Skip Navigation

Cardiovascular Research 2001 49(1):200-206; doi:10.1016/S0008-6363(00)00221-2
© 2001 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Markewitz, B. A
Right arrow Articles by Michael, J. R
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Markewitz, B. A
Right arrow Articles by Michael, J. R
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2000, European Society of Cardiology

Regulation of endothelin-1 synthesis in human pulmonary arterial smooth muscle cells

effects of transforming growth factor-β and hypoxia

Boaz A Markewitz, Imad S Farrukh, Yuexian Chen, Yaohui Li1 and John R Michael*

Division of Respiratory, Critical Care and Occupational Pulmonary Medicine, Medical Service, Department of Veterans Affairs Medical Center and Department of Medicine, University of Utah School of Medicine, Salt Lake City, UT 84132, USA

* Corresponding author. University of Utah Health Sciences Center, Division of Respiratory, Critical Care and Occupational Pulmonary Medicine, 50 N. Medical Drive, Salt Lake City, UT 84132, USA. Tel.: +1-801-581-7806; fax: +1-801-585-3355

Received 11 May 2000; accepted 15 August 2000


    Abstract
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
Objective: Endothelin-1 (ET-1) potently regulates pulmonary vascular tone and promotes vascular smooth muscle cell growth. Clinical and animal studies implicate increased ET-1 production in the pathogenesis of primary and secondary pulmonary hypertension. Although pulmonary arterial smooth muscle cells (PASMCs) synthesize ET-1 under basal conditions, it is unknown whether factors that may be important in pulmonary hypertension, such as transforming growth factor-β (TGF-β) or hypoxia, augment ET-1 production by these cells. Methods: We determined the effect of TGF-β and hypoxia on ET-1 release and preproET-1 mRNA from cultured rat and human PASMCs. Results: In the basal state, rat and human PASMCs synthesize, on average (mean±S.E.M.), 872±114 and 563±57 pg ET-1/mg cell protein over 24 h, respectively, a level that causes autocrine and paracrine effects in other tissues. TGF-β significantly increases the expression of preproET-1 mRNA and ET-1 production by both rat and human PASMCs. Hypoxia for 24 h, however, does not affect ET-1 release from rat or human PASMCs. Conclusions: Cultured rat and human PASMCs are a source of ET-1 production. Enhanced ET-1 release from PASMCs may contribute to the pathophysiology of TGF-β-induced pulmonary hypertension. ET-1 production by PASMCs is unlikely to contribute to the role of ET-1 in hypoxia-induced pulmonary vasoconstriction.

KEYWORDS Endothelins; Growth factors; Hypoxia/anoxia; Pulmonary circulation; Smooth muscle


    1 Introduction
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
Endothelin-1 (ET-1) is a multifunctional regulatory peptide that produces important autocrine effects in multiple cell types. It can influence intracellular Ca2+ concentration, arachidonic acid metabolism, and ion-channel activity and, through these effects, potently regulate pulmonary vascular tone. ET-1 acting through either ETA or ETB receptors can contract human pulmonary arteries, causing potent and long-lasting vasoconstriction [1]. Besides its well-known effects on vessel tone, ET-1 also produces long-term adaptations, such as mitogenesis and hypertrophy, probably by increasing expression of immediate-early response genes. ET-1, for example, can stimulate the growth of pulmonary arterial fibroblasts [2] and pulmonary artery smooth muscle [3,4].

Increased ET-1 levels have been found in and hypothesized to contribute to several pulmonary hypertensive disorders in humans, including primary pulmonary hypertension, chronic hypoxic lung disease, collagen vascular disease, pulmonary thromboembolism and congestive heart failure [5–8]. Since pulmonary arterial smooth muscle cells (PASMCs) can synthesize ET-1 [4,9,10], these cells may serve as a source for increased ET-1 generation in pathophysiologic conditions. Consequently, we evaluated the ability of transforming growth factor-β (TGF-β) and hypoxia, two factors that may contribute to pulmonary hypertension, to regulate ET-1 synthesis in cultured rat and human PASMCs.

TGF-β is a family of three isoforms that regulate cell growth and differentiation, extracellular matrix synthesis, cytokine production, and vascular neogenesis [11]. TGF-β has been implicated in the vascular remodeling associated with primary pulmonary hypertension [12] and persistent pulmonary hypertension in patients with congenital diaphragmatic hernia [13]. Hypoxia causes acute and chronic changes in pulmonary artery pressure through vasoconstriction and remodeling. Both factors have been shown to regulate ET-1 production in various models [14]. We sought to determine if TGF-β and acute hypoxia could regulate ET-1 synthesis by PASMCs.


    2 Methods
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
2.1 Reagents
We purchased M199 medium (M199), TGF-β, Moloney murine leukemia virus reverse transcriptase, 5x-first strand buffer, dithiothreitol and Taq DNA polymerase from GIBCO Laboratories Life Technologies (Grand Island, NY, USA); fetal bovine serum (FBS) and bovine calf serum (BCS) from HyClone Laboratories (Logan, UT, USA); custom ATV solution from Irvine Scientific (Santa Ana, CA, USA); chloroform from Mallinckrodt Specialty Chemicals (Paris, KY, USA); dNTP set solution from Pharmacia LKB Biotechnology (Alameda, CA, USA); formamide and random primer hexanucleotides pd(N)6 from Boehringer Mannheim (Indianapolis, IN, USA); RNasin ribonuclease inhibitor from Promega (Madison, WI, USA); bicinchoninic acid (BCA) protein assay reagent from Pierce Chemical (Rockford, IL, USA); tissue culture plates from Costar (Cambridge, MA, USA); 2-mercaptoethanol from Bio-Rad Laboratories (Richmond, CA, USA); phenol from Amresco (Solon, OH, USA); ethyl alcohol from Quantum Chemical Corporation (Tuscola, IL, USA); ET-1 radioimmunoassay (RIA) kits from Peninsula Laboratories (Belmont, CA, USA); and SmGM culture media from Clonetics (San Diego, CA, USA). All other reagents, unless stated otherwise, were purchased from Sigma (St. Louis, MO, USA).

2.2 Rat PASMCs
Dr. A. Rothman, at the University of California at San Diego, generously provided the rat PASMCs. These cells are a cloned cell line, from proximal pulmonary arteries, derived by growth selection. These cells stain uniformly with anti-smooth muscle myosin and {alpha}-actin antibodies. They contain mRNA for smooth muscle contractile proteins (i.e., smooth muscle {alpha}-actin, myosin heavy chain, myosin regulatory light chain, and {alpha}-tropomyosin) and functional receptors for angiotensin II, norepinephrine and {alpha}-thrombin [15,16]. Rat PASMCs were suspended in growth medium (M199 containing 23 mM sodium bicarbonate, 10% FBS, 2 mM L-glutamine, penicillin, 100 U/ml and streptomycin, 0.1 mg/ml), plated into 24-well plates and grown at 37°C in a 5% CO2 environment. All studies were performed when the plates were nearly confluent.

2.3 Human PASMCs
Human PASMCs were cultured from main pulmonary artery explants from donors (arteries were obtained from the University of Utah Transplant Program), as previously described [17]. Briefly, the arteries were separated from their adventitia and endothelium and then minced into 1- to 3-mm2 pieces with sterile scalpel blades. The tissues were mounted in tissue culture wells with 0.05 ml of chicken plasma plus 0.05 ml of chick embryo extract. The tissue and eventually the human PASMCs were then plated with SmGM culture medium that was supplemented with 5% FBS, 10% BCS plus dexamethasone (0.39 µg/ml) and antimicrobial agents (gentamicin, 50 µg/ml, amphotericin, B 25 µg/ml, penicillin, 120 U/ml and streptomycin, 0.12 mg/ml). Experiments were performed in primary cultured cells or in second passage cells. Transmission electron micrographs indicate that the cultured cells have the characteristics of vascular smooth muscle cells, including contractile filaments, dense bodies and longitudinal cigar-shaped mitochondria [17].

2.4 Experimental protocol
Human or rat PASMCs grown in 24-well plates were incubated for 24 h at 37°C in 500 µl of growth medium, either alone or in growth medium containing TGF-β (1–10 ng/well). Studies designed to evaluate the effect of oxygen tension on ET-1 production were performed in growth media, as previously described [18]. Six- or twenty-four-well plates were placed in humidified, airtight, modular incubator chambers (Billups-Rothburg, Del Mar, CA, USA) and exposed to normoxic (5% CO2, balance air) or hypoxic (0 or 3% O2 with 5% CO2 and balance N2) environments. The chambers were infused with preanalyzed gas mixtures for 15 min at 2 p.s.i. (1 p.s.i.=6874.76 Pa), the chamber was closed and then incubated at 37°C for 24 h. At the end of the exposure, media gas measurements were made (Radiometer ABL 500, Copenhagen, Denmark).

2.5 ET-1 production
After incubation, the supernatants were removed and ET-1 was measured using a radioimmunoassay as previously described [18,19]. The lower limit of sensitivity for ET-1 detection was 2 pg. Intra-assay variation was less than 9%, and interassay variation was less than 15%. After extraction in 1 ml 0.1 N NaOH, the total cellular protein level in each well was measured from an aliquot of the solubilized cells using the BCA protein assay reagents [20]. ET-1 measurements were expressed as pg ET-1/mg total cell protein.

2.6 RNA isolation
As previously described [19], the supernatant was removed and the cells were overlaid with 4 M guanidinium isothiocyanate, 1% 2-mercaptoethanol, and 1% sarcosyl (pH 7.0). The cells were homogenized by several passages through a 25-gauge needle and one-tenth volume of 2 M sodium acetate was added. The RNA was phenol/chloroform extracted, precipitated in isopropanol, washed in 70% ethanol, and suspended in Tris–HCl–EDTA. Each sample was quantified spectrophotometrically.

2.7 Reverse transcription-polymerase chain reaction amplification of RNA
Reverse transcription polymerase chain reaction (RT-PCR) amplification of RNA was performed as previously described by this laboratory [19]. A 5-µg amount of total RNA from each sample was reverse transcribed by incubating it with 250 pmol of random primer hexanucleotides, 400 U of Moloney murine leukemia virus reverse transcriptase, 80 U of RNasin, 2 mM deoxynucleotide triphosphates, 0.5 mM dithiothreitol, 75 mM KCl, 3 mM MgCl2 and 50 mM Tris–HCl (pH 8.3; final volume, 50 µl) for 1 h at 37°C.

The cDNA was amplified by PCR. The upstream and downstream primers for ET-1 were GCCAAGCAGACAAAGAACTCCGAG and GCTCTGTAGTCAATGTGCTCGGTT, respectively. These give a 247-base-pair fragment that is complementary to position 371–618 in rat ET-1 cDNA [21]. PCR of rat genomic DNA yields a single 1300-base-pair product, indicating that these primers span an intron. The upstream and downstream primers for β-actin were TGGAGAAGAGCTATGAGCTGCCTG and GTGCCACCAGACAGCACTGTGTTG, respectively, which yield a single band corresponding to a 201-bp cDNA fragment. PCR of rat genomic DNA with the β-actin primers yields a 289-bp product that is complementary to positions 2499–2788 in the β-actin gene, confirming that this primer set spans an intron.

PCR was performed by incubating 5 µl of sample cDNA with 50 mM KCl, 10 mM Tris–HCl, 1.5 mM MgCl2, 0.01% gelatin, 800 µM total dNTP, 2 U of Taq DNA polymerase, 2.5% formamide, and 100 pmol of ET-1 primers, in a final volume of 50 µl (final pH, 8.3 at room temperature). PCR using ET-1 primers was carried out for 30 cycles (15 s at 94°C, 15 s at 65°C, 30 s at 72°C) following 1 min of early DNA denaturation at 94°C using a Perkin-Elmer Cetus 9600 GeneAMP PCR system. Different primers were never combined in the same tube. The amplified cDNA products were electrophoresed in a 1% SeaKem ME agarose, 2.5% NuSieve GTG agarose gel containing ethidium bromide. ET-1 and β-actin product sequences have been previously verified by using fluoresceinated primer ends and cycle sequencing [21].

2.8 Northern analysis of human preproET-1 mRNA
Total RNA (10–20 µg/lane) was electrophoresed on a 1.3% agarose gel containing 0.24% formaldehyde and a trace amount of ethidium bromide, and transferred to nylon filters (Hybond-N, Amersham Life Science, Cleveland, OH, USA). The filters were prehybridized in buffer containing 50% formamide, 5x SSPE (1x SSPE=0.15 M NaCl, 0.01 M NaH2PO4.H2O and 0.001 M EDTA), 5x Denhardt's solution and herring sperm DNA (100 µg/ml) and hybridized at 42°C in fresh buffer containing human ET-1 cDNA labeled by a random primer DNA labeling system (Gibco BRL) using ({alpha}-32P)deoxy-CTP (NEN Corp.). Human ET-1 cDNA (1.2 kb) was generously provided by Dr. Gary Visner (University of Florida, Gainesville, FL, USA) [22]. Filters were washed at 42°C in 0.1xSSC and 0.1% SDS. To correct for RNA loading, filters were rehybridized with human β-actin cDNA labeled as described above. Human β-actin cDNA was prepared by PCR of specific primers for human β-actin [23].

2.9 Statistical analysis
Data were analyzed by the unpaired Student's t-test. Statistical significance was taken as P<0.05. Values are presented as mean±S.E.M.


    3 Results
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
3.1 Rat pulmonary arterial smooth muscle cells
Rat PASMCs release ET-1 into the medium under basal conditions (Fig. 1A). Although synthesis varied among individual experiments, in the basal state, these cells produced, over a 24-h period, 872±114 pg ET-1/mg total cell protein (n = 26). PCR amplification of reverse-transcribed RNA using preproET-1 primers yields a 247-base-pair product, whose sequence corresponds to that expected for ET-1, confirming that these cells synthesize ET-1. TGF-β (1–10 ng/well for 24 h) dose-dependently augments ET-1 release (Fig. 1A).


Figure 1
View larger version (14K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Transforming growth factor-β (TGF-β) increases endothelin-1 (ET-1) production by rat pulmonary artery smooth muscle cells (PASMCs) (A) and human PASMCs (B). Supernatant ET-1 was measured after 24 h of incubation with or without TGF-β (1–10 ng/well). n≥7 in each group for rat PASMCs and n = 8 in each group for human PASMCs. Values are expressed as the mean±S.E.M. % control. {dagger}P<0.005 vs. control; *P<0.001 vs. control.

 
To investigate if oxygen tension regulates ET-1 release, we initially tested the effect of 3 and 0% O2 on media pH. Exposing rat PASMCs to anoxia for 24 h significantly reduced media pH compared to 21 or 3% O2. Consequently, subsequent experiments were performed with 3% O2. As shown in Fig. 2A, hypoxia for 24 h does not affect basal ET-1 release. There was no difference in media pH between the two groups (7.31±0.02 normoxia vs. 7.29±0.02 for 3% O2, NS). Media PO2 was 130±4 mmHg during normoxia and 42±1 mmHg after exposure to 3% O2 (P<0.001).


Figure 2
View larger version (14K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Hypoxia for 24 h does not affect endothelin-1 (ET-1) production by rat pulmonary artery smooth muscle cells (PASMCs) (A) or human PASMCs (B). Supernatant ET-1 was measured after 24 h of normoxia (21% O2) or hypoxia. Rat PASMCs were exposed to 3% O2 and human PASMCs to 0% O2. n≥19 in rat PASMCs and n = 8 in human PASMCs. Values are expressed as the mean±S.E.M. % control.

 
3.2 Human pulmonary arterial smooth muscle cells
When all baseline experiments are combined, human PASMCs generate, over 24 h, an average of 563±57 pg ET-1 per mg total cell protein (n = 16). In human PASMCs, northern analysis demonstrates preproET-1 mRNA of the expected size (~2.3 kb). TGF-β (10 ng/well) significantly increases ET-1 release (Fig. 1B) and preproET-1 mRNA normalized to β-actin concentration (Figs. 3A and 4Go). Exposure to 0% O2 for 24 h does not alter basal preproET-1 levels or ET-1 production (Figs. 2B, 3BGo and Fig. 4). Media pH was similar in the two groups (7.32±0.02 normoxia and 7.31±0.02 with 0% O2). Media PO2 was 132±4 mmHg during normoxia and 23±3 after exposure to 0% O2 (P<0.001).


Figure 3
View larger version (35K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Representative Northern analysis of human preproendothelin-1 and β-actin mRNA in human pulmonary artery smooth muscles cells exposed to TGF-β (10 ng) for 24 h (A) or hypoxia (0% 02, 5% CO2, balance N2) for 24 h (B).

 

Figure 4
View larger version (14K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Effect of transforming growth factor-β (TGF-β) and hypoxia on preproendothelin-1 (preproET-1) mRNA levels in human pulmonary arterial smooth muscle cells. TGF-β increases preproET-1 mRNA, as assessed by Northern analysis normalized for β-actin mRNA concentration. Cells were exposed to TGF-β (10 ng) for 24 h or hypoxia (0% O2, 5% CO2, balance N2) for 24 h. Control (n = 4), TGF-β (n = 5) and hypoxia (n = 5). Values are expressed as the mean±S.E.M. *P<0.01 vs. control.

 

    4 Discussion
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
Compared to control subjects, patients with primary or secondary pulmonary hypertension have elevated plasma ET-1 levels and increased ET-1 expression in the endothelium of their pulmonary arteries [7,8,24]. Experimental evidence strongly implicates ET-1 in the pathogenesis of pulmonary hypertension arising in animals from monocrotaline or chronic hypoxia. In both models, circulating ET-1 levels increase, ETA receptor antagonists acutely reduce pulmonary arterial pressure, and chronic therapy with ETA receptor blockers markedly reduces the development of pulmonary hypertension, pulmonary vascular remodeling and right ventricular hypertrophy [25–31].

Previous reports indicate that PASMCs can synthesize ET-1 [4,9,10]. Our results confirm this observation and indicate that TGF-β, but not hypoxia, regulates ET-1 production in human PASMCs. In the basal state, these cells release 200 to 300 pM ET-1, a level similar to that reported from other cells [19].

TGF-β significantly increases the expression of preproET-1 mRNA and ET-1 release by PASMCs. We evaluated the effect of TGF-β because patients with primary pulmonary hypertension have a dramatic increase in cell-associated immunoreactivity for TGF-β isoforms in the media and neointima of hypertensive muscular arteries, implying a potential role for TGF-β in the vascular remodeling [12]. Additionally, its expression is increased in two animal models of pulmonary hypertension, chronic air embolism and monocrotaline infusion [32,33]. Chronic air embolism, for example, induces pulmonary hypertension in sheep, triples lung lymph TGF-β activity and markedly enhances immunoreactivity for TGF-β1 and TGF-β3 in intraacinar arteries with new muscle [32]. Monocrotaline infusion also augments whole lung expression of mRNA for the three isoforms of TGF-β, and the increase in TGF-β precedes the development of pulmonary hypertension [33]. Interestingly, both acute air embolism [34] and monocrotaline-induced pulmonary hypertension increase circulating ET-1 levels [28]. As indicated above, an ET receptor antagonist markedly reduces the pulmonary hypertension and pulmonary vascular remodeling that develop following monocrotaline infusion [28]. These observations suggest that ET-1 may mediate in part the pulmonary vascular actions of TGF-β.

Alveolar hypoxia for one or more hours raises plasma ET-1 levels in animals [25,30,35,36] and increases the content of ET-1 or preproET-1 mRNA in lung homogenate [25,35–37]. The cells responsible for increased ET-1 synthesis during hypoxia are unclear. Our results indicate that 24 h of hypoxia does not increase ET-1 production by cultured rat or human PASMCs, suggesting that these cells are unlikely to be a source for the increased ET-1. The inability of hypoxia to alter ET-1 synthesis by PASMCs contrasts with the significant decrease in ET-1 synthesis caused by hypoxia in cultured rat pulmonary artery endothelial cells [18]. These differing results emphasize that the regulatory effects of hypoxia on ET-1 synthesis may vary markedly depending on the cell type involved. This study focused on the short-term effect of hypoxia on ET-1 synthesis by PASMCs. Whether chronic hypoxia would lead to a different result is unknown.

Hypoxic pulmonary vasoconstriction occurs primarily at the precapillary level. Pulmonary vascular remodeling following chronic hypoxic exposure takes place predominantly in small pulmonary arteries and arterioles. Thus, smooth muscle cells from distinct regions of the pulmonary circulation may respond differently to stimuli. A study in sheep indicates that ET-1 gene expression is much greater in smooth muscle cells isolated from the main, compared with midregion, pulmonary artery [38]. Our study confirms physiologically significant ET-1 production by proximal PASMCs. Whether smooth muscle cells derived from more distal segments of the pulmonary artery would respond similarly or not to hypoxia and TGF-β is unknown.

ET-1 may produce important autocrine effects on PASMCs. ET-1 is a co-mitogen for PASMCs [3,4,39], stimulating DNA synthesis. Cultured PASMCs from fawn-hooded rats that develop idiopathic pulmonary hypertension, for example, produce increased amounts of ET-1 under basal conditions compared to cells from control animals [4]. Additionally, PASMCs from fawn-hooded rats have an increased rate of cell growth, and an ETA receptor antagonist prevents the increase in proliferation, strongly implying that ET-1 serves as an autocrine growth factor for PASMCs [4]. In PASMCs, ET-1 also modulates the activity of calcium-activated-chloride and potassium channels [40,41], activates protein kinase C and increases phospholipase D activity [42]. Thus, basal ET-1 synthesis by PASMCs likely acts as an autocrine factor that influences their growth and function.

In summary, cultured rat and human PASMCs synthesize and release ET-1, a powerful regulator of pulmonary vascular tone and potential mediator of pulmonary hypertension. TGF-β substantially increases the expression of preproET-1 mRNA and ET-1 production by human PASMCs, whereas short-term hypoxia does not affect ET-1 production by these cells.

Time for primary review 25 days.


    Acknowledgements
 
This material is based upon work supported by an Edward P. Stiles Trust Fund Grant provided through the Louisiana State University Medical Center at Shreveport (BAM), the Board of Regents of the State of Louisiana through the Louisiana Education Quality Support Fund (1966–99)-RD-A-20 (BAM), the office of Research and Development, Medical Research Service, Department of Veterans Affairs (JRM) and the University of Utah Specialized Center for Research in Acute Lung Injury NHLBI IP50-HL-50153 (JRM and ISF).


    Notes
 
1 Current address: Department of Surgery, Louisiana State University Medical Center, Shreveport, Louisiana, USA. Back


    References
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 

  1. McCulloch K.M., Docherty C.C., Morecroft I., MacLean M.R. Endothelin B receptor-mediated contraction in human pulmonary resistance arteries. Br J Pharmacol (1996) 119:1125–1130.[Web of Science][Medline]
  2. Peacock A.J., Dawes K.E., Shock A., et al. Endothelin-1 and endothelin-3 induce chemotaxis and replication of pulmonary artery fibroblasts. Am J Respir Cell Mol Biol (1992) 7:492–499.[Web of Science][Medline]
  3. Zamora M.R., Dempsey E.C., Walchak S.J., Stelzner T.J. BQ123, an ETA receptor antagonist, inhibits endothelin-1-mediated proliferation of human pulmonary artery smooth muscle cells. Am J Respir Cell Mol Biol (1993) 9:429–433.[Web of Science][Medline]
  4. Zamora M.R., Stelzner T.J., Webb S., et al. Overexpression of endothelin-1 and enhanced growth of pulmonary artery smooth muscle cells from fawn-hooded rats. Am J Physiol (1996) 270:L101–L109.[Web of Science][Medline]
  5. Cody R.J., Haas G.J., Binkley P.F., Capers Q., Kelley R. Plasma endothelin correlates with the extent of pulmonary hypertension in patients with chronic congestive heart failure. Circulation (1992) 85:504–509.[Abstract/Free Full Text]
  6. Vancheeswaran R., Magoulas T., Efrat G., et al. Circulating endothelin-1 levels in systemic sclerosis subsets—a marker of fibrosis or vascular dysfunction? J Rheumatol (1994) 21:1838–1844.[Web of Science][Medline]
  7. Stewart D.J., Levy R.D., Cernacek P., Langleben D. Increased plasma endothelin-1 in pulmonary hypertension: marker or mediator of disease? Ann Intern Med (1991) 114:464–469.[Abstract/Free Full Text]
  8. Sofia M., Faraone S., Alifano M., et al. Endothelin abnormalities in patients with pulmonary embolism. Chest (1997) 111:544–549.[CrossRef][Web of Science][Medline]
  9. Tchekneva E., Lawrence M.L., Meyrick B. Cell-specific differences in ET-1 system in adjacent layers of main pulmonary artery: a new source of ET-1. Am J Physiol (2000) 278:L813–L821.[Web of Science]
  10. Medina J., Wolf A. Strategies to antagonise the cyclosporine A-induced proliferation of human pulmonary artery smooth muscle cells: anti-endothelin-1 antibodies, verapamil, and octreotide. Biochem Pharmacol (2000) 59:1459–1466.[CrossRef][Web of Science][Medline]
  11. Blobe G.C., Schiemann W.P., Lodish H.F. Role of transforming growth factor β in human disease. N Engl J Med (2000) 342:1350–1358.[Free Full Text]
  12. Botney M.D., Bahadori L., Gold L.I. Vascular remodeling in primary pulmonary hypertension: potential role for transforming growth factor-beta. Am J Pathol (1994) 144:286–295.[Abstract]
  13. Yamataka T., Puri P. Active collagen synthesis by pulmonary arteries in pulmonary hypertension complicated by congenital diaphragmatic hernia. J Pediatr Surg (1997) 32:682–687.[CrossRef][Web of Science][Medline]
  14. Michael J.R., Markewitz B.A. Endothelins and the lung. Am J Respir Crit Care Med (1996) 154:555–581.[Web of Science][Medline]
  15. Rothman A., Kulik T.J., Taubman M.B., et al. Development and characterization of a cloned rat pulmonary arterial smooth muscle cell line that maintains differentiated properties through multiple subcultures. Circulation (1992) 86:1977–1986.[Abstract/Free Full Text]
  16. Rothman A., Wolner B., Button D., Taylor P. Immediate-early gene expression in response to hypertrophic and proliferative stimuli in pulmonary arterial smooth muscle cells. J Biol Chem (1994) 269:6399–6404.[Abstract/Free Full Text]
  17. Peng W., Karwande S.V., Hoidal J.R., Farrukh I.S. Potassium currents in cultured human pulmonary arterial smooth muscle cells. J Appl Physiol (1996) 80:1187–1196.[Abstract/Free Full Text]
  18. Markewitz B.A., Kohan D.E., Michael J.R. Hypoxia decreases endothelin-1 synthesis by rat lung endothelial cells. Am J Physiol (1995) 269:L215–L220.[Web of Science][Medline]
  19. Markewitz B.A., Kohan D.E., Michael J.R. Endothelin-1 synthesis, receptors and signal transduction in a cloned rat alveolar epithelial cell line: evidence for an autocrine role. Am J Physiol (1995) 268:L192–L200.[Web of Science][Medline]
  20. Goldschmidt R.C., Kimelberg H.K. Protein analysis of mammalian cells in monolayer culture using the bicinchoninic assay. Anal Biochem (1989) 177:41–45.[CrossRef][Web of Science][Medline]
  21. Sakurai T., Yanagisawa M., Inoue A., et al. cDNA cloning, sequence analysis and tissue distribution of rat preproendothelin-1 mRNA. Biochem Biophys Res Commun (1991) 175:44–47.[CrossRef][Web of Science][Medline]
  22. Visner G.A., Staples E.D., Chesrown S.E., et al. Isolation and maintenance of human pulmonary artery endothelial cells in culture isolated from transplant donors. Am J Physiol (1994) 267:L406–L413.[Web of Science][Medline]
  23. Ponte P., Sun-Yu N., Engel J., Gunning P., Kedes L. Evolutionary conservation in the untranslated regions of actin mRNAs: DNA sequence of a human beta-actin cDNA. Nucleic Acids Res (1984) 12:1687–1696.[Abstract/Free Full Text]
  24. Giaid A., Yanagisawa M., Langleben D., et al. Expression of endothelin-1 in the lungs of patients with pulmonary hypertension. N Engl J Med (1993) 328:1732–1739.[Abstract/Free Full Text]
  25. Oparil S., Chen S.J., Meng Q.C., et al. Endothelin-A receptor antagonist prevents acute hypoxia-induced pulmonary hypertension in the rat. Am J Physiol (1995) 268:L95–L100.[Web of Science][Medline]
  26. Okada M., Yamashita C., Okada M., Okada K. Role of endothelin-1 in beagles with dehydromonocrotaline-induced pulmonary hypertension. Circulation (1995) 92:114–119.[Abstract/Free Full Text]
  27. Okada M., Yamashita C., Okada M., Okada K. Endothelin receptor antagonists in a beagle model of pulmonary hypertension: contribution to possible potential therapy? J Am Coll Cardiol (1995) 25:1213–1217.[Abstract]
  28. Miyauchi T., Yorikane R., Sakai S., et al. Contribution of endogenous endothelin-1 to the progression of cardiopulmonary alterations in rats with monocrotaline-induced pulmonary hypertension. Circ Res (1993) 73:887–897.[Abstract/Free Full Text]
  29. Bonvallet S.T., Zamora M.R., Hasunuma K., et al. BQ123, an ETA-receptor antagonist, attenuates hypoxic pulmonary hypertension in rats. Am J Physiol (1994) 266:H1327–H1331.[Web of Science][Medline]
  30. DiCarlo V.S., Chen S.-J., Meng Q.C., et al. ETA-receptor antagonist prevents and reverses chronic hypoxia-induced pulmonary hypertension in rat. Am J Physiol (1995) 269:L690–L697.[Web of Science][Medline]
  31. Eddahibi S., Raffestin B., Clozel M., Levame M., Adnot S. Protection from pulmonary hypertension with an orally active endothelin receptor antagonist in hypoxic rats. Am J Physiol (1995) 268:H828–H835.[Web of Science][Medline]
  32. Perkett E.A., Pelton R.W., Meyrick B., Gold L.I., Miller D.A. Expression of transforming growth factor-beta mRNAs and proteins in pulmonary vascular remodeling in the sheep air embolization model of pulmonary hypertension. Am J Respir Cell Mol Biol (1994) 11:16–24.[Abstract]
  33. Arcot S.S., Lipke D.W., Gillespie M.N., Olson J.W. Alterations of growth factor transcripts in rat lungs during development of monocrotaline-induced pulmonary hypertension. Biochem Pharmacol (1993) 46:1086–1091.[CrossRef][Web of Science][Medline]
  34. Wang D., Li M.-H., Hsu K., et al. Air embolism-induced lung injury in isolated rat lungs. J Appl Physiol (1992) 72:1235–1242.[Abstract/Free Full Text]
  35. Li H., Chen S.J., Chen Y.-F., et al. Enhanced endothelin-1 and endothelin receptor gene expression in chronic hypoxia. J Appl Physiol (1994) 77:1451–1459.[Abstract/Free Full Text]
  36. Elton T.S., Oparil S., Taylor G.R., et al. Normobaric hypoxia stimulates endothelin-1 gene expression in the rat. Am J Physiol (1992) 263:R1260–R1264.[Web of Science][Medline]
  37. Li H., Elton T.S., Chen Y.F., Oparil S. Increased endothelin receptor gene expression in hypoxic rat lung. Am J Physiol (1994) 266:L553–L560.[Web of Science][Medline]
  38. Tchekneva E., Quertermous T., Christman B., Lawrence M., Meyrick B. Regional variability in preproendothelin-1 gene expression in sheep pulmonary artery and lung during onset of air-induced chronic pulmonary hypertension: participation of arterial smooth muscle cells. J Clin Invest (1998) 101:1389–1397.[Web of Science][Medline]
  39. Hassoun P.M., Thappa V., Landman M.J., Fanburg B.L. Endothelin 1: mitogenic activity on pulmonary artery smooth muscle cells and release from hypoxic endothelial cells. Proc Soc Exp Biol Med (1992) 199:165–170.[CrossRef][Medline]
  40. Peng W., Michael J.R., Hoidal J.R., Karwande S.V., Farrukh I.S. ET-1 modulates KCa-channel activity and arterial tension in normoxic and hypoxic human pulmonary vasculature. Am J Physiol (1998) 275:L729–L739.[Web of Science][Medline]
  41. Salter K.J., Turner J.L., Albarwani S., Clapp L.H., Kozlowski R.Z. Ca2+-activated Cl and K+ channels and their modulation by endothelin-1 in rat pulmonary arterial smooth muscle cells. Exp Physiol (1995) 80:815–824.[Abstract]
  42. Plevin R., Kellock N.A., Wakelam M.J.O., Wadsworth R. Regulation by hypoxia of endothelin-1-stimulated phospholipase D activity in sheep pulmonary artery cultured smooth muscle cells. Br J Pharmacol (1994) 112:311–315.[Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Markewitz, B. A
Right arrow Articles by Michael, J. R
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Markewitz, B. A
Right arrow Articles by Michael, J. R
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?