© 2001 by European Society of Cardiology
Copyright © 2001, European Society of Cardiology
Estrogen inhibits mechanical strain-induced mitogenesis in human vascular smooth muscle cells via down-regulation of Sp-1
aHormones and The Vasculature Laboratory, Baker Institute and Alfred Heart Centre, Alfred Hospital, Melbourne, Australia
bVascular Research Laboratory, Cardiology Division, University of California, San Francisco, CA, USA
cDivision of Nephrology, University of California, San Francisco, CA, USA
dBerlex Biosciences, Richmond, CA 94143, USA
* Corresponding address. Alfred and Baker Medical Unit, 3rd Floor, Alfred Hospital, Commercial Road, Prahran, VIC 3181, Australia. Tel.: +61-3-9276-3263; fax: +61-3-9276-2461 k.sudhir{at}alfred.org.au
Received 10 May 2000; accepted 14 December 2000
| Abstract |
|---|
|
|
|---|
Objective: The cellular basis of the cardioprotective effects of estrogen are largely unknown. An inhibitory effect on vascular smooth muscle (VSM) growth has been proposed. We examined the effect of 17β-estradiol (E2) on mechanical strain-induced mitogenesis in human fetal VSM cells. Methods and results: Cells were grown on fibronectin-coated plates with silicone-elastomer bottoms, and exposed to cyclic mechanical strain (60 cycles/min), with and without E2 (1 nmol/l), for 48 h. [3H]-Thymidine incorporation was measured during the last 6 h. Strain induced 1.5–2 fold increases in DNA synthesis that were attenuated by antibodies to platelet-derived growth factor (PDGF) AA and BB. Strain also induced increases both in mRNA and protein levels of Sp-1, a transcription factor that binds to the PDGF-A gene promoter site. E2 attenuated strain-induced mitogenesis, and also increases in mRNA and protein levels of Sp-1. The estrogen receptor (ER) antagonist ICI 182,780 (100 nmol/l) reversed the inhibitory effect of E2 on strain-induced increases in DNA synthesis and Sp-1 protein. RT-PCR analysis showed presence of both ER-
and -β in these cells. Conclusions: Estrogen inhibits strain-induced mitogenesis in human VSM cells via an ER mediated process involving down-regulation of the transcription factor Sp-1.
KEYWORDS Gender; Growth factors; Platelets; Smooth muscle
| 1 Introduction |
|---|
|
|
|---|
Estrogen use is associated with a reduced incidence of cardiovascular disease in postmenopausal women [1]. With the recent identification of an estrogen receptor (ER) in human vascular smooth muscle (VSM) [2] and endothelial cells [3], a direct vascular effect of estrogen has been proposed. Estrogen reportedly inhibits restenosis [4], and improves outcomes [5] following balloon angioplasty. In an experimental model of balloon injury of the rat carotid artery, estrogen attenuated myointimal proliferation [6]. 17β-Estradiol (E2) reportedly inhibits thymidine uptake by pig left anterior descending coronary artery segments [7]. In human umbilical vein smooth muscle cells in culture, serum and endothelin-1 induced increases in cell numbers were attenuated 75% by estrogen [8]. The mechanisms underlying these potentially beneficial anti-proliferative effects of estrogen are unclear. Sullivan et al. [9] showed that physiological levels of estrogen significantly suppressed the carotid arterial response to injury in ovariectomized normolipemic female mice. Of interest, Iafrati et al. [10] recently reported that estrogen inhibited this vascular injury response even in ER-
knockout (ERKO) mice, in which the ER-
gene is disrupted. These mice express ER-β in their vasculature, which likely mediates the anti-proliferative effect of E2 in this model. Both ER-
and ER-β exist widely and are distributed in most organs including the heart and vasculature in humans, and different and organ-specific roles have been suggested for these two receptors [11]. However, evidence for an ER-β-mediated effect of E2 in human vascular cells has not been directly demonstrated.
Repetitive physical deformation is a feature of the environment of VSM cells in vivo. It has previously been shown that cyclic mechanical strain stimulates the proliferation of neonatal rat VSM cells through production and autocrine action of platelet derived growth factor (PDGF) [12]. Strain also causes a synergistic increase in the response to other mitogens, such as angiotensin II, possibly via synergy between angiotensin II and PDGF [13]. Wilson et al. have shown that strain increases expression of the transcription factor Sp-1, and that GC-rich regions in the proximal 92 bp of the PDGF-A gene promoter contain mechanical strain-responsive elements that possibly bind Sp-1 [14]. The interaction between sex hormones and mechanical strain is unclear. Clearly such an interaction is relevant to the effect of estrogens on VSM cells in vivo, both in normal physiology and in states characterized by acute increases in stretch such as angioplasty [15], or chronic increases such as hypertension [16]. Accordingly, we investigated the effect of physiological concentrations of E2 on strain-induced proliferation, as well as on induction of Sp-1, in human fetal VSM cells. We also characterized ER subtypes to determine the presence of ER-
and ER-β in human vascular smooth muscle cells.
| 2 Methods |
|---|
|
|
|---|
2.1 Application of cyclic strain to cultured cells
Human fetal VSM cells (HF 16) were cultured from the aorta of a therapeutically aborted female fetus and generously supplied by Drs. Karen Yee and Stephen Schwartz at the Department of Pathology, University of Washington, Seattle [17]. Experiments were conducted in accordance with the policies of the local ethics committees. Cells from passage 3–7 were grown to confluence in six-well silicone elastomer-bottomed culture plates coated with pronectin (Flexcell, McKeesport, PA, USA), growth arrested in serum-free DMEM (without phenol red) for 24 h in the presence of E2 (1 nmol/l) or vehicle, and then subjected to cyclic mechanical strain (60 cycles/min) using a Flexercel Stress Unit (Flexcell). This unit repetitively applies vacuum (
15–20 kPa) to the rubber-bottomed dishes and a computer system controls the frequency and the extent of deformation (up to a maximum of 25% to the cells at the periphery of the dishes).
2.2 Measurement of DNA synthesis
Cells were incubated with [3H]-thymidine (1 µCi/well) during the final 6 h of the strain, washed with PBS, and extracted with 15% trichloroacetic acid at 4°C for 30 min. The rubber bottom of the Flex plates containing the TCA-precipitable material was removed from the plate and placed directly into a scintillation vial with 10 ml of scintillation solution for counting.
2.3 Isolation of total RNA and Northern blot
Total cellular RNA was isolated by an RNA STAT-60TM reagent (Tel-Test, Friendswood, TX, USA). A 10 µg amount of the RNA was electrophoresed on 1% agarose gels, transferred to nylon membranes (Amersham, Arlington Heights, IL, USA), and hybridized with a cDNA probe for Sp-1 message which was labeled with [
-32P] dCTP (3000 Ci/mmol; Amersham) using the random primer method. After washing with SSC 0.1% SDS buffers, membranes were exposed to X-ray films for 12–48 h at –70°C to obtain optimal signals. The membranes were stripped and, for normalization, rehybridized with a GAPDH cDNA probe using the same method. The autoradiographic signals were scanned with a PowerLook II Scanner (Umax Data System, Taipei, Taiwan, ROC) and the relative level of Sp-1 mRNA was normalized by comparison to the GAPDH mRNA signal.
2.4 Isolation of total protein and Western blot
Cells were scraped from the culture plates, suspended in 0.5% SDS–PBS, and broken using a syringe with a 20 G needle. After boiling for 10 min and centrifugation for 5 min at 4°C, proteins in the supernatant were quantified with BCA Protein Assay Reagent (Pierce Chemical, Rockford, IL, USA) by measuring the OD at 562 nm. A 20 µg amount of the protein was electrophoresed on 7% SDS–polyacrylamide gels and transferred to Hybond ECL filters (Amersham). After blocking with 10% nonfat dry milk in TBS (20 mM Tris, pH 7.5, 50 mM NaCl, and 0.1% Tween-20) overnight, filters were incubated with primary antibody of Sp-1 (rabbit polyclonal IgG; Santa Cruz Biotechnology, Santa Cruz, CA, USA) for 1 h and the HRP-conjugated secondary antibody (anti-rabbit) for 1 h. Filters were then incubated for 1 min with enhanced chemiluminescence reagents (Amersham) and exposed to X-ray films for 1–10 min to obtain ideal exposure. Signals of Sp-1 protein were scanned with a PowerLook scanner and relative levels of the protein were estimated by densitometry.
2.5 RT-PCR
The RT-PCR was performed by using the SuperScript One-Step RT-PCR system (Life Technologies, Rockville, MD, USA). A 0.5 µg amount of total RNA was added to the RT-PCR mixture and incubated at 50°C for 30 min and then at 94°C for 2 min. The reaction was amplified for 35 cycles by incubation at 92°C for 30 s, 60°C for 30 s, 72°C for 1 min, and a final incubation at 72°C for 5 min in a PCR 9600 thermocycler (Perkin-Elmer, Norwalk, CT, USA). The oligonucleotide primers used for ER-
were 5'CGCTGCGTCGCCTCTAACCTC3' and 5'GGCTCGGAGACACGCTGTTG3', which amplify a 430-base pair (bp) fragment from ER-
mRNA, and for ER-β were 5'CCTGGGCACCTTTCTCCTTTAGT3' and 5'GCAGAAGTGAGCATCCCTCTTTG3' to amplify a 200-bp fragment from ER-β mRNA. The primers for PDGF A chain were 5'ATGGCGTGTTACATTCCTGAAC3' and 5'TTCGTCCTTACAGAACCTTTGC3', which amplify a 427-bp fragment from PDGF A chain mRNA. The primers for actin were obtained from Clontech (South San Francisco, CA, USA). The PCR products along with the 100-bp molecular weight markers were separated on a 4% polyacrylamide gel with TAE buffer and visualized by staining with ethidium bromide.
2.6 Statistical analysis
All data are presented as mean±S.E.M. All comparisons were made using ANOVA, with posthoc testing by the Student–Neumann–Keul's test. Differences with P<0.05 were considered significant.
| 3 Results |
|---|
|
|
|---|
3.1 Estrogen-induced inhibition of DNA synthesis
For assessment of DNA synthesis, experiments were conducted for 48 h, with [3H]-thymidine incorporation during the final 6 h. E2 had no effect on DNA synthesis in unstrained cells. Strain induced a 1.7-fold increase in DNA synthesis, which was significantly attenuated by E2 (1 nmol/l) (30% decrease, P<0.05), but not by the vehicle DMSO (Fig. 1). The extent of inhibition of DNA synthesis was significantly reduced by the ER antagonist ICI 182,780 (Fig. 2), suggesting that estrogen-induced inhibition of DNA synthesis is an ER-mediated process.
|
|
3.2 Effect of PDGF antibodies on strain-induced human VSM proliferation
To determine the contribution of PDGF to strain-induced proliferation in human VSM cells, cells were subjected to cyclic mechanical strain in the presence and absence of neutralizing antibodies to PDGF-AA and PDGF-BB. Antibodies to PDGF-AA and PDGF-BB did not influence DNA synthesis in control cells. However, both antibodies significantly attenuated strain-induced proliferation (61.8% decrease, P<0.05. Fig. 3), confirming that strain-induced proliferation in these cells is mediated via PDGF production, as shown in previous studies in a neonatal rat cell line [12].
|
3.3 Effect of E2 on mechanical strain-induced increase in Sp-1
Sp-1 is a transcription factor that binds to the promoter of the PDGF gene. We examined the effect of E2 on expression of Sp-1 in human VSM cells. E2 had no effects on Sp-1 gene expression and protein level in unstrained cells. In cells subjected to cyclic mechanical strain, Sp-1 mRNA increased significantly at 4, 8 and 24 h in response to the strain, and in contrast, in cells grown in the presence of E2 (1 nmol/l), the increase in Sp-1 mRNA was significantly attenuated compared to without E2 (Fig. 4). Sp-1 protein increased 2.0±0.3 fold at 24 h and 2.2±0.5 fold at 48 h after strain, while in cells grown in the presence of estrogen, strain-induced Sp-1 protein increase was prevented (Fig. 5). The E2 effect on Sp-1 protein was completely abolished by pretreatment with the ER antagonist ICI 182,780 (100 nmol/l), indicating an ER-mediated effect (Fig. 6).
|
|
|
3.4 Estrogen receptor subtypes by RT-PCR analysis
Both ER-
and ER-β mRNA were detected in these VSM cells by RT-PCR. ER-
expression appeared to be upregulated nearly 2-fold by E2 treatment after 24 h (Fig. 7). Relatively high levels of ER-β mRNA were detected in the VSM cells (compared to the positive control of Ishikawa cells).
|
3.5 PDGF gene expression by RT-PCR
Mechanical strain induced an increase in PDGF-A mRNA, detected by RT-PCR analysis. Treatment with E2 (1 nmol/l) attenuated this strain-induced increase in PDGF-A expression at 8 and 24 h; the effect was more pronounced at 8 h, at which time PDGF-A expression was 35% of that observed in strained cells without E2 (Fig. 8). However, E2 did not affect PDGF-A chain expression in unstrained cells, or PDGF-B chain expression in either unstrained or strained cells (data not shown).
|
| 4 Discussion |
|---|
|
|
|---|
The present study shows that physiological concentrations of estrogen inhibit strain-induced proliferation in human VSM cells, in company with down-regulation of the transcription factor Sp-1. These cells express both ER-
and ER-β, and the inhibitory effect of E2 on mechanical strain appears to be mediated via one or both of the estrogen receptors, as incubation with ICI 182,780 attenuates this effect. Previous studies have shown anti-proliferative effects of estrogen in rabbit [18], rat [19], and porcine [20] VSM cells exposed to growth factors. In human umbilical VSM cells, E2 had a biphasic effect on DNA synthesis: low concentrations (0.3 nmol/l) stimulated, and higher concentrations (30 nmol/l) inhibited [3H]-thymidine incorporation [21]. In human female aortic smooth muscle cells, E2 (1 nmol/l) inhibited increases in DNA synthesis induced by a variety of mitogens [22]; a similar inhibitory effect was observed in smooth muscle cells from saphenous veins from both men and women in response to concentrations of estradiol from 10 nmol/l to 1 µmol/l [23]. The present study extends these observations, providing evidence for E2-induced inhibition of proliferation in VSM cells subjected to mechanical strain.
We have confirmed in this study that human VSM cells also synthesize PDGF in response to mechanical strain since antibodies to both PDGF-AA and PDGF-BB significantly attenuated the proliferative response to strain. PDGF has previously been implicated in the development of atherosclerosis as a migratory and mitogenic stimulus to VSM cells. By quantitative RT-PCR, cells in atherosclerotic lesions have been shown to express mRNA for both PDGF A and B chains, and PDGF A appears to be upregulated during proliferation [24]. Enhanced migratory activity has been shown in VSM cells with high expression of both PDGF-A and PDGF-B, with significant correlations between PDGF mRNA levels and the degree of directional changes of VSM cells during migration, examined in vitro [25]. Of interest, in addition to cyclic mechanical strain [12], shear stress has also been shown to promote release of PDGF from VSM cells in culture [26], suggesting that its production can be regulated by various forms of mechanical stimuli. Estrogens reportedly have anti-atherosclerotic effects [27], and attenuate myointimal proliferation in an animal model of balloon injury [6], and have been shown to modulate expression of both PDGF ligand and receptor proteins in reproductive tissues, where PDGF is a possible mediator of estrogen-induced cell proliferation, migration and differentiation [28]. A regulatory effect of estrogens on PDGF synthesized locally in the vascular wall might contribute to its anti-proliferative effects in vivo.
Sp-1 is a zinc-finger transcription factor that interacts with the PDGF-A gene promoter [29] and the PDGF-B gene promoter [30,31]. Sp-1 binds to consensus elements in the proximal PDGF-A gene promoter as well as to the 5'-CCACCC-3' motif in the proximal PDGF-B gene promoter. The ability of Sp-1 to bind is critical for basal expression driven by the PDGF-A and PDGF-B gene promoters in cultured cells. It has recently been shown that GC-rich regions in the proximal 92 bp of the PDGF-A gene promoter contain mechanical strain-responsive elements that possibly bind Sp-1 [14]. The present study shows that in human VSM cells subjected to cyclic mechanical strain, both Sp-1 gene expression and protein levels increase, and that this increase in Sp-1 is significantly attenuated by estradiol. The relatively long delay between the increase in Sp-1 gene expression (observed at 4 h) and protein level (24 h) may be explained by the nuclear localization of this transcription factor. It is possible that estrogen-induced inhibition of Sp-1 mediates the down-regulation of PDGF, resulting in decreased cell proliferation. This interpretation is supported by our finding of estradiol-induced attenuation of PDGF-A mRNA expression in cells subjected to mechanical strain.
The inhibition of strain-induced proliferation by E2 was not observed in the presence of the estrogen receptor antagonist ICI 182,780, suggesting that the anti-proliferative effect is mediated via one or both of the ER. This is further supported by our observation that strain-induced increase in Sp-1 protein is attenuated by E2, but not in the presence of ICI 182,780. While many of the effects of estrogen are mediated via the classical ER (ER-
), it has been suggested that the recently discovered ER-β might also play a role in some of its vascular effects [32]. In the ERKO mice, in which the ER-
gene is disrupted, the anti-proliferative effect of E2 is still observed, raising the possibility that the ER-β might mediate this effect [10]. RT-PCR analysis showed that the cells we examined in the present study express both ER-
and ER-β. However, the relative contribution of these receptors to the anti-proliferative effect of estrogen remains to be determined.
In summary, we have demonstrated that estrogen inhibits mechanical strain-induced increase in DNA synthesis in human vascular smooth muscle cells by a mechanism that involves inhibition of increases in Sp-1, possibly resulting in a down-regulation of PDGF-A. Such an effect may underlie the inhibitory effect of estrogens on the progression of atherosclerosis, and the beneficial effects on restenosis observed in experimental [6] and observational clinical studies [4]. Further studies exploring the interaction between estrogens and other transcription factors and downstream growth factors in VSM cells are required to fully elaborate their anti-proliferative properties.
Time for primary review 26 days.
| Acknowledgments |
|---|
|
|
|---|
This work was supported in part by the Foundation for Cardiac Research, University of California, San Francisco. K.S. is funded as a Senior Research Fellow of the National Health and Medical Research Council (NH&MRC) of Australia. S.L. is funded through a block grant from the NH&MRC to the Baker Institute.
| References |
|---|
|
|
|---|
- Barrett-Connor E., Bush T.L. Estrogen and coronary heart disease in women. J. Am. Med. Assoc. (1991) 265:1861–1867.
[Abstract/Free Full Text] - Karas R.H., Patterson B.L., Mendelsohn M.E. Human vascular smooth muscle cells contain functional estrogen receptor. Circulation (1994) 89:1943–1950.
[Abstract/Free Full Text] - Kim-Schulze S., McGowan K.A., Hubchak S.C., et al. Expression of an estrogen receptor by human coronary artery and umbilical vein endothelial cells. Circulation (1996) 94:1402–1407.
[Abstract/Free Full Text] - O'Brien J.E., Peterson E.D., Keeler G.P., et al. Relation between estrogen replacement therapy and restenosis after percutaneous coronary interventions. J. Am. Coll. Cardiol. (1996) 28:1111–1118.[Abstract]
- O'Keefe J.H., Kim S.C. Jr, Hall R.R., et al. Estrogen replacement therapy after coronary angioplasty in women. J. Am. Coll. Cardiol. (1997) 29:1–5.[Abstract]
- Chen S.J., Li H., Durand J., et al. Estrogen reduces myointimal proliferation after balloon injury of rat carotic artery. Circulation (1996) 93:577–584.
[Abstract/Free Full Text] - Vargas R., Wroblewska B., Rego A., et al. Oestradiol inhibits smooth muscle cell proliferation of pig coronary artery. Br. J. Pharmacol. (1993) 109:612–617.[Web of Science][Medline]
- Morey A.K., Pedram A., Razandi M., et al. Estrogen and progesterone inhibit vascular smooth muscle proliferation. Endocrinology (1997) 138:3330–3339.
[Abstract/Free Full Text] - Sullivan T.R. Jr, Karas R.H., Aronovitz M., et al. Estrogen inhibits the response-to-injury in a mouse carotid artery model. J. Clin. Invest. (1995) 96:2482–2488.[Web of Science][Medline]
- Iafrati M.D., Karas R.H., Aronovitz M., et al. Estrogen inhibits the vascular injury response in estrogen receptor
-deficient mice. Nat. Med. (1997) 3:545–548.[CrossRef][Web of Science][Medline] - Brandernberger A.W., Tee M.K., Lee J.Y., et al. Tissue distribution of estrogen receptors alpha and beta mRNA in the midgestational human fetus. J. Clin. Endocrinol. Metab. (1997) 82:3509–3512.
[Abstract/Free Full Text] - Wilson E., Mai Q., Sudhir K., et al. Mechanical strain induces growth of vascular smooth muscle cells via autocrine action of PDGF. J. Cell Biol. (1993) 123:741–747.
[Abstract/Free Full Text] - Sudhir K., Wilson E., Chatterjee K., et al. Mechanical strain and collagen potentiate mitogenic activity of angiotensin II in rat vascular smooth muscle cells. J. Clin. Invest. (1993) 92:3003–3007.[Web of Science][Medline]
- Wilson E., Vives F., Collins T., et al. Strain-responsive regions in the platelet-derived growth factor-A gene promoter. Hypertension (1998) 31(part 2):170–175.
[Abstract/Free Full Text] - Stone G.W., Hodgson J.M., St Goar F.G., et al. Improved procedural results of coronary angioplasty with intravascular ultrasound-guided balloon sizing: the CLOUT Pilot Trial. Clinical Outcomes with Ultrasound Trial (CLOUT) Investigators. Circulation (1997) 95:2044–2052.
[Abstract/Free Full Text] - Safar M.E., Peronneau P.A., Toto-Moukouo J.A., et al. Pulsed doppler: diameter, blood flow velocity, and volumic flow of the brachial artery in sustained essential hypertension. Circulation (1981) 63:393–400.
[Free Full Text] - Conroy S.C., Hart C.E., Perez-Reyes N., et al. Characterization of human aortic smooth muscle cells expressing HPV16 E6 and E7 open reading frames. Am. J. Pathol. (1995) 147:753–762.[Abstract]
- Lou H., Zhao Y., Delafontaine P., et al. Estrogen effects on insulin-like growth factor-I (IGF-I)-induced cell proliferation and IGF-I expression in native and allograft vessels. Circulation (1997) 96:927–933.
[Abstract/Free Full Text] - Espinosa E., Oemar B.S., Luscher T.F. 17β-Estradiol and smooth muscle cell proliferation in aortic cells of male and female rats. Biochem. Biophys. Res. Commun. (1996) 221:8–14.[CrossRef][Web of Science][Medline]
- Moraghan T., Antoniucci D.M., Grenert J.P., et al. Differential response in cell proliferation to β estradiol in coronary arterial vascular smooth muscle cells obtained from mature female versus male animals. Endocrinology (1996) 137:5174–5177.[Abstract]
- Somjen D., Kohen F., Jaffe A., et al. Effects of gonadal steroids and their antagonists on DNA synthesis in human vascular cells. Hypertension (1998) 32:39–45.
[Abstract/Free Full Text] - Suzuki A., Mizuno K., Ino Y., et al. Effects of 17 β-estradiol and progesterone on growth-factor-induced proliferation and migration in human female aortic smooth muscle cells in vitro. Cardiovasc. Res. (1996) 32:516–523.
[Abstract/Free Full Text] - Dai-Do D., Espinosa E., Liu G., et al. 17β-Estradiol inhibits proliferation and migration of human vascular smooth muscle cells: similar effects in cells from postmenopausal females and in males. Cardiovasc. Res. (1996) 32:980–985.
[Abstract/Free Full Text] - Krettek A., Fager G., Lindmark H., et al. Effect of phenotype on the transcription of the genes for platelet-derived growth factor (PDGF) isoforms in human smooth muscle cells, monocyte-derived macrophages, and endothelial cells in vitro. Arterioscler. Thromb. Vasc. Biol. (1997) 17:2897–2903.
[Abstract/Free Full Text] - Koster R., Windstetter U., Uberfuhr P., et al. Enhanced migratory activity of vascular smooth muscle cells with high expression of platelet-derived growth factor A and B. Angiology (1995) 46:99–106.[Web of Science][Medline]
- Sterpetti A.V., Cucina A., Fragale A., et al. Shear stress influences the release of platelet-derived growth factor and basic fibroblast growth factor by arterial smooth muscle cells. Winner of the ESVS prize for best experimental paper 1993. Eur. J. Vasc. Surg. (1994) 8:138–142.[CrossRef][Web of Science][Medline]
- Adams M.R., Williams J.K., Clarkson T.B., et al. Effects of oestrogens and progestogens on coronary atherosclerosis and osteoporosis of monkeys. Baillieres Clin. Obstet. Gynaecol. (1991) 5:915–934.[CrossRef][Web of Science][Medline]
- Gray K., Eitzman B., Raszmann K., et al. Coordinate regulation by diethylstilbestrol of the platelet-derived growth factor-A (PDGF-A) and -B chains and the PDGF receptor alpha- and β-subunits in the mouse uterus and vagina: potential mediators of estrogen action. Endocrinology (1995) 136:2325–2340.[Abstract]
- Khachigian L.M., Williams A.J., Collins T. Interplay of Sp-1 and Egr-1 in the proximal PDGF-A promoter in cultured vascular endothelial cells. J. Biol. Chem. (1995) 270:27679–27686.
[Abstract/Free Full Text] - Khachigian L.M., Fries J.W.U., Benz M.W., et al. Novel cis-acting elements in the human platelet-derived growth factor B-chain core promoter that mediate gene expression in cultured vascular endothelial cells. J. Biol. Chem. (1994) 269:22647–22656.
[Abstract/Free Full Text] - Scarpati E.M., DiCorleto P.E. Identification of a thrombin response element in the human platelet-derived growth factor B-chain (c-sis) promoter. J. Biol. Chem. (1996) 271:3025–3032.
[Abstract/Free Full Text] - Gustafsson J.A. Estrogen receptor β — getting in on the action? Nat. Med. (1997) 3:493–494.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
J. P. Stegemann, H. Hong, and R. M. Nerem Mechanical, biochemical, and extracellular matrix effects on vascular smooth muscle cell phenotype J Appl Physiol, June 1, 2005; 98(6): 2321 - 2327. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ling, A. Dai, R. J. Dilley, M. Jones, E. Simpson, P. A. Komesaroff, and K. Sudhir Endogenous Estrogen Deficiency Reduces Proliferation and Enhances Apoptosis-Related Death in Vascular Smooth Muscle Cells: Insights From the Aromatase-Knockout Mouse Circulation, February 3, 2004; 109(4): 537 - 543. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ling, P. J. Little, M. R. I. Williams, A. Dai, K. Hashimura, J.-P. Liu, P. A. Komesaroff, and K. Sudhir High glucose abolishes the antiproliferative effect of 17beta -estradiol in human vascular smooth muscle cells Am J Physiol Endocrinol Metab, April 1, 2002; 282(4): E746 - E751. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










