's Liberation Army (01Q015), Chinese Academy of Sciences (KJ951-B1, KJ95T-06), National Natural Science Foundation of China (39630130, 39625015), Ministry of Science and Technology (G1999053907), and German Max-Planck Society. The authors wish to thank Dr Guo-Xiang Wu, Ya-Lan Wu, Yi-Ming Lin, Wei Hu, Bo Cen, Wen-Bo Zhang, Ying Xiong, Shun-Mei Xin, and Pei-Hua Wu for their kind assistance.


    References
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 Acknowledgments
 References
 

  1. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature (1993) 362:801–809.[CrossRef][Medline]
  2. Ross R. Atherosclerosis — an inflammatory disease. New Engl J Med (1999) 340:115–126.[Free Full Text]
  3. Baggiolini M. Chemokines and leukocyte traffic. Nature (1998) 392:565–568.[CrossRef][Medline]
  4. Schall T.J. A new class of membrane-bound chemokine with a CX3C motif. Nature (1997) 385:640–644.[CrossRef][Medline]
  5. Terkeltaub R., Boisvert W.A., Curtiss L.K. Chemokines and atherosclerosis. Curr Opin Lipidol (1998) 9:397–405.[CrossRef][Web of Science][Medline]
  6. Li D.Y., Mehta J.L. Antisense to LOX-1 inhibits oxidized LDL-mediated upregulation of monocyte chemoattractant protein-1 and monocyte adhesion to human coronary artery endothelial cells. Circulation (2000) 101:2889–2895.[Abstract/Free Full Text]
  7. Schwartz D., Andalibi A., Chaverri Almada L., Berliner J.A., Kirchgessner T., Fang Z.T., Tekamp Olson P., Lusis A.J., Gallegos C., Fogelman A.M. Role of the GRO family of chemokines in monocyte adhesion to MM-LDL-stimulated endothelium. J Clin Invest (1994) 94:1968–1973.[Web of Science][Medline]
  8. Claise C., Edeas M., Chalas J., Cockx A., Abella A., Capel L., Lindenbaum A. Oxidized low-density lipoprotein induces the production of interleukin-8 by endothelial cells. FEBS Lett (1996) 398:223–227.[CrossRef][Web of Science][Medline]
  9. Chuntharapai A., Lee J., Hebert C.A., Kim K.J. Monoclonal antibodies detect different distribution patterns of IL-8 receptor A and IL-8 receptor B on human peripheral blood leukocytes. J Immunol (1994) 153:5682–5688.[Abstract]
  10. Bishayi B., Samanta A.K. Identification and characterization of specific receptor for interleukin-8 from the surface of human monocytes. Scand J Immunol (1996) 43:531–536.[CrossRef][Web of Science][Medline]
  11. Oin S., LaRosa G., Campbell J.J., Smith Heath H., Kassam N., Shi X., Zeng L., Buthcher E.C., Mackay C.R. Expression of monocyte chemoattractant protein-1 and interleukin-8 receptors on subsets of T cells: correlation with transendothelial chemotactic potential. Eur J Immunol (1996) 26:640–647.[Web of Science][Medline]
  12. Boisvert W.A., Santiago R., Curtiss L.K., Terkeltaub R.A. A leukocyte homologue of the IL-8 receptor CXCR-2 mediates the accumulation of macrophages in atherosclerotic lesions of LDL receptor-deficient mice. J Clin Invest (1998) 101:353–363.[Web of Science][Medline]
  13. Force T., Bonventre J.V. Growth factors and mitogen-activated protein kinases. Hypertension (1998) 31:152–161.[Abstract/Free Full Text]
  14. Jing Q., Xin S.M., Cheng Z.J., Zhang W.B., Zhang R., Qin Y.W., Pei G. Activation of p38 mitogen-activated protein kinase by oxidized LDL in vascular smooth muscle cells: mediation via pertussis toxin-sensitive G proteins and association with oxidized LDL-induced cytotoxicity. Circ Res (1999) 84:831–839.[Abstract/Free Full Text]
  15. Cuenda A., Rouse J., Doza Y.N., Meier R., Cohen P., Gallagher T.F., Young P.R., Lee J.C. SB 203580 is a specific inhibitor of a MAP kinase homologue which is stimulated by cellular stresses and interleukin-1. FEBS Lett (1995) 364:229–233.[CrossRef][Web of Science][Medline]
  16. Sundström C., Nilsson K. Establishment and characterization of a human histiocytic lymphoma cell line (u937). Int J Cancer (1976) 17:565–673.[Web of Science][Medline]
  17. Takahashi K., Sawasaki Y. Human endothelial cell line, ECV304, produces pro-urokinase [letter] in vitro. Cell Dev Biol (1991) 27A:766–768.[CrossRef]
  18. Khandaker M.H., Xu L., Rahimpour R., Mitchell G., DeVries M.E., Pickering J.G., Singhal S.K., Feldman R.D., Kelvin D.J. CXCR1 and CXCR2 are rapidly down modulated by bacterial endotoxin through a unique agonist-independent, tyrosine kinase-dependent mechanism. J Immunol (1998) 161:1930–1938.[Abstract/Free Full Text]
  19. Raingeaud J., Gupta S., Rogers J.S., Dickens M., Han J., Ulevitch R.J., Davis R.J. Pro-inflammatory cytokines and environmental stress cause p38 mitogen-activated protein kinase activation by dual phosphorylation on tyrosine and threonine. J Biol Chem (1995) 270:7420–7426.[Abstract/Free Full Text]
  20. Denton C.P., Shi-Wen X., Sutton A., Abraham D.J., Black C.M., Pearson J.D. Scleroderma fibroblasts promote migration of mononuclear leucocytes across endothelial cell monolayers. Clin Exp Immunol (1998) 114(2):293–300.[CrossRef][Web of Science][Medline]
  21. Lloyd A.R., Oppenheim J.J., Kelvin D.J., Taub D.D. Chemokines regulate T cell adherence to recombinant adhesion molecules and extracellular matrix proteins. J Immunol (1996) 156:932–938.[Abstract]
  22. Lundahl J., Skold C.M., Hallden G., Hallgren M., Eklund A. Monocyte and neutrophil adhesion to matrix proteins is selectively enhanced in the presence of inflammatory mediators. Scand J Immunol (1996) 44:143–149.[CrossRef][Web of Science][Medline]
  23. Koch A.E., Polverini P.J., Kunkel S.L., Harlow L.A., DiPietro L.A., Elner V.M., et al. Interleukin-8 as a macrophage-derived mediator of angiogenesis. Science (1992) 258:17998–18001.
  24. Berliner J.A., Nava M., Fogelman A.M., Frank J.S., Demer L.L., Edwards P.A., Watson A.D., Lusis A.J. Atherosclerosis: basic mechanisms. Oxidation, inflammation and genetics. Circulation (1995) 91:2488–2496.[Abstract/Free Full Text]
  25. Krieger M., Herz J. Structures and functions of multiligand lipoprotein receptors: macrophage scavenger receptors and LDL receptor-related protein (LRP). Annu Rev Biochem (1994) 63:601–637.[Web of Science][Medline]
  26. Dhaliwal B.S., Steinbrecher U.P. Scavenger receptors and oxidized low-density lipoproteins. Clin Chim Acta (1999) 286:191–205.[CrossRef][Web of Science][Medline]
  27. Nicholson A.C., Frieda S., Pearce A., Silverstein R.L. Oxidized LDL binds to CD36 on human monocyte-derived macrophages and transfected cell lines. Evidence implicating the lipid moiety of the lipoprotein as the binding site. Arterioscler Thromb Vasc Biol (1995) 15:269–275.[Abstract/Free Full Text]
  28. Fyrnys B., Claus R., Wolf G., Deigner H.P. Oxidized low density lipoprotein stimulates protein kinase C (PKC) activity and expression of PKC-isotypes via prostaglandin-H-synthase in P388D1 cells. Adv Exp Med Biol (1997) 407:93–98.[Web of Science][Medline]
  29. Li D., Yang B., Mehta J.L. Ox-LDL induces apoptosis in human coronary artery endothelial cells: role of PKC, PTK, bcl-2 and Fas. Am J Physiol (1998) 275(2 Pt 2):H568–H576.[Web of Science][Medline]
  30. Sakai M., Kobori S., Miyazaki K., Horiuchi S. Macrophage proliferation in atherosclerosis. Curr Opin Lipidol (2000) 11:503–509.[CrossRef][Web of Science][Medline]
  31. Ruwhof C., van der Laarse A. Mechanical stress-induced cardiac hypertrophy: mechanisms and signal transduction pathways. Cardiovasc Res (2000) 47:23–37.[Abstract/Free Full Text]
  32. Rao K.M. MAP kinase activation in macrophages. J Leukocyte Biol (2001) 69(1):3–10.[Abstract/Free Full Text]
  33. Deigner H.P., Claus R. Stimulation of mitogen activated protein kinase by LDL and oxLDL in human U-937 macrophage-like cells. FEBS Lett (1996) 385:149–153.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Lei, Z.-B.
Right arrow Articles by Li, X.-Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lei, Z.-B.
Right arrow Articles by Li, X.-Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?