© 2002 by European Society of Cardiology
Copyright © 2001, European Society of Cardiology
TNF
decreases
MHC expression by a NO mediated pathway: role of E-box transcription factors for cardiomyocyte specific gene regulation
aDepartment of Cardiology and Angiology, Medizinische Hochschule Hannover, Carl-Neuberg Strasse 1, 30625 Hannover, Germany
bWinters Center for Heart Failure Research, Baylor College of Medicine, 2002 Holocombe Boulevard, Houston, TX 77030, USA
drexler.helmut{at}mh-hannover.de
* Corresponding author: Tel.: +49-511-532-3840; fax: +49-511-532-5412
Received 20 July 2001; accepted 12 September 2001
| Abstract |
|---|
|
|
|---|
Objective: Tumor necrosis factor
(TNF
) is thought to play a key role in the pathogenesis of cardiac failure. In the myocardium, TNF
enhances the expression of inducible nitric oxide synthase (iNOS). Nitric oxide (NO) has been shown to affect β-agonist-dependent cardiac contractility and relaxation. It is not clear, however, whether TNF
mediated NO release has sustained cardiac effects, by altering expression of cardiomyocyte specific genes such as
-myosin heavy chain (
MHC). Methods: Neonatal rat ventricular cardiomyocytes (CM) were stimulated with TNF
and/or the NOS inhibitor nitro-L-arginine (L-NNA). Protein binding to the E-box enhancer element in the
MHC promoter was evaluated by electrophoretic mobility shift assay (EMSA) and transcriptional activity of the E-box consensus motif was determined by luciferase assay. mRNA levels of the endogenous
MHC gene were assessed by RT–PCR. In vivo studies were performed in transgenic mice with cardiac specific over-expression of TNF
. Results: CM treated with TNF
exhibited decreased levels of
MHC transcripts (69±8% of control), the effect of TNF
was reversed by L-NNA (94±14% of control). As shown by EMSA, TNF
reduced protein binding to the
MHC E-box enhancer motif via NO dependent pathways. Addition of the NO-donor sodium nitroprusside (SNP) to CM nuclear extracts dose dependently disrupted protein binding to the
MHC E-box. Furthermore, exposure of CM to TNF
or SNP decreased transcription from an E-box luciferase-reporter construct (TNF
: 74±12%; SNP 250 µM: 72±10%; SNP 500 µM: 66±11% of control). In myocardial tissue of TNF
transgenic mice, increased nitrotyrosine staining, decreased protein binding to the
MHC E-box motif and reduced expression of
MHC (62±26%) were observed. Conclusions: The present study shows that TNF
reduces
MHC transcript levels in cardiomyocytes. Our data obtained in cultured CM and in TNF
transgenic mice support the notion that TNF
exerts these effects by NO and E-box dependent mechanisms in vitro and possibly in vivo.
KEYWORDS Cell culture/isolation; Cytokines; Gene expression; Heart failure; Nitric oxide
| 1. Introduction |
|---|
|
|
|---|
Patients with chronic heart failure (CHF) display elevated plasma and cardiac levels of the pro-inflammatory cytokine tumor necrosis factor
(TNF
) [1,2]. TNF
promotes cardiac hypertrophy, ventricular dilatation, negative inotropy and CHF in experimental studies [3–9], suggesting that TNF
may play a pathophysiological role in CHF.
TNF
effects are mediated through several signaling cascades including protein kinase C, mitogen-activated protein kinases and inducible nitric oxide synthase (iNOS) [3,8–10]. Nitric oxide (NO) has been implicated in the negative inotropic effects of TNF
[11]. It is not known, however, whether TNF
mediated increase in NO production affects cardiomyocyte gene expression.
Myosin heavy chains are the molecular motor of the heart, and contractile properties heavily depend on the isoform composition of myosin heavy chain proteins. Expression of the two isoforms present in the adult mamalian heart,
- and β-myosin heavy chain (
MHC and βMHC), has received close attention in the past. In experimental models of cardiac hypertrophy and failure and in patients with CHF, a down-regulation of
MHC and an up-regulation of βMHC is observed. This shift in isoform composition results in a reduction of contractile velocity and reduced energy expenditure [12–14].
Expression of the
MHC gene is restricted to the heart and is controlled mostly at the level of transcription [15], making it an excellent target to analyze mechanisms of cardiac specific gene regulation. Among several positive and negative cis-acting elements, the E-box motif (CANNTG) represents an enhancer element which has been implicated in the hemodynamic and cAMP-dependent transcriptional control of the
MHC gene, although flanking M-CAT, CarG, A/T-rich and MEF2 motifs further specify transcriptional regulation [12,16–21]. In addition, studies in skeletal muscle demonstrate NO dependent regulation of E-box transcriptional activities [22] suggesting that the E-box might be susceptible to NO dependent transcriptional regulation also in cardiomyocytes.
In this study, we present evidence that TNF
depresses
MHC gene expression by NO-dependent mechanisms in vitro, possibly via decreased transcriptional activity of the E-box enhancer element, located in the
MHC promoter. Additional studies in transgenic mice with cardiac specific overexpression of TNF
suggest that these mechanisms may also operate in vivo.
| 2. Methods |
|---|
|
|
|---|
Cell culture media, recombinant TNF
, sodium nitroprusside (SNP), N-nitro-L-arginine (L-NNA) and all other chemicals were purchased from Sigma.
2.1 Cardiomyocyte isolation and transfection
Primary cardiomyocytes (CM) were isolated from 1- to 3-day-old Sprague–Dawley rats [23]. Cells were plated at a density of 5x104 cells per cm2 in DMEM/M199 supplemented with 10% horse serum and 5% FCS. After 24 h, cells were switched to serum-free medium. CM were transfected for 6 h with luciferase-reporter plasmids containing the thymidine kinase minimal promoter (pmin-tk-luc) or the min-tk fused to a basic E-box motif (CACGTG) (pM4-min-tk-luc) [24] using Lipofectamin (GIBCO) in DMEM/M199 supplemented with 5% FCS. After transfection, CM were washed and kept for 24 h in DMEM/M199 before stimulation. Transfection efficiency was controlled by co-transfection with a vector expressing constitutively active green fluorescence protein (pAdTrackCMV, [31]). No difference in the number of transfected cells was observed 24 h after treatment. Luciferase assays (Luciferase Assay Kit, Promega) were performed with whole cell lysates using equal amounts of protein (BIORAD Protein Assay, Bradford, UK).
2.2 Tissue source
Transgenic mice with cardiac-specific TNF
over-expression (n=4) and wildtype litter mates (n=4) were sacrificed at 14±2 weeks of age. Left ventricular tissue was isolated, snap-frozen in liquid nitrogen and stored at –80°C. TNF
transgenic mice display a transition to cardiac dilatation by 12 weeks of age [25]. The studies were performed in accordance with NIH guidelines for the use of experimental animals (NIH Publication No. 85-23, revised 1996).
2.3 RNA isolation and analysis
RNA was isolated from cells or mouse tissue by TriZolTM (GIBCO). cDNA was synthesized from 2 µg total RNA (SuperScript II, GIBCO). RT–PCR was performed using the following primers: rat G3PDH as published previously [26], mouse
MHC according to gene bank accession number M76599
[GenBank]
(5'-ACGGCCCTTTGACATCC-3', 5'-CGGACACCTCTCCCTGAG-3'). For verification of RT–PCR products, amplified cDNAs were initially subcloned into pGEM-T (Promega) and sequenced. Samples were tested for equal G3PDH content before
MHC RT–PCR was performed under linear amplification conditions. Bands were densiometrically scanned using Quantity One (BIORAD).
2.4 Electrophoretic mobility shift assay (EMSA)
EMSA was performed as described previously [27,28] with some modifications. In brief: protein extracts from various mouse tissues were obtained by homogenization in Totex-buffer (20 mM Hepes pH 7.5, 400 mM NaCl, 1 mM MgCl2, 0.5 mM EDTA, 0.1 mM EGTA, 20% Glycerol, 1% Nonidet P-40, supplemented with 5 mM DTT, 0.01% Aprotinin, and 1 mM PMSF). CM were scraped into PBS, briefly centrifuged and lysed in Totex-buffer. Protein concentrations were determined (BIORAD, Protein Assay, Bradford). Oligonucleotides: an E-box element located at position –47 in the
MHC promoter (
MHC E-box) 5'GACTCCAAATTTAGGCAGCAGGCACGTGGAATGAGC3' [21] and an E-box element of the MCK promoter (MCK E-box) 5'CCCAACACCTGCTGCCTGCTGAGCC3' [22] were end-labeled with T4 polynucleotide kinase (NEB). Then, 10–20 µg protein were incubated with 1 ng of labeled oligonucleotide in 20 µl binding buffer (25 mM Hepes pH 7.5, 5 mM MgCl2, 1 mM KCl, 0.05 µg/µl dIdC, 0.1 µg/ml BSA, 1 mM DTT, 0.01% Aprotinin, 1 mM PMSF) for 30 min on ice. DNA–protein complexes were separated on 5% polyacrylamide gels and subjected to autoradiography. Bands were finally scanned using Quantity One (BIORAD).
2.5 Nitrotyrosine immunohistochemistry
Paraffin embedded myocardial sections from TNF
transgenic and wildtype mice were deparaffinized in xylene and rehydrated in graded EtOH concentrations. Endogenous peroxidase activity was blocked by treating sections with 1% H2O2 for 15 s. Sections were then blocked in 2% goat serum in PBS for 1 h. Incubation with the primary anti-nitrotyrosine polyclonal antibody (Upstate Biotech., 5 mg/ml) was performed in a humidified chamber for 1 h. Sections were subsequently washed in PBS and incubated with a biotinylated secondary antibody (Vectastain ABC elite secondary antibody, 1:50 dilution), followed by incubation with an avidin–biotin detection system and the peroxidase substrate, diaminobenzidine (DAB) according to the manufacturer's instructions (Vector Labs). The sections were finally counterstained with hematoxylin and visualized by light microscopy.
2.6 Statistical analysis
All data are given as mean±S.D. of at least three separate experiments. Differences were evaluated by ANOVA. Statistical significance was defined as P<0.05.
| 3. Results |
|---|
|
|
|---|
3.1 TNF
decreases the level of
MHC mRNA in cardiomyocytes through nitric oxide-dependent mechanismsVentricular myocytes (CM) were treated with recombinant TNF
(20 ng/ml) for 48 h, and
MHC transcripts levels were assessed by RT–PCR. TNF
treated cells exhibited a marked decrease (P<0.02) in
MHC mRNA concentration (Fig. 1).
|
To examine the role of nitric oxide (NO) in mediating TNF
effects on
MHC transcript levels, we employed the NOS inhibitor L-NNA (500 µM). Addition of L-NNA 30 min prior to treatment with TNF
abolished the inhibitory effect of TNF
on
MHC mRNA expression in CM (P<0.02) (Fig. 1). L-NNA alone did not significantly increase
MHC mRNA levels (data not shown).
3.2 TNF
attenuates E-box protein binding activities via nitric oxide
MHC transcription is regulated in part by E-box dependent mechanisms [21,29]. At least three DNA–protein complexes with different migration properties were observed when nuclear extracts from CM were incubated with the
MHC E-box oligonucleotide (Fig. 2A). Specificity of binding was confirmed by adding a 100-fold excess of unlabeled
MHC E-box oligonucleotide, which abolished DNA-protein binding of the three complexes (data not shown).
|
Exposure of CM to TNF
(20 ng/ml, 48 h) significantly reduced (P<0.05) DNA-protein binding of the complex indicated by arrow 3 (Fig. 2). Additional complexes, indicated by arrows 1 and 2 (Fig. 2), were not affected by TNF
. Addition of L-NNA (500 µM) restored E-box binding in TNF
treated cells (Fig. 2A). L-NNA alone did not significantly affect E-box binding (data not shown). Densitometric analyses of the binding intensity of complex 3 (Fig. 2, arrow 3) are summarized in Fig. 2B.
3.3 Sodium-nitroprusside (SNP) and TNF
decrease transcriptional activity of an E-box luciferase plasmid in CM
To investigate whether protein binding to the
MHC E-box is directly affected by nitric oxide, DNA-binding reactions of nuclear extracts isolated from CM were incubated with the NO donor SNP in the presence of 1 mM DTT (Fig. 3A). SNP releases NO in the presence of DTT and increases nitrosoactive stress in binding reactions [30]. DNA–protein binding was disrupted dose-dependently by SNP (Fig. 3A). To determine whether TNF
and NO attenuate not only DNA–protein binding, but also E-box dependent gene transcription, CM were transfected with a luciferase-reporter construct driven by an E-box promoter (pM4-min-tk-luc) [24]. CM transfected with the E-box promoter luciferase-reporter plasmid displayed significantly (P<0.05) higher luciferase activities as compared to CM transfected with a control plasmid (Fig. 3B). Addition of TNF
or SNP significantly reduced (P<0.05) luciferase activities in E-box promoter luciferase-reporter plasmid transfected cells (Fig. 3B).
|
3.4 Mice with cardiac specific over-expression of TNF
display enhanced nitrotyrosine staining, and a decrease in E-box binding and
MHC transcript levelsCardiac specific over-expression of TNF
in mice results in concentric hypertrophy which transitions to a dilated cardiac phenotype by 12 weeks of age [25]. TNF
transgenic mice (age: 14±2 weeks) exhibited significantly reduced (P<0.05)
MHC mRNA levels as compared to wildtype siblings (Fig. 4). To investigate whether the reduction in
MHC expression was associated with increased NO production, we determined the NO content in wildtype and in TNF
transgenic myocardium. Nitrotyrosine staining in cross sections served as a marker for increased NO production. Nitrotyrosine staining was almost absent in wildtype hearts (Fig. 5, panel A and B). By contrast, there was abundant nitrotyrosine staining in TNF
transgenic hearts (Fig. 5, panel C and D) consistent with high levels of nitric oxide in mutant mice. The same staining pattern was observed in additional three mutant and three wildtype mice.
|
|
The
MHC E-box oligonucleotide forms several DNA–protein complexes of different migration properties when incubated with extracts of spleen, liver, skeletal muscle and heart (Fig. 6A). In mouse hearts, four major complexes were observed (Fig. 6A). The fact that an unrelated E-box containing oligonucleotide (derived from the muscle creatine kinase promoter, MCK E-box [22]) was recognized by at least three protein complexes with identical migration properties (Fig. 6B and C, arrows 1, 3 and 4), which were fully competed away by 100-fold excess of unlabeled
MHC E-box oligonucleotide (data not shown), confirmed the specificity of these three DNA–protein complexes to the E-box motif within the
MHC E-box oligonucleotide. In order to investigate whether increased nitrotyrosine staining in TNF
over-expressing myocardium correlates with a reduction of E-box binding, we analyzed E-box binding in myocardial extracts from wildtype and TNF
transgenic mice, using both the
MHC E-box and the MCK E-box oligonucleotides. Binding analyses of both oligonucleotides revealed reduced DNA–protein binding of two complexes (Fig. 6B and C, arrow 3 and 4). Similar findings were observed in additional three transgenic and two wildtype mice.
|
| 4. Discussion |
|---|
|
|
|---|
Our study demonstrates for the first time that TNF
mediated increased production of nitric oxide in the heart has sustained effects, by altering transcription: (1) from a common muscle specific enhancer element, E-box; and (2) of the cardiac specific gene,
MHC.
Serum levels of TNF
are elevated in patients with CHF and expression of TNF
emerges in cardiomyocytes of failing hearts [1,2,32]. Mice with cardiac specific over-expression of TNF
develop a profound dilated cardiomyopathy-like phenotype and activation of the fetal gene program [6,33], indicating a role for TNF
in the pathogenesis of CHF. Most studies so far have focused on the induction of cardiac hypertrophy and remodeling by TNF
[25,34,35]. In contrast, we examined the impact of TNF
on the transcriptional regulation of
MHC, a key protein of the cardiomyocyte contractile apparatus, which is down-regulated in the failing myocardium [12–14].
MHC gene expression is regulated mainly at the level of transcription [15]. Our observation that
MHC down-regulation by TNF
was achieved in part by NO dependent pathways raised the question whether NO directly affects transcriptional regulation of
MHC. Indeed, NO directly interfered with protein binding to the
MHC E-box motif in CM nuclear extracts, indicating that transcription factors binding to the E-box are sensitive to redox modification or nitrosylation. In our studies, short-term and direct incubation of cell lysates with the NO-donor SNP was more efficient in disrupting protein binding to the E-box as compared to chronic whole cell stimulation with TNF
. Differences in NO concentration and time-kinetics may explain this observation (rapid NO release from SNP vs. delayed and extended NO-synthesis following TNF
stimulation). However, other mechanism(s) cannot be excluded. Our observation, that TNF
and SNP, decreased transcriptional activity of an E-box luciferase-reporter plasmid, demonstrates that TNF
and NO not only alter E-box binding, but also decrease E-box dependent transcription. Transcriptional regulation by redox and nitrosoactive stress has been described for several transcription factors including AP-1, Sp-1, NF-
B and p53 [36]. It has been shown in skeletal muscle that the E-box binding transcription factor JunD is regulated by nitrosoactive stress [22].
E-box motifs have been implicated in cell cycle control as well as in muscle differentiation. bHLH transcription factors including c-Myc, Max, MAD, MyoD, myogenin and JunD bind to E-box motifs [22,24,37]. In cardiomyocytes, several tissue-specific and ubiquitously expressed E-box binding transcription factors, e.g. transcription enhancer factor 1 (TEF1), Max, upstream stimulatory factor 1 (USF1) [21,38], have been described. Our finding that E-box DNA–protein binding complexes show a heart-specific pattern may indicate that E-boxes are involved in cardiomyocyte specific gene expression. In rat cardiomyocyte culture, three DNA–protein complexes were detected by EMSA. By contrast, four complexes were observed in mouse cardiac tissue. Although we have not specifically addressed the reason(s) for this disparity, it is possible that heart extracts contain additional DNA–binding proteins, which are expressed only in non-cardiomyocytes, i.e. cell types that are much less abundant in cardiomyocyte cultures. Species differences (cardiomyocytes from rats, tissue from mice) are less likely to explain the different number of DNA–protein complexes, because, similar to the situation in mouse heart tissue, we have detected four DNA–protein complexes by EMSA in rat heart tissue (data not shown). Interestingly, binding intensities of complexes predominantly observed in the myocardium, are decreased in failing hearts of TNF
transgenic mice, implicating a regulation by TNF
. It will be interesting to elucidate whether E-box binding transcription factors are affected in their expression levels and/or activity by TNF
and/or nitrosoactive stress in the heart. So far, we do not know the transcription factor composition of individual E-box binding complexes in CM or mouse hearts. In preliminary studies, however, we have observed reduced expression of JunD in TNF
over-expressing mice (data not shown). In future experiments we will analyze whether JunD is an E-box binding transcription factor in CM and whether it is susceptible to regulation by TNF
and/or nitrosoactive stress.
Cell culture models have limitations and may not always reflect the in vivo situation. Therefore, we used TNF
transgenic mice to confirm our in vitro data. In this model, we observed increased NO production (nitrotyrosine staining) and reduced E-box binding as well as decreased mRNA levels of
MHC. These observations support the notion that TNF
may suppress
MHC expression via NO and E-box dependent mechanisms also in the in vivo situation.
Time for primary review 18 days.
| Acknowledgements |
|---|
We are grateful to Silvia Gutzke for technical support. This study was supported in part by the Deutsche Forschungsgemeinschaft (SFB 244).
| References |
|---|
|
|
|---|
- Levine B., Kalman J., Mayer L., et al. Elevated circulating levels of tumor necrosis factor in severe chronic heart failure. N Engl J Med (1990) 323:236–241.[Abstract]
- Torre-Amione G., Kapadia S., Benedict C., et al. Proinflammatory cytokine levels in patients with depressed left ventricular ejection fraction: a report from the Studies of Left Ventricular Dysfunction (SOLVD). J Am Coll Cardiol (1996) 27:1201–1206.[Abstract]
- Yokoyama T., Vaca L., Rossen R.D., et al. Cellular basis for the negative inotropic effects of tumor necrosis factor-alpha in the adult mammalian heart. J Clin Invest (1993) 92:2303–2312.[Web of Science][Medline]
- Pagani F.D., Baker L.S., Hsi C., et al. Left ventricular systolic and diastolic dysfunction after infusion of tumor necrosis factor-alpha in conscious dogs. J Clin Invest (1992) 90:389–398.[Web of Science][Medline]
- Mann D.L., Young J.B. Basic mechanisms in congestive heart failure. Recognizing the role of proinflammatory cytokines. Chest (1994) 105:897–904.[CrossRef][Web of Science][Medline]
- Kubota T., McTiernan C.F., Frye C.S., et al. Dilated cardiomyopathy in transgenic mice with cardiac-specific overexpression of tumor necrosis factor-alpha. Circ Res (1997) 81:627–635.
[Abstract/Free Full Text] - Muller-Werdan U., Schumann H., Fuchs R., et al. Tumor necrosis factor alpha (TNF alpha) is cardiodepressant in pathophysiologically relevant concentrations without inducing inducible nitric oxide-(NO)-synthase (iNOS) or triggering serious cytotoxicity. J Mol Cell Cardiol (1997) 29:2915–2923.[CrossRef][Web of Science][Medline]
- Muller-Werdan U., Schumann H., Loppnow H., et al. Endotoxin and tumor necrosis factor alpha exert a similar proinflammatory effect in neonatal rat cardiomyocytes, but have different cardiodepressant profiles. J Mol Cell Cardiol (1998) 30:1027–1036.[CrossRef][Web of Science][Medline]
- Finkel M.S., Oddis C.V., Jacob T.D., et al. Negative inotropic effects of cytokines on the heart mediated by nitric oxide. Science (1992) 257:387–389.
[Abstract/Free Full Text] - Clerk A., Harrison J.G., Long C.S., et al. Pro-inflammatory cytokines stimulate mitogen-activated protein kinase subfamilies, increase phosphorylation of c-Jun and ATF2 and upregulate c-Jun protein in neonatal rat ventricular myocytes. J Mol Cell Cardiol (1999) 31:2087–2099.[CrossRef][Web of Science][Medline]
- Stein B., Frank P., Schmitz W., et al. Endotoxin and cytokines induce direct cardiodepressive effects in mammalian cardiomyocytes via induction of nitric oxide synthase. J Mol Cell Cardiol (1996) 28:1631–1639.[CrossRef][Web of Science][Medline]
- Nadal-Ginard B., Mahdavi V. Molecular basis of cardiac performance. Plasticity of the myocardium generated through protein isoform switches. J Clin Invest (1989) 84:1693–1700.[Web of Science][Medline]
- Calderone A., Takahashi N., Izzo N.J. Jr., et al. Pressure- and volume-induced left ventricular hypertrophies are associated with distinct myocyte phenotypes and differential induction of peptide growth factor mRNAs. Circulation (1995) 92:2385–2390.
[Abstract/Free Full Text] - Lowes B.D., Minobe W., Abraham W.T., et al. Changes in gene expression in the intact human heart. Downregulation of alpha-myosin heavy chain in hypertrophied, failing ventricular myocardium. J Clin Invest (1997) 100:2315–2324.[Web of Science][Medline]
- Izumo S., Lompre A.M., Matsuoka R., et al. Myosin heavy chain messenger RNA and protein isoform transitions during cardiac hypertrophy. Interaction between hemodynamic and thyroid hormone-induced signals. J Clin Invest (1987) 79:970–977.[Web of Science][Medline]
- Baker D.L., Dave V., Reed T., et al. A novel E box/AT-rich element is required for muscle-specific expression of the sarcoplasmic reticulum Ca2+-ATPase (SERCA2) gene. Nucleic Acids Res (1998) 26:1092–1098.
[Abstract/Free Full Text] - Gupta M.P., Gupta M., Zak R. An E-box/M-CAT hybrid motif and cognate binding protein(s) regulate the basal muscle-specific and cAMP-inducible expression of the rat cardiac alpha-myosin heavy chain gene. J Biol Chem (1994) 269:29677–29687.
[Abstract/Free Full Text] - Izumo S., Mahdavi V. Thyroid hormone receptor alpha isoforms generated by alternative splicing differentially activate myosin HC gene transcription. Nature (1988) 334:539–542.[CrossRef][Medline]
- Molkentin J.D., Jobe S.M., Markham B.E. Alpha-myosin heavy chain gene regulation: delineation and characterization of the cardiac muscle-specific enhancer and muscle-specific promoter. J Mol Cell Cardiol (1996) 28:1211–1225.[CrossRef][Web of Science][Medline]
- Sartorelli V., Webster K.A., Kedes L. Muscle-specific expression of the cardiac alpha-actin gene requires MyoD1, CArG-box binding factor, and Sp1. Genes Dev (1990) 4:1811–1822.
[Abstract/Free Full Text] - Xiao Q., Ojamaa K. Regulation of cardiac alpha-myosin heavy chain gene transcription by a contractile-responsive E-box binding protein. J Mol Cell Cardiol (1998) 30:87–95.[CrossRef][Web of Science][Medline]
- Buck M., Chojkier M. Muscle wasting and dedifferentiation induced by oxidative stress in a murine model of cachexia is prevented by inhibitors of nitric oxide synthesis and antioxidants. EMBO J (1996) 15:1753–1765.[Web of Science][Medline]
- Wollert K.C., Taga T., Saito M., et al. Cardiotrophin-1 activates a distinct form of cardiac muscle cell hypertrophy. Assembly of sarcomeric units in series via gp130/leukemia inhibitory factor receptor-dependent pathways. J Biol Chem (1996) 271:9535–9545.
[Abstract/Free Full Text] - Sommer A., Burkhardt H., Keyse S.M., et al. Synergistic activation of the mkp-1 gene by protein kinase A signaling and USF, but not c-Myc. FEBS Lett (2000) 474:146–150.[CrossRef][Web of Science][Medline]
- Sivasubramanian N., Coker M.L., Kurrelmeyer K.M., et al. Left ventricular remodeling in transgenic mice with cardiac restricted overexpression of tumor necrosis factor. Circulation (2001) 104:826–831.
[Abstract/Free Full Text] - Schieffer B., Schieffer E., Hilfiker-Kleiner D., et al. Expression of angiotensin II and interleukin 6 in human coronary atherosclerotic plaques: potential implications for inflammation and plaque instability. Circulation (2000) 101:1372–1378.
[Abstract/Free Full Text] - Dignam J.D., Lebovitz R.M., Roeder R.G. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res (1983) 11:1475–1489.
[Abstract/Free Full Text] - Wollert K.C., Heineke J., Westermann J., et al. The cardiac fas (APO-1/CD95) receptor/Fas ligand system: relation to diastolic wall stress in volume-overload hypertrophy in vivo and activation of the transcription factor AP-1 in cardiac myocytes. Circulation (2000) 101:1172–1178.
[Abstract/Free Full Text] - Molkentin J.D., Markham B.E. An M-CAT binding factor and an RSRF-related A-rich binding factor positively regulate expression of the alpha-cardiac myosin heavy-chain gene in vivo. Mol Cell Biol (1994) 14:5056–5065.
[Abstract/Free Full Text] - Bates JN, Baker MT, Guerra RJ, et al. Nitric oxide generation from nitroprusside by vascular tissue. Evidence that reduction of the nitroprusside anion and cyanide loss are required. Biochem Pharmacol 1991; S157–S165.
- He T.C., Zhou S., da Costa L.T., et al. A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci USA (1998) 95:2509–2514.
[Abstract/Free Full Text] - Testa M., Yeh M., Lee P., et al. Circulating levels of cytokines and their endogenous modulators in patients with mild to severe congestive heart failure due to coronary artery disease or hypertension. J Am Coll Cardiol (1996) 28:964–971.[Abstract]
- Bryant D., Becker L., Richardson J., et al. Cardiac failure in transgenic mice with myocardial expression of tumor necrosis factor-alpha. Circulation (1998) 97:1375–1381.
[Abstract/Free Full Text] - Siwik D.A., Chang D.L., Colucci W.S. Interleukin-1beta and tumor necrosis factor-alpha decrease collagen synthesis and increase matrix metalloproteinase activity in cardiac fibroblasts in vitro. Circ Res (2000) 86:1259–1265.
[Abstract/Free Full Text] - Kubota T., Bounoutas G.S., Miyagishima M., et al. Soluble tumor necrosis factor receptor abrogates myocardial inflammation but not hypertrophy in cytokine-induced cardiomyopathy. Circulation (2000) 101:2518–2525.
[Abstract/Free Full Text] - Sun Y., Oberley L.W. Redox regulation of transcriptional activators. Free Radic Biol Med (1996) 21:335–348.[CrossRef][Web of Science][Medline]
- Evans S.M., Walsh B.A., Newton C.B., et al. Potential role of helix-loop-helix proteins in cardiac gene expression. Circ Res (1993) 73:569–578.
[Abstract/Free Full Text] - Gupta M.P., Amin C.S., Gupta M., et al. Transcription enhancer factor 1 interacts with a basic helix-loop-helix zipper protein. Max, for positive regulation of cardiac alpha-myosin heavy-chain gene expression. Mol Cell Biol (1997) 17:3924–3936.[Abstract]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





