© 2001 by European Society of Cardiology
Copyright © 2000, European Society of Cardiology
Differential expression of cardiac ANP and BNP in a rabbit model of progressive left ventricular dysfunction
aKlinik und Poliklinik für Innere Medizin II, Klinikum der Universität Regensburg, F.J. Strauss Allee 11, 93042 Regensburg, Germany
bScios Inc., Sunnyvale, CA 94085, USA
* Corresponding author. Tel.: +49-941-944-7257; fax: +49-941-944-7339 andreas.luchner{at}klinik.uni-regensburg.de
Received 19 December 2000; accepted 26 March 2001
| Abstract |
|---|
|
|
|---|
Objective: Activation of atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP) is considered a hallmark of myocardial remodeling. To determine magnitude and relative proportion of activation during the progression to heart failure, we assessed ANP and BNP gene expression in atrial and left ventricular (LV) tissue in a newly developed model of progressive rapid ventricular pacing-induced heart failure in rabbits. Methods: Six animals underwent progressive pacing with incremental rates (330 beats per min (bpm) to 380 bpm over 30 days), resulting in congestive heart failure (CHF). Five animals underwent pacing at 330 bpm for 10 days only (early LV dysfunction, ELVD) and five additional animals served as control group (CTRL). Results: ELVD was characterized by decreased mean arterial pressure (P=0.05 vs. CTRL) as well as significantly impaired LV function (LV fractional shortening (FS) P<0.01 vs. CTRL) and dilatation (P<0.01 vs. CTRL). CHF was characterized by further decreased mean arterial pressure (P<0.01 vs. ELVD), further impaired LV function (FS P<0.03 vs. ELVD) and dilatation (P<0.01 vs. CTRL). In control animals, significant ANP expression was observed only in atrial tissue (P<0.02 vs. BNP) while BNP expression was ubiquitous but marginal (LV P<0.05 vs. ANP). In ELVD, activation of ANP (atria and LV P<0.05 vs. CTRL) and BNP (atria P<0.05 vs. CTRL, LV n.s.) was observed. In CHF, LV-BNP increased further markedly (P<0.01 vs. CTRL, P<0.05 vs. ELVD) while atrial ANP and BNP expression as well as LV ANP expression remained unchanged (all P=n.s. vs. ELVD). Conclusion: The current studies demonstrate differential activation of atrial and LV ANP and BNP under normal conditions and during the progression to heart failure and provide a molecular basis for the superiority of BNP as marker of LV dysfunction and CHF.
KEYWORDS Gene expression; Heart failure; Natriuretic peptide
| 1 Introduction |
|---|
|
|
|---|
Atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP) are genetically distinct hormones of cardiac origin. ANP was originally extracted from atrial tissue [1] and is released from secretory granules in response to atrial stretch [2]. BNP was first extracted from porcine brain [3] but is now also considered a cardiac natriuretic peptide [4,5]. Both, ANP and BNP have established roles in electrolyte and volume-homeostasis [6,7].
In contrast to ANP, which is predominant in atrial myocytes under normal conditions [8,9], controversy persists with respect to the presence and abundance of BNP gene expression in atrial and ventricular myocardium under normal conditions and in early heart failure. Although the opinion that BNP is of primarily ventricular origin was fueled by studies, which have reported strong left ventricular (LV) BNP expression under normal conditions in humans [10] and animals [11], conflicting studies failed to demonstrate significant expression of LV BNP under normal conditions [9,12–14]. The discussion as to the major site of BNP expression is ongoing, particularly since studies which have investigated atrial as well as ventricular BNP expression under control conditions and during the progression to congestive heart failure (CHF) are sparse.
Rapid ventricular pacing-induced heart failure is an animal model which allows to reproducibly induce LV dysfunction and dilatation and has traditionally been carried out in large animals, i.e. dogs, pigs, and sheep [15–17]. Recently, rapid ventricular pacing-induced heart failure was also implemented as a small animal model in the rabbit [18–21]. It was our objective to utilize the rabbit model for the first time to define cardiac ANP and BNP gene expression in atrial and ventricular myocardium throughout the progression to CHF. Since we were particularly interested in the temporal pattern of activation, we modified the traditional model of straight pacing and developed a model, which slowly evolves over 30 days from a chronic period of early LV dysfunction (ELVD) to CHF.
The hypothesis of the current investigation was that atrial myocardium is the major site of ANP expression and that BNP is expressed only marginally in atrial and LV myocardium in the absence of LV dysfunction. Further we hypothesized that differential atrial and ventricular recruitment of ANP and BNP occurs during the progression to CHF and that CHF is associated with a particularly strong recruitment of LV BNP. To address this hypothesis, we assessed ANP and BNP gene expression with rabbit-specific cDNAs in atrial and LV myocardium in the absence of LV dysfunction as well as in ELVD and CHF.
| 2 Methods |
|---|
|
|
|---|
2.1 Study protocol
Sixteen male rabbits (chinchilla bastard) were used for the study. Eleven rabbits underwent implantation of a programmable cardiac pacemaker (Medtronic Minix 8340, Minneapolis, MN). Under anesthesia (ketamine 60 mg/kg and xylazine 5 mg/kg i.m.), the right internal jugular vein was dissected and cannulated with a single-lumen central venous catheter (Braun, Germany). The catheter was then advanced into the right ventricle under pressure guidance. A 2 french transvenous screw-in pacemaker lead (Medtronic) was advanced through the catheter into the right ventricular apex and implanted endocardially. The pacemaker was implanted subcutaneously into the right abdominal wall and the pacemaker lead was connected subcutaneously with the pacemaker. To the best of our knowledge, this is the first study in rabbits where rapid ventricular pacing-induced heart failure was induced with a transvenously implanted pacemaker system. All rabbits were allowed to recover for at least 10 days after surgery before the pacemaker was started for the induction of heart failure. Proper pacemaker function was checked intraoperatively, at the time of programming, and subsequently all 10 days. All studies were approved by the governmental animal care committee.
Six rabbits (CHF group) underwent pacing with a stepwise increase of stimulation frequencies over 30 days. During the first 10 days, animals were paced at 330 beats per min (bpm). This protocol results in ELVD, as defined by significant LV systolic dysfunction with cardiac enlargement and decreased perfusion pressure but no clinical signs of heart failure. The pacing rate was then increased to 360 bpm for 10 days and then 380 bpm for another 10 days and ELVD evolved to CHF with further cardiac enlargement and further decreased perfusion pressure together with clinical signs of fluid retention (ascites). A similar step-wise pacing protocol over 38 days in dogs also evolves from ELVD to CHF and results in progressive canine heart failure [13,22–24].
At baseline (control), after being paced at 330 bpm for 10 days (ELVD) and at the end of the protocol (CHF), conscious arterial pressure was measured invasively via the medial ear artery and a 2-D guided M-mode echocardiogram was obtained. At the end of the pacing protocol, rabbits were killed by i.v. euthanasia and tissue was rapidly harvested. Hearts were trimmed on ice, snap frozen in liquid nitrogen and stored at –80°C until further processing.
A second group of five rabbits was paced at 330 bpm for 10 days only and served as tissue donors for the ELVD group and a third group of five normal rabbits served as tissue donors for the control group. Again, invasive hemodynamic measurements and an echocardiogram were obtained to assess cardiac function before animals were euthanized and tissue was rapidly harvested and deep-frozen.
2.2 Analytical methods
For analysis of cardiac natriuretic peptide expression, mRNA was extracted from all atrial and LV samples utilizing a commercially available kit (Fasttrack, Invitrogen). Briefly, tissue was homogenized (Polytron PT 1200) in a detergent-based buffer containing RNAse/Protein Degrader and incubated in a slow-shaking waterbath. DNA was precipitated and sheared and oligo (dT) cellulose was added for adsorption of polyadenylated mRNA. DNA, proteins, cell debris and non-polyadenylated RNA were washed off and mRNA eluted off the oligo (dT) cellulose. The yield of mRNA was determined in a spectrophotometer by absorption of 260 nm UV-light. Approximately 5 µg mRNA per extract were loaded on a 1.2% agarose formaldehyde gel and electrophoresed for 2–3 h at 75 V. The gel was blotted downward overnight (Turbo-Blotter, Schleicher & Schuell) onto a nylon membrane (Maximum Strength Nytran Membrane, Schleicher & Schuell).
As a probe for ANP mRNA, a 393 base-pair partial cDNA specific for rabbit ANP was synthesized. In brief, first-strand cDNA was reverse transcribed from rabbit atrial mRNA. Then, DNA-amplification was performed by polymerase chain reaction with 20-base oligomers as primers. Amplification temperatures were 95°C for 60 s, 56°C for 120 s and 72°C for 180 s and 35 amplification cycles were performed. CTAACCCAGTGTACAACGCC was used as 5' primer and GGCTGTTATCTTCGGTACCG as 3' primer, corresponding to nucleotides 157–176 and 531–540 of the published sequence [25]. The resulting DNA was electrophoresed in a 1% agarose gel, resulting in a single sharp band of the predicted length. This band was recovered from the gel and sequenced. The resulting nucleotide sequence was identical to the predicted sequence, thus confirming that the recovered DNA contained a specific cDNA to rabbit ANP mRNA.
As a probe for BNP mRNA, a 750 bp EcoR1/HindIII DNA restriction fragment containing the gene for rabbit BNP (courtesy A.A. Protter, Scios Inc., Sunnyvale, CA, USA) was used.
Fifty ng of both probes were random primed with P32-dCTP (Random Primed DNA Labeling Kit, Boehringer Mannheim Biochemical, Germany) and column-purified. Membranes were prehybridized (QuickHyb Hybridization Solution, Stratagene) for 10 min at 68°C and then hybridized with the labeled probe for 80 min at 68°C. Membranes were then washed stringent (2x SSC/0.1% SDS at 22°C for 5 min, then 0.2x SSC/0.1% SDS at 22°C for 5 min, then 0.2x SSC/0.1% SDS at 55°C for 20 min) and exposed to an X-ray film overnight. To control for loading conditions and mRNA transfer onto the membranes, blots were re-hybridized with a GAPDH probe. The respective autoradiographic bands for ANP, BNP and GAPDH were quantified with a scanning spectrophotometer and ANP and BNP mRNA expressed in arbitrary units as ratio of autoradiographic densities of the respective band and the GAPDH-band.
2.3 Echocardiography
A long and short-axis echocardiogram (HP Sonos 5500, 12 MHz probe) was performed under light sedation (5 mg midazolam i.m.) in a supine position from the left parasternal window. LV end-diastolic (LVEDd) and end-systolic (LVESd) dimensions and diastolic and systolic thickness of the left ventricular anterior wall (AEDth and AESth) and posterior wall (PEDth and PESth) as well as left atrial diameter (LAd) were determined from three repeated 2D guided M-mode tracings using the ASE convention. From those measurements, fractional shortening (FS) was calculated as: FS=(LVEDd–LVESd)/LVEDd.
2.4 Calculation of wall stress
From the blood pressure recordings, three repeated tracings were used for the assessment of peak systolic arterial pressure (SAP), which was used as an estimate of LV systolic pressure. Left ventricular systolic wall stress (LVSWS) was then calculated as [26,27]:
|
|
2.5 Statistical analysis
Results of the quantitative studies were expressed as mean±standard error of the mean. Comparison between the control, ELVD and CHF groups were performed by analysis of variance (ANOVA) followed by Fisher's least significant difference test. Comparison between the atrial and LV tissues as well as between ANP and BNP were performed by paired Student's t-test. Statistical significance was defined as P<0.05.
| 3 Results |
|---|
|
|
|---|
3.1 Blood pressure, LV function, and LV geometry (Table 1)
In ELVD, systolic (–7% vs. CTRL, P<0.02), diastolic (–6% vs. CTRL, P=n.s.) and mean arterial pressure (–7% vs. CTRL, P=0.05) were decreased. Significant LV dysfunction was present (FS –26% vs. CTRL, P<0.01) and LVs were dilated at end-diastole (LVEDd +26% vs. CTRL, P<0.01) and end-systole (LVESd +44% vs. CTRL, P<0.01). While only a tendency towards wall thinning was observed at end-diastole (AEDth –7% and PEDth –4% vs. CTRL, both P=n.s.), a significant reduction in wall thickness was present at end-systole (AESth –18% and PESth –19% vs. CTRL, both P<0.01).
|
In CHF, systolic (–18% vs. ELVD, P<0.01), diastolic (–17% vs. ELVD, P<0.01), and mean arterial pressure (–17% vs. ELVD, P<0.01) all decreased markedly and significantly further. LV function decreased further as compared to ELVD (FS –24% vs. ELVD, P<0.03) and further LV dilatation (LVEDd +5% vs. ELVD, P=n.s., LVESd +17%, P<0.05) and wall thinning at end-diastole (AEDth –8% vs. ELVD, P=n.s., and PEDth –15%, P<0.04) and end-systole (AESth –17% vs. ELVD, P=n.s., and PESth –20%, P<0.03) were observed.
3.2 Body and heart weight (Table 1)
Total body weight increased progressively but not statistically significantly in ELVD (+5% vs. CTRL, P=n.s.) and CHF (+5% vs. ELVD, P=n.s.). Total heart weight was increased in ELVD (+21% vs. CTRL, P<0.03) and did not increase further in CHF. Increased heart weight was due to increased atrial weight (+140% in ELVD and +148% in CHF, both P<0.01 vs. CTRL) and a tendency towards increased RV weight (both P=n.s. vs. CTRL). LV weight remained unchanged in ELVD (–1% vs. CTRL, P=n.s.) and CHF (–3% vs. ELVD, P=n.s.).
3.3 Atrial ANP and BNP gene expression (Fig. 1)
A positive signal for ANP and BNP mRNA was detected in all atrial samples from control, ELVD and CHF animals. Under control conditions, atrial ANP mRNA expression significantly exceeded the faint BNP expression (+300% vs. BNP, P<0.02). In ELVD, significant increases in both, ANP (+160% vs. CTRL, P<0.05) and BNP expression (+1354% vs. CTRL, P<0.01) were observed with a greater relative increase of BNP expression (P<0.01 vs. ANP). No further increases were observed for ANP or BNP expression when ELVD progressed to CHF. But inversely as in control animals, BNP expression now exceeded ANP expression significantly (+75% vs. ANP, P<0.03).
|
3.4 LV ANP and BNP gene expression (Figs. 2–4
While LV ANP mRNA expression was absent in most control animals, faint signals for BNP mRNA were present and LV BNP expression exceeded ANP expression significantly (P<0.05). In ELVD, the onset of significant LV ANP expression as well as increased LV BNP expression (+542% vs. CTRL, P=n.s.) were observed. While LV ANP expression did not increase further in CHF, a further strong increase was observed for LV BNP expression (+106% vs. ELVD, P<0.05) and BNP expression again exceeded ANP expression significantly (+382% vs. ANP, P<0.01).
|
|
|
Throughout the progression of CHF, LV BNP expression increased more steeply than ANP and in an almost linear fashion relative to LV systolic wall stress (Fig. 3). Relative to LV FS, BNP expression decreased in an almost linear fashion (Fig. 4).
| 4 Discussion |
|---|
|
|
|---|
In the current study, cardiac ANP and BNP gene expression was assessed for the first time in a small animal model of rapid ventricular pacing-induced heart failure. In order to address temporal changes during the evolution of heart failure, the traditional model of straight pacing was modified and experiments were carried out in a newly implemented model of progressive pacing which evolves from ELVD to CHF over a 30-day period. Northern analysis demonstrated that ANP is the predominant cardiac natriuretic peptide in the absence of ventricular dysfunction while BNP is only marginally expressed. In contrast, strong global cardiac natriuretic peptide activation is present during the progression to heart failure with a predominance of BNP in ELVD and CHF.
With respect to activation of BNP, our current findings confirm studies which failed to demonstrate significant expression of LV BNP under normal conditions [9,12] and challenge studies which have reported strong LV BNP expression in normal human [10] and animal [11] myocardium. With respect to the controversy whether BNP expression occurs predominantly in ventricular myocardium, our findings confirm studies that have demonstrated strong activation of LV BNP in severe CHF [9,14] and extend these studies as they demonstrate marked activation of LV BNP already in ELVD. Further they demonstrate additional activation of atrial BNP in ELVD and CHF and that atrial BNP expression in ELVD even exceeds LV expression.
As compared to ANP, activation of LV BNP during the progression of heart failure was observed to be stronger, both in ELVD and CHF. And while LV ANP does not increase further in CHF as compared to ELVD, activation of LV BNP increases further significantly. When related to LV systolic wall stress, it therefore becomes evident that LV BNP expression tracks wall stress closer than ANP expression and does so almost proportionally (Fig. 3). This close association suggests LV BNP expression as a superior marker of LV overload in progressive CHF and provides a molecular basis for the superiority of plasma BNP as biochemical marker of LV dysfunction which is currently evolving in a number of human studies [28–31].
Our finding that full activation of natriuretic peptide gene expression in this model occurs earlier in atrial as compared to LV tissue, namely in ELVD, points to a greater sensitivity of the atrial myocyte to stimulate ANP and BNP gene expression as compared to the ventricular myocyte. This effect may be related to a mechanic mechanism such as the greater atrial distensibility. It may, however, also indicate a greater dependency of ventricular myocytes upon further stimulation such as by local or circulating neurohormones, e.g. ANG II or ET-1. Since ANG II [32] and ET-1 [33] have been shown to induce transcription of early genes and stimulate myocyte growth or even directly stimulate BNP transcription, and since activation of both, ANG II and ET-1, has been demonstrated in clinical [34] and experimental CHF [24,35], these factors might provide additional stimuli in addition to LV systolic wall stress for full expression of natriuretic peptides in LV tissue in CHF.
Although the current study is the first to address cardiac natriuretic peptide gene expression in a small animal model of rapid ventricular pacing-induced heart failure and does so in a newly implemented model of progressive heart failure, cardiac ANP and BNP expression have also been studied earlier in large animal models of pacing-induced heart failure, albeit with conflicting results. When LV ANP expression was first studied in the dog model of traditional straight rapid ventricular pacing, either no induction [8] or only a statistically insignificant trend [17] towards induction of LV ANP gene expression was observed. Similar results were obtained in a very recent study where only weak increases in LV ANP expression were observed after straight pacing in pigs [14]. In contrast, when LV ANP and BNP expression were assessed in a recently developed large animal model of progressive pacing in dogs, strong LV ANP [36] and BNP [13] expression were observed in CHF. However, in contrast to the current study, neither LV ANP nor LV BNP expression was activated in dogs with ELVD [13,36]. The disparity between the current early onset of LV ANP and BNP gene expression in the rabbit model and the late onset in the dog model is remarkable and may indicate that activation of cardiac natriuretic peptide expression in heart failure differs between species. It may, alternatively, also relate to differences in stimulation protocols (with higher pacing rates in the rabbit) or hemodynamic differences. Nevertheless, this observation deserves further attention, particularly in human heart failure. Here, the relative extent of LV ANP and BNP expression in ELVD and CHF has not been established yet and remains to be assessed in future clinical studies.
In summary, the current studies provide insight into the temporal activation of cardiac ANP and BNP expression under normal conditions and in evolving CHF. They demonstrate that ANP is the predominant cardiac natriuretic peptide in the absence of ventricular dysfunction while BNP is only marginally expressed. They challenge the notion that BNP expression occurs predominantly in ventricular myocardium during the progression of heart failure and demonstrate strong atrial activation of BNP in ELVD and CHF. They further demonstrate that while atrial ANP and BNP expression reach an early maximum in ELVD, CHF is characterized by a further increase in cardiac natriuretic peptide activation, predominantly BNP. And lastly, they provide a molecular basis for the superiority of BNP as marker of LV dysfunction based upon the close association of BNP expression with LV systolic wall stress throughout the progression of heart failure.
Time for primary review 30 days.
| Acknowledgements |
|---|
Presented in part at Heart Failure 2000, June 29–July 1, 2000, Venice, Italy and published in abstract form in the European Journal of Cardiac Failure 2000;2(2):43. Supported by the Deutsche Forschungsgemeinschaft (Lu 562/3-1,2) and by an institutional grant of the Universität Regensburg (ReForM). The authors acknowledge outstanding technical assistance by A. Schiessl.
| References |
|---|
|
|
|---|
- De Bold A.J., Borenstein H.B., Veress A.T., Sonnenberg H. A rapid and potent natriuretic response to intravenous injection of atrial myocardial extract in rats. Life Sci (1981) 28:89–94.[CrossRef][Web of Science][Medline]
- Edwards B.S., Zimmermann R.S., Schwab R.R., Heublein D.M., Burnett J.C. Atrial stretch, not pressure, is the principal determinant controlling the acute release of atrial natriuretic factor. Circ Res (1988) 62:191–195.
[Abstract/Free Full Text] - Sudoh T., Kangawa K., Minamino N., Matsuo H. A new natriuretic peptide in porcine brain. Nature (1988) 332:78–81.[CrossRef][Medline]
- Aburaya M., Hino J., Minamino N., Kangawa K., Matsuo H. Isolation and identification of rat brain natriuretic peptide in cardiac atrium. Biochem Biophys Res Commun (1989) 163:226–232.[CrossRef][Web of Science][Medline]
- Kambayashi Y., Nakao K., Mukoyama M., et al. Isolation and sequence determination of human brain natriuretic peptide in human atrium. FEBS Lett (1990) 259:341–345.[CrossRef][Web of Science][Medline]
- Burnett J.C., Granger J.P., Opgenorth T.J. Effects of synthetic atrial natriuretic factor on renal function and renin release. Am J Physiol (1984) 247:F863–F866.[Web of Science][Medline]
- Clavell A.L., Stingo A.J., Aarhus L.L., Burnett J.C. Biological actions of brain natriuretic peptide in thoracic inferior vena caval constriction. Am J Physiol (1993) 265:R1416–R1422.[Web of Science][Medline]
- Perella M.A., Schwab T.R., O'Murchu B., et al. Cardiac atrial natriuretic factor during evolution of congestive heart failure. Am J Physiol (1992) 262:H1248–1255.[Web of Science][Medline]
- Takahashi T., Allen P., Izumo S. Expression of A-, B-, and C-type natriuretic peptide genes in failing and developing human ventricles. Circ Res (1992) 71:9–17.
[Abstract/Free Full Text] - Mukoyama M., Nakao K., Hosoda K., et al. Brain natriuretic peptide as a novel cardiac hormone in humans. JCI (1991) 87:1402–1412.[Web of Science][Medline]
- Ogawa Y., Nakao K., Mukoyama M., et al. Natriuretic peptides as cardiac hormones in normotensive and spontaneously hypertensive rats: the ventricle is a major site of synthesis and secretion of brain natriuretic peptide. Circ Res (1991) 69:491–500.
[Abstract/Free Full Text] - Adachi S., Ito H., Ohta Y., et al. Distribution of mRNAs for natriuretic peptides in RV hypertrophy after pulmonary arterial banding. Am J Physiol (1995) 268:H162–H169.[Web of Science][Medline]
- Luchner A., Stevens T., Borgeson D., et al. Differential atrial and ventricular expression of myocardial BNP during the evolution of heart failure. Am J Physiol (1998) 274:H1684–H1689.[Web of Science][Medline]
- Hystad M.E., Klinge R., Spurkland A., Attramadal H., Hall C. Contrasting cardiac regional responses of A-type and B-type natriuretic peptide to experimental chronic heart failure. Scand J Clin Lab Invest (2000) 60:299–309.[CrossRef][Web of Science][Medline]
- Coleman H., Taylor R., Pool P., et al. Congestive heart failure following chronic tachycardia. Am Heart J (1971) 81:790–798.[CrossRef][Web of Science][Medline]
- Riegger G.A.J., Elsner D., Forssmann W.G., Kromer E.P. Effects of ANP-(95-126) in dogs before and after induction of heart failure. Am J Physiol (1990) 259:H1643–1648.[Web of Science][Medline]
- Williams R.E., Kass D.A., Kawagoe Y., et al. Endomyocardial gene expression during development of pacing tachycardia-induced heart failure in the dog. Circ Res (1994) 75:615–623.
[Abstract/Free Full Text] - Masaki H., Imaizumi T., Ando S., et al. Production of chronic congestive heart failure by rapid ventricular pacing in the rabbit. Cardiovasc Res (1993) 27:828–831.[Web of Science]
- Colston J.T., Kumar P., Chambers J.P., Freeman G.L. Altered sarcolemmal calcium channel density and Ca(2+)-pump ATPase activity in tachycardia heart failure. Cell Calcium (1994) 16:349–356.[CrossRef][Web of Science][Medline]
- Spinale F.G., Walker J.D., Mukherjee R., et al. Concomitant endothelin receptor subtype-A blockade during the progression of pacing-induced congestive heart failure in rabbits. Beneficial effects on left ventricular and myocyte function. Circulation (1997) 95:1918–1929.
[Abstract/Free Full Text] - Eble D.M., Walker J.D., Samarel A.M., Spinale F.G. Myosin heavy chain synthesis during the progression of chronic tachycardia induced heart failure in rabbits. Basic Res Cardiol (1998) 93:50–55.[CrossRef][Web of Science][Medline]
- Stevens T.L., Borgeson D.D., Luchner A., et al. Tachycardia-induced cardiomyopathy. Spinale F., ed. (1996) Futura Press.
- Luchner A., Stevens T.L., Borgeson D.D., et al. Angiotensin II in the evolution of experimental heart failure. Hypertension (1996) 28:472–477.
[Abstract/Free Full Text] - Luchner A., Jougasaki M., Friedrich E., et al. Activation of cardiorenal and pulmonary tissue endothelin-1 in experimental heart failure. Am J Physiol Regul Integr Comp Physiol (2000) 279:R974–979.
[Abstract/Free Full Text] - Oikawa S., Imai M., Inuzuka C., et al. Structure of dog and rabbit precursors of atrial natriuretic polypeptides deduced from nucleotide sequence of cloned cDNA. Biochem Biophys Res Commun (1985) 132:892–899.[CrossRef][Web of Science][Medline]
- Grossmann W., Jones D., McLaurin L.P. Wall stress and patterns of hypertrophy in the human left ventricle. J Clin Invest (1975) 56:56–64.[Web of Science][Medline]
- Reichek N., Wilson J., Sutton M., et al. Noninvasive determination of left ventricular end-systolic stress: validation of the method and initial application. Circulation (1982) 65:99–108.
[Free Full Text] - McDonagh T., Robb S., Murdoch D., et al. Biochemical detection of left ventricular systolic dysfunction. Lancet (1998) 351:9–13.[CrossRef][Web of Science][Medline]
- Luchner A., Burnett J.C., Jougasaki M., et al. Evaluation of brain natriuretic peptide as marker of left ventricular dysfunction and hypertrophy in the population. J Hypertens (2000) 18:1121–1128.[CrossRef][Web of Science][Medline]
- Richards A.M., Nicholls M.G., Yandle T.G., et al. Plasma N-terminal pro-brain natriuretic peptide and adrenomedullin: new neurohumoral predictors of left ventricular function and prognosis after myocardial infarction. Circulation (1998) 97:1921–1929.
[Abstract/Free Full Text] - Troughton R.W., Frampton C.M., Yandle T.G., et al. Treatment of heart failure guided by plasma aminoterminal brain natriuretic peptide (N-BNP) concentrations. Lancet (2000) 355:1126–1130.[CrossRef][Web of Science][Medline]
- Dostal D., Baker B. Angiotensin II stimulation of left ventricular hypertrophy in adult rat heart. Am J Hypertens (1992) 5:276–280.[Web of Science][Medline]
- Ito H., Hiroe M., Hirata Y., et al. Endothelin ET-A receptor antagonist blocks cardiac hypertrophy provoked by hemodynamic overload. Circulation (1994) 89:2198–2203.
[Abstract/Free Full Text] - Wei C., Lerman A., Rodeheffer R., et al. Endothelin in human congestive heart failure. Circulation (1994) 89:1580–1586.
[Abstract/Free Full Text] - Margulies K., Hildebrand F., Lerman A., Perella M., Burnett J.C. Increased endothelin in experimental heart failure. Circulation (1990) 82:2226–2230.
[Abstract/Free Full Text] - Luchner A., Borgeson D., Grantham J., et al. Relationship between left ventricular wall stress and ANP gene expression during the evolution of rapid ventricular pacing-induced heart failure in the dog. Eur J Heart Fail (2000) 2(2000):379–386.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
S. G. Williams, L. L. Ng, R. J. O'Brien, S. Taylor, D. J. Wright, and L.-B. Tan Is plasma N-BNP a good indicator of the functional reserve of failing hearts? The FRESH-BNP study Eur J Heart Fail, December 1, 2004; 6(7): 891 - 900. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Mariano-Goulart, M.-C. Eberle, V. Boudousq, A. Hejazi-Moughari, C. Piot, C. C. de Kerleau, R. Verdier, M.-L. Barge, F. Comte, N. Bressot, et al. Major increase in brain natriuretic peptide indicates right ventricular systolic dysfunction in patients with heart failure Eur J Heart Fail, August 1, 2003; 5(4): 481 - 488. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

P<0.05 vs. ANP.
P<0.05 vs. ELVD.

