© 2000 by European Society of Cardiology
Copyright © 2000, European Society of Cardiology
IRFI 042, a novel dual vitamin E-like antioxidant, inhibits activation of nuclear factor-
B and reduces the inflammatory response in myocardial ischemia–reperfusion injury
aInstitute of Pharmacology, School of Medicine, University of Messina, Policlinico Universitario, Via Consolare Valeria, Policlinico Gazzi Torre Biologica 5° Piano, 98125 Messina, Italy
bInstitute of Human Physiology, School of Medicine, University of Messina, Policlinico Universitario, 98100 Messina, Italy
cDepartment of Internal Medicine, School of Medicine, University of Messina, Policlinico Universitario 98100 Messina, Italy
dBiomedica Foscama Research Center, Ferentino (FR), Italy
* Corresponding author. Tel.: +39-90-221-3648; fax: +39-90-221-3300 squadrito{at}csnet.it
Received 16 December 1999; accepted 4 May 2000
 |
Abstract |
|---|
 Top Abstract 1 Introduction2 Methods3 Results4 DiscussionReferences |
|---|
Background: Nuclear factor-
B (NF-B) is a ubiquitous rapid response transcription factor involved in inflammatory reactions which exerts its effect by expressing cytokines, chemokines, and cell adhesion molecules. Oxidative stress causes NF-B activation. IRFI 042 is a novel dual vitamin E-like antioxidant and we, therefore, investigated its ability to protect the heart from oxidative stress and to halt the inflammatory response in a model of myocardial ischaemia–reperfusion injury. Methods: Anaesthetized rats were subjected to total occlusion (45 min) of the left main coronary artery followed by 5-h reperfusion (MI/R). Sham myocardial ischaemia rats (sham-operated rats) were used as controls. Myocardial necrosis, cardiac output, cardiac and plasma vitamin E levels, myocardial malondialdehyde (MAL), cardiac SOD activity and elastase content (an index of leukocyte infiltration), hydroxyl radical (OH•) formation, cardiac amount of mRNA codifying for ICAM-1 (evaluated by the means of reverse transcriptase polymerase chain reaction) and ICAM-1 immunostaining in the at-risk myocardium were investigated. NF-B activation and the inhibitory protein of NF-B, I-B
, were also studied in at-risk myocardium by using electrophoretic mobility shift assay (EMSA) and Western blot analysis, respectively. Results: The ischaemia–reperfusion model produced wide heart necrosis (area at risk–necrotic area=52±5%; necrotic area–left ventricle=28±3%), increased cardiac MAL, an index of lipid peroxidation (area at risk=62.5±3.9 nmol/g tissue; necrotic area=80.3±5.1 nmol/g tissue), induced tissue neutrophil infiltration, and caused a marked decrease in endogenous antioxidants. Furthermore, myocardial ischaemia plus reperfusion caused in the area at risk peak message for ICAM-1 at 3 h of reperfusion and increased cardiac ICAM-1 immunostaining at 5 h of reperfusion. NF-B activation was also evident at 0.5 h of reperfusion and reached its maximum at 2 h of reperfusion. I-B was markedly decreased at 45 min of occlusion; peak reduction was observed at 1 h of reperfusion and thereafter it was gradually restored. Intraperitoneal administration of IRFI 042 (5, 10, 20 mg/kg, 5 min after reperfusion) reduced myocardial necrosis expressed as a percentage either of the area at risk (18±4%) or the total left ventricle (11±2%), and improved cardiac output. This treatment also limited membrane lipid peroxidation in the area at risk (MAL=14.3±2.5 nmol/g tissue) and in the necrotic area (MAL=26.5±3.7 nmol/g tissue), restored the endogenous antioxidants vitamin E and superoxide dismutase, and inhibited detrimental hydroxyl radical formation. Finally, IRFI 042 blocked the activation of NF-B, reduced cardiac ICAM-1 expression, and blunted tissue elastase content, an index of leukocytes accumulation at the site of injury. Conclusions: Our data suggest that IRFI 042 is cardioprotective during myocardial infarction by limiting reperfusion-induced oxidative stress and by halting the inflammatory response.
KEYWORDS Free radicals; Hemodynamics; Infection/inflammation; Ischaemia; Necrosis; Reperfusion
|
1 Introduction |
|---|
|
TopAbstract1 Introduction2 Methods3 Results4 DiscussionReferences |
|---|
Several pathogenic mechanisms have been proposed to explain the myocardial damage that occurs during myocardial ischaemia–reperfusion injury. In recent years, oxidative stress has been shown to play a pivotal role especially during the reperfusion period. In fact, although reperfusion is essential to halt the progression of cellular injury associated with decreased oxygen and nutrient delivery, it can also lead to negative events such as the cardiac leukocytes infiltration, subsequent production of inflammatory mediators [1] and free radical-induced lipid peroxidation. This last event is associated with detrimental effects on the reversibly injured cells [2] and is related with the evolution of myocardial damage [3].
Oxidative stress during post-ischaemic reperfusion therefore plays a pivotal role in activating interconnected inflammatory cascades that have been already recognized to be involved in the development of reperfusion-induced damage [4]. Indeed, reactive oxygen intermediates (ROIs) activate nuclear factor kappa B (NF-B), an ubiquitous rapid response transcription factor which modulates gene expression in various situations that require rapid and sensitive immune and inflammatory response and that causes the expression of several cytokines and adhesion molecules, such as E-selectin, vascular cell adhesion molecule 1 (VCAM-1), and intercellular adhesion molecule 1 (ICAM-1) [5]. This latter adhesion molecule has been show to play a key role in myocardial ischaemia–reperfusion injury [6]. With this background, quenching of ROIs would theoretically have a dual benefit in myocardial ischaemia–reperfusion injury: it would limit the evolution of myocardial damage by either reducing free radicals-induced lipid peroxidation and blunting ROIs mediated activation of inflammatory reaction.
Endogenous antioxidants or free radicals scavengers are able to limit but not to fully neutralize the oxygen reactive species which are generated during this reaction [7], and this leads to the uncontrolled progression of peroxidative damage to cellular membranes.
The chain-breaking antioxidant, vitamin E plays an important role in the endogenous defense system, since it has been demonstrated that its deficiency is responsible for increased myocardial injury caused by oxidative stress [8] and that ischaemia reperfusion of the heart is associated with a blunting in cardiac -tocopherol levels [9,10]. Furthermore, experimental evidence suggest that vitamin E and its derivative pentamethyl-hydroxychromane effectively inhibit activation of NF-B [11]. Besides this, the slow incorporation of vitamin E into tissues, due to its marked lipophilicity, is probably responsible for its failure as a cardioprotective compound as shown during the acute administration of -tocopherol after ischaemia–reperfusion injury induced in the pig [12].
The vitamin E analogue IRFI 042 (Fig. 1) is a novel dual antioxidant compound which is more idrophilic and selective than the natural one. IRFI 042 is a pro-drug that displays a longer half-life and more effective distribution than its derived molecule IRFI 005 which is unstable in light and temperature.
|
In the present study, we investigated the ability of IRFI 042 in reducing the damage to rat heart after myocardial ischaemia and reperfusion.
|
2 Methods |
|---|
|
TopAbstract1 Introduction2 Methods3 Results4 DiscussionReferences |
|---|
The investigation conforms with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996).
2.1 Surgical procedures
Male Sprague–Dawley rats (230–250 g body weight) underwent myocardial ischaemia which was induced by a temporary occlusion of the left main coronary artery [13]. Rats were anaesthetized with sodium pentobarbital (50 mg/kg) and placed on a heated operating table. The animals were kept anaesthetized for the entire experiment. Polyethylene catheters (PE 50) were inserted into the common carotid artery for the measurement of blood pressure and heart rate, as previously reported [14]. After tracheotomy, the animals were ventilated with room air by a respirator for small rodents (model 7025, Ugo Basile, Varese, Italy) with a stroke volume of 15 ml/kg and a rate of 54 stroke/min to maintain normal PO2, PCO2 and pH parameters. An incision was made on the left side of the chest and the fourth intercostal space exposed. Sutures were placed through the overlapping skin and muscles to permit rapid closure of the chest wall following the surgical procedure. The chest was then opened and the ribs were gently spread. The heart was quickly expressed out of the thoracic cavity, inverted and a 4.0 silk ligature was placed under the visualized left main coronary artery. The ligature was then tied. The heart was returned quickly to the thoracic cavity and the tips of the suture, used to produce the coronary legation, were exteriorized through the chest wall. After the removal of air in the chest by a syringe, the incision was closed by tying the previously placed sutures. The occlusion period lasted 45 min, then the tips of sutures were removed and the heart was reperfused for 5 h (MI/R groups). Control animals underwent all the previously described surgical procedures apart from the fact that the sutures, passing around the left coronary artery, were not tied (Sham MI/R groups).
Animals were treated with IRFI 042 (5, 10 and 20 mg/kg) or vehicle (DMSO/NaCl 0.9%, 1:1 v/v; 1 ml/kg) acutely intraperitoneally 5 min after the onset of reperfusion.
2.2 Myocardial damage quantification
Infarcted and perfused areas were determined by triphenyl tetrazolium chloride Evan's blue technique [15]. At the end of reperfusion period, the ligature around the left main coronary artery was retighten; 2 ml of Evan's blue dye (2 mg/ml solution in phosphate buffer 20 mM, pH 7.4) was injected into the jugular vein to stain the area of the myocardium perfused by the patent coronary artery. The area at risk was determined by negative staining. The atria, right ventricle and major blood vessels were subsequently removed from the heart. The left ventricle was then sliced into 3-mm thick sections parallel to the atrioventricular groove by a graduated electric slicer. The sections were placed between two Plexiglas plates and the outlines of the entire areas of the left ventricle and the unstained areas of the myocardium (i.e. the area at risk) were traced on transparencies. The sections were washed in cool saline for 15 min and then immersed in a 1% solution of the triphenyl tetrazolium chloride stain in 20 mM phosphate buffer, pH 7.4 at 37°C for 20 min to detect the presence of coenzyme and dehydrogenase. Viable tissues stained deep red, and infarcted areas depleted of dehydrogenase were unstained. These area were recorded on transparencies, as has been mentioned. The entire left ventricle, areas at risk of ischaemia and areas of infarct were measured by an electronic planimeter (Lasico Instrument Co., Inc., Los Angeles, CA). Samples from all three portions of left ventricular cardiac tissue (i.e. non-ischemic, ischemic non-necrotic, and ischemic necrotic) were weighed and stored at –70°C for subsequent analysis.
2.3 Haemodynamic measurements
For the haemodynamic measurements, a cannula was inserted into the left common carotid artery, as described elsewhere [14] and connected to a pressure transducer (Mac Lab/4E transducer module, AD instruments, Hastings, UK). Changes in electrical activity of the myocardium were detected by electrocardiogram (ECG) (MacLab/4E ECG module, AD Instruments, Hastings, UK) in lead II. Furthermore, an ultrasonic flow probe was placed around the ascending aorta for continuous measurement of cardiac output. All the data obtained from each module of the system were elaborated by computer software (Charter Windows 3.5, AD Instruments, Hastings, UK) and displayed on a computer monitor [14].
2.4 Lipid peroxidation determination
Determination of the cardiac malondialdehyde (MAL) was carried out in order to estimate the extent of lipid peroxidation in the damaged tissue [16]. Samples of the area not at risk, the area at risk, and the necrotic area, obtained at the end of reperfusion were frozen at –70°C until the assay. On the day of analysis, after thawing, tissue samples were washed in ice-cold 20 mM Tris–HCl, pH 7.4, blotted on absorbant paper and weighed. Each sample was then minced in ice-cold 20 mM Tris–HCl pH 7.4 and homogenized, in a ratio 1:10 w/v, using a Teflon pestle. After centrifugation at 3000xg for 10 min at 4°C, the clear homogenate supernatant was used for biochemical assay. The assay was carried out using a colorimetric commercial kit (Lipid Peroxidation Assay Kit, Cat. No. 437634, Calbiochem-Novabiochem Corporation, USA).
Briefly, 0.65 ml of 10.3 mM N-methyl-2-phenylindole in acetonitrile were added to 0.2 ml of homogenate supernatant. After vortexing for 3–4 s and adding 0.15 ml of HCl 37%, samples were mixed well, sealed with a tight stopper, and incubated at 45°C for 60 min. The samples were then cooled on ice and the absorbance was measured spectrophotometrically at 586 nm. A calibration curve of an accurately prepared standard MAL solution (from 2 to 128 nmol/ml) was also run for quantitation.
2.5 Vitamin E evaluation
Cardiac and plasma vitamin E (VE) levels were measured in order to determine the oxidative state of the heart and the blood following the ischaemia reperfusion injury. Samples of blood (0.3 ml) were drawn from the carotid catheter before occlusion and at the end of reperfusion. The blood removed was replaced at a ratio of 1:2 with saline solution (NaCl, 0.9%), then collected in dark polyethylene tubes, to avoid direct light, containing 10 µl of heparin solution (8000 IU) and 5 µl of BHT (1 mg/ml in phosphate buffer). The blood samples were centrifuged at 3000xg for 10 min at 4°C. Myocardial VE levels were determined in the area not at risk and in the area at risk samples obtained after excision of the heart. Plasma and myocardial specimens were stored at –70°C until the assay. The assay was performed using a high-performance liquid chromatography (HPLC) method with some modifications [17]. Briefly, 0.15 ml of plasma or tissue homogenate, in dark polyethylene tubes, were treated with 150 µl of tocopherol acetate (25 µg/ml in ethanol) (Sigma Chemical Co., St. Louis, MO, USA), which was used as an internal standard, and with 300 µl of butanol/ethyl acetate (1:1, v/v) (Acros Chemical, Geel, Belgium). After vortexing for 20 s, 15 mg of sodium sulfate were added (Acros Chemical, Geel, Belgium) and shaken on a vortex mixer for an additional 60 s. After centrifugation at 15 000xg for 5 min at 4°C, the organic layer was recovered and 50 µl was injected into the HPLC apparatus. The HPLC equipment consisted of a solvent delivery module (Model 422 Master, Kontron Instruments, Everett, USA), a programmable variable wavelength detector (Spectromonitor 4100, Thermo Separation Products, Florida, USA), connected to an automatic integrator (Model CR-3A, Shimadzu, Kyoto, Japan). The column used was an UltraTechsphere C18, 250x4.6 mm, 5 µ (HPLC Technology Ltd., Macclesfield, Cheshire, UK), attached to a precolumn (Guard column, Water-Millipore, Milford, USA). The mobile phase was methanol/water (97:5, v/v) at a flow-rate of 1 ml/min at room temperature. The detector was set at a wavelength of 280 nm. The concentration of plasma vitamin E was expressed in µM.
2.6 Cardiac superoxide dismutase assessment
Superoxide dismutase (SOD) activity was evaluated to estimate endogenous defenses against superoxide anions. The analysis was carried out in the area not at risk, the area at risk, and necrotic area of the left ventricle. SOD activity was determined spectrophotometrically at 505 nm by using a commercial kit (Ransod Assay Kit, Cat. No. Sd 125, Randox Laboratories, Crumlin, UK). SOD activity was expressed as Units/mg protein.
2.7 Measurement of hydroxyl radical (OH•) formation
In order to quantify OH– production during occlusion and reperfusion in the heart, we used the aromatic trap technique [18]. Sodium salicylate serves as a specific trap for hydroxyl radicals because it can react chemically with the produced OH– radicals, yielding 2,5-dihydroxybenzoic acid (2,5-DHBA), 2,3 dihydroxybenzoic acid (2,3-DHBA), and catechol as its hydroxylation derivatives, in approximate proportions of 40, 49, and 11%, respectively [19]. In the present study, we measured both 2,5-DHBA and 2,3-DHBA [20,21]. To allow the chemical reaction, each group of animals received sodium salicylate (100 mg/kg i.p.) [22] (Janssen Chemical, Beerse, Belgium), 1 h before surgical procedures. Another experimental group, which underwent myocardial ischaemia plus reperfusion, was not administered sodium salicylate with the aim of studying any possible direct action of the acid on the considered parameters.
We did not observe any interaction between salicylic acid and the compound IRFI 042. Samples of blood (0.5 ml) were drawn from the carotid catheter before occlusion, 1 h after reperfusion, 3 h after reperfusion, and at the end of reperfusion. The blood removed was replaced at a ratio of 1:2 with saline solution (NaCl 0.9%). The blood was collected in polyethylene tubes containing 20 µl of heparin solution (16 000 IU). The plasma samples obtained after centrifugation at 3000xg for 10 min at 4°C were frozen at –70°C until the assay. To measure 2,5-DHBA and 2,3-DHBA formation, an HPLC method was used [19,23]. Briefly, 250 µl of plasma was treated with 10 µl of 100 µM 2,4-dihydroxybenzoic acid (2,4-DHBA) (Janssen Chemical, Beerse, Belgium), which has been used as an internal standard and 10 µl of 40% HClO4. The plasma was extracted with 2.5 ml HPLC grade diethylether (Janssen Chemical, Beerse, Belgium) and mixed on a vortex for 2 min. After centrifugation for 15 min at 15 000xg at 4°C, the diethylether layer was separated and was then evaporated in a vacuum concentrator system (Heto Lab Equipment, Denmark). The residue obtained was dissolved in 30 µl of 0.1 N HCl and 32.5 µl of the mobile phase, and 50 µl of the solution was injected into the HPLC apparatus. The HPLC equipment consisted of a solvent delivery module (Model 422 Master, Kontron Instruments, Everett, USA), a programmable wavelength detector (Model 165, Beckman Instruments, San Ramon, USA), connected to an automatic integrator (Model CR-3A, Shimadzu, Kyoto, Japan). The column used was a Lichrosorb-10-RP18, 10 µm, 250x4.6 mm (Labservice Analytica, Milano, Italy), attached to a precolumn (Guard Column Water-Millipore, Milford, USA). The mobile phase was 80% 0.003 M citric acid, 0.003 M acetic buffer (pH 3.6) and 255 methanol (Janssen Chemical, Beerse, Belgium) at a flow-rate of 1.3 ml/min. The concentrations of 2,3-DHBA and 2,5-DHBA were expressed in µM.
2.8 Cardiac elastase content
Elastase (ELA) levels were evaluated as an index of PMNs accumulation and activation in the jeopardized tissue because this enzyme is released from the stimulated granulocytes at the site of injury [24]. The analysis was carried out in the area not at risk, the area at risk, and the necrotic area of the left ventricle by using a specific immunoassay kit (PMN elastase, IMAC, Cat. No. 11332, Merck, Darmstadt, Germany). ELA activity was expressed in Units/g tissue.
2.9 RNA isolation and reverse transcriptase-polymerase chain reaction (RT-PCR)
Total cellular RNA was extracted from heart sections (area at risk) at several time points of occlusion and reperfusion. The methods used in the current study have been described elsewhere [25]. In brief, approximately 100 mg of cardiac muscle was homogenized with 800 µl RNAzol Stat (Teltest, Firendswood, TX) in a microfuge tube, after which 80 µl chloroform was added. After vortexing and centrifugation, the aqueous phase was transferred to a new microfuge tube containing an equal volume of cold isopropanol and the RNA recovered by precipitation by chilling at –80°C for 15 min. The pellet was washed with cold ethanol 70%, centrifuged, dried in speed vacuum, centrifuged a second time and then dissolved in 20 µl of buffer. A 2-µg portion of total RNA was subjected to first strand cDNA synthesis in a 20-µl reaction mixture containing the AMV reverse transcriptase (Superscript II; BRL USA), each dNTP, the specific primers, Tris–HCl and MgCl2.
After dilution of the product with distilled water, 5 µl were used for each polymerase chain reaction (PCR) which contained the Taq polymerase (Perkin-Elmer), the buffer as supplied with the enzyme, each dNTP, and the specific primers, designed to cross introns and to avoid confusion between mRNA expression and genomic contamination.
The following oligonucleotide pairs were used (5' oligo/3'oligo), each sequence as 5' to 3': ICAM-1: AGGTGGATACCGGTAGA/CCTTCTAAGTCCTCCAACA; GAPDH: ACCACCATGGAGAAGGTCGG/CTCAGTGTAGCCCAGGATGGC.
The optimal cycle number for ICAM-1 was 25 and we used a PCR negative and a PCR positive control without cDNA or with a known cDNA, respectively. A portion of the PCR product was electrophoresed and transferred to a nylon membrane which was prehybridized with oligonucleotide probes, radiolabeled with [32P]ATP by a T4 oligonucleotide kinase. After an overnight hybridization at 55°C, filters underwent autoradiography in a dark-room with a fixed camera. The captured image, using image analysis software (Bio-Profil, Celbio, Milan, Italy), was subjected to densitometric analysis.
2.10 Immunohistochemistry
ICAM-1 staining was studied in the area at risk at the end of reperfusion period. For immunohistochemical evaluation, 5-µm thick cryostat sections were stained according to the avidin–biotin–peroxidase complex procedure [26]. An average of seven sections per immunohistochemical stain was cut from each sample, air-dried for 30 min, and the fixed in cold acetone for 10 min. Endogenous peroxidases were blocked with horse serum for 15 min at room temperature prior to incubation with primary antibodies. Monoclonal antibodies consisted of mouse monoclonal antibodies raised against rat ICAM-1 (clone: IA 28, subclass IgG1) and were obtained from British Biotechnology Products Ltd (Abingdom, UK). A monoclonal mouse IgG1 antibody was used for the controls. Biotinylated, specific-specific second layer reagents were the applied, followed by avidin–biotin–horse radish peroxidase complex as a chromogenic substrate, as previously shown. The microscope image was examined using a computer-assisted image analyzer that analyzed the changes in staining. Densitometric analysis of the captured image was performed on a PC using image analysis software.
2.11 Isolation of nuclear and cytoplasmic proteins
Briefly, 70 mg of pulverized myocardial samples (obtained from the area at risk at different time points) were homogenized in 0.8 ml ice-cold hypotonic buffer [10 mM HEPES pH 7.9, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothreitol (DDT); protease inhibitors: 0.5 mM phenyl methylsulfonyl fluoride, aprotinin, pepstatin, leupeptin (10 µg/ml each); and phosphatase inhibitors: 50 mM NAF, 30 mM β-glycerophosphate, 1 mM Na3VO4 and 20 mM P-nitrophenyl phosphate]. The homogenates were centrifuged for 30 s at 2000 rpm at 4°C to eliminate any unbroken tissues. The supernatants were incubated on ice for 20 min, vortexed for 30 s after addition of 50 µl of 10% Nonidet P-40 and then centrifuged for 1 min at 4°C in an Eppendorf centrifuge. Supernatants containing cytoplasmic protein were collected and stored at –80°C. The pellets, after a single wash with the hypotonic buffer without Nonidet P-40, were suspended in an ice-cold hypertonic salt buffer (20 mM HEPES pH 7.9, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, protease inhibitors, and phosphatase inhibitors), incubated on ice for 30 min, mixed frequently, and centrifuged for 15 min at 4°C. The supernatants were collected as nuclear extracts and stored at –80°C. The concentration of total proteins in the samples was determined by a commercially available protein assay reagent. To estimate possible contamination of the nuclear extracts with the cytoplasmic extracts, when preparing the nuclear and cytoplasmic proteins, lactate dehydrogenase (LDH) activity was determined by a commercially available kit for the quantitative kinetic determination of LDH activity (Sigma Chemical, St. Louis, MO). Values were expressed as LDH activity units per milligram of protein. To establish that the nuclear extracts contained mainly nuclear proteins, 40 µg of nuclear protein preparations were subjected to Western blot analysis for histone H3, a nuclear protein, with anti-histone H3 antibody (Upstate Biotechnology, Lake Placid, NY).
2.12 Electrophoretic mobility shift assay
NF-B binding activity was performed in a 15-µl binding reaction mixture containing 1% binding buffer [50 µg/ml of double-stranded poly(dI-dC), 10 mM Tris–HCl (pH 7.5), 50 mM NaCl, 0.5 mM EDTA, 0.5 mM DTT, 1 mM MgCl2, and 10% glycerol], 15 µg of nuclear proteins, and 35 fmol (50 000 cpm, Cherenkov counting) of double-stranded NF-B consensus oligonucleotide (5'-AGT TGA GGG GAC TTT CCC AGG C-8') which was end-labeled with [
-32P]ATP (3000 Ci/mmol at 10 mCi/ml; Amersham Life Sciences, Arlington Heights, IL) using T4 polynucleotide kinase. The binding reaction mixture was incubated at room temperature for 20 min and analyzed by electrophoresis on 5% nondenaturing polyacrylamide gels. After electrophoresis, the gels were dried using a gel-drier and exposed to Kodak X-ray films at –70°C. The binding bands were quantified by scanning densitometry of a bio-image analysis system (Bio-Profil Celbio, Milan, Italy). The results for the time-point from each group were expressed as relative integrated intensity compared with the sham-operated group measured in the same batch because the integrated intensity of group samples from different electrophoretic mobility shift assay (EMSA) batches would be affected by the half-life of the isotope, exposure time, and background levels.
2.13 Western blot analysis of I-B in cytoplasm
Cytoplasmic proteins (40 µg) from each sample were mixed with 2x SDS sample buffer [62 mM Tris (pH 6.8), 10% glycerol, 2% SDS, 5% β-mercaptoethanol, 0.003% bromophenol blue], heated at 95°C for 5 min, and separated by SDS–polyacrylamide gel electrophoresis. After electrophoresis on 12.5% polyacrylamide gels, the separated proteins were transferred from the gels into Hybond electrochemiluminescence membranes (Amersham) using a Bio-Rad semidry transfer system (Bio-Rad) for 2 h. The membranes were blocked with 5% not-fat dry milk in TBS–0.05% Tween for 1 h at room temperature, washed three times for 10 min each in TBS–0.05 Tween 20, and incubated with a primary I-B antibody (Santa Cruz Biotechnology) in TBS–0.05% Tween 20 containing 5% not-fat dry milk for 1–2 h at room temperature. After being washed three times for 10 min each in TBS–0.05% Tween 20, the membranes were incubated with a second antibody peroxidase-conjugated goat anti-rabbit immunoglobulin G (Sigma) for 1 h at room temperature. After washing, the membranes were analyzed by the enhanced chemiluminescence system according to the manufacturer's protocol (Amersham). The I-B protein signal was quantified by scanning densitometry using a bio-image analysis system (Bio-Profil Celbio, Milan Italy). The results from each experimental group were expressed as relative integrated intensity compared with normal hearts measured with the same batch.
2.14 Drug
IRFI 042 was supplied by Biomedica Foscama Research Center, Ferentino, (FR), Italy.
The compound was administered intraperitoneally, 5 min following the onset of reperfusion, in dimethylsulphoxide/NaCl 0.9% (1:1, v/v). All substances were prepared fresh daily and administered in a volume of 1 ml/kg.
2.15 Statistical analysis
Data are expressed as means±S.D. and were analyzed by ANOVA for multiple comparison of results. Duncan's multiple range test was used to compare group means. In all cases, a probability error of less than 0.05 was selected as the criterion for statistical significance.
|
3 Results |
|---|
|
TopAbstract1 Introduction2 Methods3 Results4 DiscussionReferences |
|---|
3.1 Myocardial infarct size
The area at risk showed no significant differences between each of the experimental groups (Fig. 2), indicating that a similar amount of tissue (about 50%) was jeopardized by the occlusion of the left coronary artery in each group. To further confirm effective occlusion and reperfusion, ST-segment changes were evaluated. Peak ST-segment elevation occurred at 30–45 min following coronary occlusion in each group and there were no significant differences in peak ST-segment elevation among any of the ischemic experimental group (Table 1). Moreover ST-segment elevation at the end of reperfusion decreased significantly in MI/R rats. The onset of reperfusion was also associated with a noticeable increase in premature left ventricular arrhythmias in all ischemic–reperfused MI/R rats. Mortality ranged between 10 and 15% and failure to develop ischemia and reperfusion (10%) was similar in all experimental groups. All these data, taken together, suggest that the pathophysiologic response to occlusion and reperfusion of the left coronary artery was comparable among all groups.
|
|
In the MI/R vehicle group, the necrotic area, expressed either as percentage of the area at risk or as percentage of the left ventricle was significantly increased indicating that a large amount of cardiac tissue at risk became necrotic (Fig. 2).
Administration of IRFI 042 reduced significantly myocardial necrosis extension. This reduction was observed either in the necrotic area/area at risk or in the necrotic area/total left ventricle (Fig. 2).
3.2 Haemodynamic parameters
At the end of experiments, mean arterial blood pressure (MAP: 62±4 mmHg) and heart rate (HR: 275±12 beats/min) were significantly decreased in MI/R rats administered with vehicle. Administration of IRFI 042 (20 mg/kg) improved MAP (80±3 mmHg) and HR (317±15 beats/min) in MI/R rats. Cardiac output decreased during coronary occlusion in all animals (Table 2). This parameter improved during reperfusion in all animals but it continued to deteriorate in the MI/R rats given with vehicle and it was significantly depressed at the end of reperfusion (Table 2). Administration of IRFI 042, in a dose-dependent manner, markedly improved cardiac output (Table 2).
|
3.3 Cardiac malondialdehyde (MAL) analysis
Determination of cardiac MAL was performed to estimate free radical damage on biological membranes (Table 3). In the area not at risk, MAL levels ranged between 8 and 9 nmol/g tissue in all groups. In contrast, a significant increase in MAL production was found both in the area at risk and in the necrotic area of the MI/R rats treated with vehicle (Table 3). The administration of IRFI 042 reduced in a dose-dependent manner MAL concentration by inhibiting lipid peroxidation in both considered areas. No significant differences were observed in sham rats given either vehicle or IRFI 042 (Table 3).
|
3.4 Vitamin E analysis
Table 4 summarizes the plasma vitamin E (VE) values measured in the basal conditions, and at the end of reperfusion. Before occlusion, plasma VE levels ranged from 0.15 to 0.22 µmol/mg of cholesterol, and there were no significant differences among the groups. In contrast, at the end of reperfusion, a marked decrease was noted in the plasma of MI/R rats given vehicle. The treatment with the vitamin E analogue significantly restored VE (Table 4).
|
Vitamin E was evaluated in the area not at risk and in the area at risk. Myocardial VE contained in the areas not at risk ranged between 50 and 60 nmol/g tissue. Instead, decreased VE concentrations were found in the areas at risk of MI/R vehicle rats (Table 5). The administration of the drug partially restored VE levels (Table 5).
|
3.5 SOD activity
Table 6 shows the variations of SOD activity evaluated in the area not at risk, the area at risk and in the necrotic area in each experimental group. In the area not at risk, SOD activities ranged between 19 and 23 U/mg protein in all groups, and these values were considered normal. In contrast, a marked decrease in SOD activity was found in both the area at risk and in the necrotic area of the MI/R group treated with vehicle (Table 6). The treatment with IRFI 042 significantly inhibited the reduction in SOD activity both in the area at risk and in the necrotic area (Table 6).
|
3.6 OH• formation
Fig. 3 shows the time course of 2,3-DHBA and 2,5-DHBA produced in each group and measured under basal conditions, 1 h after reperfusion, 3 h after reperfusion and at the end of reperfusion. Very low amount of the acids were detected before ischaemia in all groups studied (<0.5 µM for 2,3-DHBA and <2 µM for 2,5-DHBA). A high amount of both acids was seen 1 h after the beginning of reperfusion in all infarcted groups, thus confirming the critical role played by free radicals during the early period of reoxygenation (Fig. 3). After 3 h of reperfusion and at the end of reperfusion, both 2,3-DHBA and 2,5-DHBA levels were nearly similar to basal values. Treatment with IRFI 042 showed a reduction in OH• production during reperfusion. No significant differences were observed at 3 h or at the end of reperfusion (Fig. 3).
|
3.7 Elastase levels
Table 7 reports elastase (ELA) amount evaluated in the area not at risk, the area at risk and in the necrotic area. High ELA activities were found both in the area at risk and in the necrotic area of the MI/R group treated with vehicle. However, IRFI 042 reduced tissue ELA levels both in the area at risk and in the necrotic area (Table 7). ELA values, in the area not at risk, ranged between 0.22 and 0.32 µg/g tissue in each group, and there were no significant differences in ELA contents among groups (Table 7).
|
3.8 ICAM-1 mRNA expression
The top of Fig. 4 shows representative autoradiograms highlighting peak mRNA expression for cardiac ICAM-1 in rats subjected to myocardial ischaemia–reperfusion injury and treated with vehicle or IRFI 042. The bottom of Fig. 4 depicts quantitative data and indicates relative amount of cardiac ICAM-1 mRNA at different time points in infarcted rats treated with vehicle or the antioxidant. No significant change in cardiac ICAM-1 mRNA expression was observed during occlusion of the coronary artery. In contrast, cardiac mRNA levels for ICAM-1 were significantly elevated during reperfusion (Fig. 4) and peak levels for adhesion molecule message were reached at 3 h of reperfusion. Administration of IRFI 042 (Fig. 4) blunted cardiac ICAM-1 mRNA expression (Fig. 4).
|
3.9 ICAM-1 expression in myocardium at risk
ICAM-1 staining was studied in myocardium at risk. Immunohistochemical evaluation indicated that a very low constitutive staining of ICAM-1 was present in the myocardium of sham-operated animals (Fig. 5) and in non-ischaemic myocardium of infarcted rats (results not shown). In contrast, samples of the area at risk obtained from MI/R rats showed an increase in ICAM-1 staining. IRFI 042 reduced the increased staining of ICAM-1 (Fig. 5).
|
3.10 Activation of nuclear factor
BNF-
b activation in the nuclear extracts of myocardium was determined by EMSA in the at-risk myocardium at different time-points. The top of Fig. 6 shows a representative EMSA picture indicating peak activation of NF-b. The bottom of the Fig. 6 shows quantitative data obtained at different time-points.
|
NF-
b binding activity was present at very low levels in sham-operated animals during occlusion and reperfusion. NF-b rapidly increased at 0.5 h of reperfusion and reached its peak following 2 h of reperfusion (Fig. 6). The administration of IRFI 042 markedly reduced NF-b binding activity (Fig. 6).
3.11 Loss of I-B protein in the cytoplasm
Nuclear factor B (NF-b) activation was also indirectly investigated by studying its inhibitory cytoplasmic protein I-B in the at-risk myocardium. The top of Fig. 7 shows representative Western blot analysis indicating peak reduction of I-B protein in the cytoplasm of myocardium obtained from sham-operated animals and rats subjected to myocardial ischaemia and treated with vehicle or IRFI 042. The bottom of Fig. 7 represents quantitative data at different time-points. I-B levels in the cytoplasm began to decrease at 45 min of occlusion and peak reduction was observed at 1 h of reperfusion Thereafter, I-B levels in cytoplasm increased and following 5 h of reperfusion the cardiac levels of the inhibitory protein were not significantly different than those of sham-operated animals (Fig. 7). The administration of IRFI 042 blunted the consistent loss of I-B protein from the cytoplasm (Fig. 7).
|
|
4 Discussion |
|---|
|
TopAbstract1 Introduction2 Methods3 Results4 DiscussionReferences |
|---|
In recent years, the pivotal role that reactive oxygen species play in the pathogenesis of several cardiovascular diseases, such as atherogenesis, myocardial infarction, and post-angioplasty restenosis, has been widely demonstrated.
Free radicals are also able to accelerate plaque formation by promoting LDL oxidation [27], an increased expression of endothelial cell adhesion molecules, and alterations in chemotactic properties of monocytes [28]. Besides this, they also lead to precipitation of clinical events by facilitating plaque rupture, fibrosis, calcification, and thrombosis [29].
Concerning myocardial ischaemia reperfusion injury, the loss of membrane integrity seems to be the major mechanism of free radical-mediated reperfusion injury [30], and several sources of ROIs have been identified in the damaged area, such as the xanthine oxidase pathway, activated leukocytes, and arachidonic acid metabolism [31]. Also, free radicals appear to act through the NF-B pathway since it has been demonstrated that the administration of the antioxidant pyrrolidine dithiocarbamate reduces nuclear transcriptional factor translocation which is evident during the earliest phases of cardiac ischaemia [32]. In this way, they indirectly enhance the NF-B-mediated expression of cellular adhesion molecules, such as ICAM-1 [5], which is responsible for detrimental leukocytes infiltration.
All this evidence supports the importance of an efficient endogenous defense system and the possible additional role of an antioxidant therapy.
Vitamin E is one of the most studied chain-breaking antioxidant. Even if its positive effects are not completely clear in primary prevention trials, the protective role of alpha-tocopherol is supported by observational cohort studies [33,34] and by two large secondary prevention trials, the Cambridge Heart Antioxidant Study and the Cholesterol Lowering Atherosclerosis Study [35], which have shown a decreased risk of major coronary diseases associated with dietary VE supplementation. This suggests a strongly reduced risk of myocardial infarction and all cardiovascular events, combined with inhibition of lesion progression in patients with angiographic evidence of coronary atherogenesis.
Furthermore, the Indian Experiment of Infarct Survival Study [36] and the Multivitamins and Probucol Study Group [37], respectively, pointed out the therapeutic efficacy of antioxidants in reducing infarct size and post-MI complications, such as angina and total cardiac events and in preventing post-angioplasty coronary restenosis.
However, to achieve sufficiently high tissue concentration for adequate protection against myocardial infarction, -tocopherol must be administered for several days before the ischemic event. In fact, acute administration of vitamin E has many limitations due to its high lipophilicity resulting in slow incorporation; moreover, pharmacological doses of -tocopherol may result in side-effects such as hypotension and tachycardia [38].
A number of less lipophilic -tocopherol analogues endowed with radical scavenging activity have been described in the literature. One of them, IRFI 005, has been shown to exert a potent vitamin E-like activity both in chemical and biological systems [39]. Its 5-acetoxy pro-drug, raxofelast [39] is currently being tested in clinical studies aimed to asses its potential for the treatment of vascular diabetic complications. To our knowledge, no vitamin E-like compound provided with a sulphydryl moiety has been reported so far. In our opinion, the combination in the same molecule of a chain-breaking moiety (characteristic of phenols related to -tocopherol) with the reducing ability of thiol groups may result in powerful and peculiar biological actions, especially in those oxidative stress-mediated situations in which a significant depletion of endogenous thiols is observed.
IRFI 042 (±)-5-emisuccinoyl-2-[2-(acetylthio)ethyl]-2,3-dihydro-4,6,7-trimethylbenzofuran (Fig. 1) was designed to this aim: both the 5-OH and the –SH groups are acyl-protected and have been shown to be easily regenerated in vivo. The compound is rapidly and almost completed absorbed and its in vivo pharmacokinetics after intravenous administration justify the timing of administration used in the present experiment (unpublished observation).
With this information, we investigated the effects of IRFI 042 in myocardial ischaemia–reperfusion injury.
IRFI 042 reduced the necrotic area, whether it was expressed as percentage of area at risk or of total left ventricle. Furthermore, the cardiac content of MAL was evaluated as an index of lipid peroxidation. The compound caused a decrease in cardiac MAL which speaks in favor of a significant attenuation of membrane injury.
The drug was also able to limit the depletion of VE and SOD that occurs in cardiac reperfusion by competing in free radicals neutralization and in trapping OH• radicals. IRFI 042 also inhibited their production as shown by the decreased amounts of 2,3-DHBA and 2,5-DHBA which are considered bona fide reporters of the flux of hydroxyl radicals. Finally, administration of IRFI 042 blunted neutrophil recruitment in the damaged tissue, as shown by a reduction in cardiac elastase content. This latter finding prompted us to analyze more deeply the mechanism underlying the ‘anti-inflammatory’ activity of the compound.
NF-B is an early transcription factor which modulates gene expression in various situations that require rapid and sensitive immune and inflammatory response. The prototypic inducible form of NF-B is an heterodimer composed of NF-B1 and Rel A, which both belong to the NF-B/Rel family of proteins. Inactive NF-B is present in the cytoplasm complexed with the inhibitory protein I-B. NF-B is activated by a number of incoming signals from the cell surface. Released from I-B inhibition, NF-B translocates to the nucleus and binds to the B motif of the target gene, which in turn causes activation of several factors (cell adhesion molecules, cytokines) involved in the inflammatory response. We found that peak NF-B activation was achieved at 1 h of reperfusion. By this time cytoplasmic I-B protein levels and NF-B nuclear binding activity returned to basal levels thus confirming that NF-B represents a rapid and early signal mechanism for controlling gene expression during reperfusion, as previously shown in an ‘in vitro’ model of myocardial iscahemia–reperfusion injury [30]. In keeping with this hypothesis, cardiac ICAM-1 mRNA levels started to increase at 1 h of reperfusion and a peak for the adhesion molecule was reached following 3 h of reperfusion. At the end of reperfusion, we found increased immunostaining for the adhesion molecule in the at-risk myocardium. This strongly supports the idea that NF-B activates an inflammatory cascade leading to the expression of cell adhesion molecules and cytokines and, finally, culminating in the deleterious accumulation of leukocytes in ischaemic tissue. A direct effect of the drug on neutrophil activation and function can also be ruled out: in fact in vitro experiments showed that IRFI 042 does not influence concavalin A- and PMA-induced activation adhesion of leukocytes (unpublished observations). Oxidative stress may exert its toxic effect, at least in part, through NF-B activation [5] and, therefore, antioxidants can work as NF-B inhibitors. Our data strongly support this hypothesis, since IRFI 042 succeeded in blocking NF-B activation, which, in turn, switched off the ICAM-1 gene and, therefore, limited leukocyte infiltration.
In conclusion, all these data attest to a high degree of cardioprotection mediated by IRFI 042 during acute myocardial infarct and suggest the potential role of antioxidants in a new therapeutic approach to myocardial infarction in light of their ability to reduce reperfusion-induced oxidative stress and halt the inflammatory response.
Time for primary review 25 days.
|
References |
|---|
|
TopAbstract1 Introduction2 Methods3 Results4 DiscussionReferences |
|---|
- Seekamp A., Ward P.A. Ischemia–reperfusion injury [review]. Agents Actions (1993) 41:137–152.
- Hearse D.J., Tosaki A. Free radicals and calcium: simultaneous interacting triggers as determinants of vulnerability to reperfusion-induced arrhythmias in the rat heart. J Mol Cell Cardiol (1988) 20:213–223.[Web of Science][Medline]
- Nohl H., Stolze K., Napetschnig S., Ishikawa T. Is oxidative stress primarily involved in reperfusion injury of the ischemic heart? Free Radic Biol Med (1991) 11:581–588.[CrossRef][Web of Science][Medline]
- Lucchesi B.M. Modulation of leukocyte-mediated myocardial reperfusion injury. Annu Rev Physiol (1990) 52:561–583.[CrossRef][Web of Science][Medline]
- May M.J., Ghosh S. Signal transduction through NF-B. Immunol Today (1998) 19:81–88.
- Ioculano M., Squadrito F., Altavilla D., et al. Antibodies against intercellular adhesion molecule-1 protects against myocardial ischaemia–reperfusion injury in the rat. Eur J Pharmacol (1994) 284:143–149.
- Roth E., Torok B., Bar W., Pollak S. Antioxidant protection against free radical-mediated myocardial injury. Prog Clin Biol Res (1987) 236:633–640.
- Klein H.H., Pich S., Lindert S., Nebendahl K., Niedmann P., Krevzer H. Combined treatment with vitamins E and C in experimental myocardial infarction in pigs. Am Heart J (1989) 118:667–674.[CrossRef][Web of Science][Medline]
- Weisel R.D., Mickle D.A.G., Finkle C.D., et al. Myocardial free radical injury after cardioplegia. Circulation (1989) 80(suppl. II):14–23.
- Haramaki N., Stewart D.B., Aggarwal S., Ikeda H., Reznik A.Z., Packer L. Networking antioxidant in the isolated rat heart are selectively depleted by ischemia–reperfusion. Free Radic Biol Med (1998) 25(3):329–339.[CrossRef][Web of Science][Medline]
- Hattori S., Hattori Y., Banba N., Kasai K., Shimoda S. Pentamethyl-hydroxychromane, vitamin E derivative, inhibits induction of nitric oxide by bacterial lipopolysaccharide. Biochem Mol Biol Int (1995) 35:177–183.[Web of Science][Medline]
- Klein H.H., Pich S., Lindert-Heimberg W., Nebendahl K., Niedmann P. Failure of chronic, high dose, oral vitamin E treatment to protect the ischemic reperfused porcine heart. J Mol Cell Cardiol (1993) 62:103–112.
- Griswold D.E., Hillegass L.M., Hill D.E., Egan J.W., Smith E.F. III. Method for quantification of myocardial infarction and inflammatory cell infiltration in rat cardiac tissue. J Pharmacol Methods (1988) 20:225–235.[CrossRef][Web of Science][Medline]
- Squadrito F., Altavilla D., Squadrito G., et al. Cyclosporin-A reduces leukocytes accumulation and protects against myocardial ischaemia reperfusion injury in rats. Eur J Pharmacol (1999) 364:159–168.[CrossRef][Web of Science][Medline]
- Klein H.H., Puschmann S., Schaper W. The mechanism of tetrazolium reaction in identifying experimental myocardial infarction. Arch Pathol Anat (1981) 393:287–297.
- Corongiu F., Lai M., Milai A. Carbon tetrachloride, bromotrichlormethane and ethane acute intoxication. Biochem J (1983) 212:625–631.[Web of Science][Medline]
- Nieremberg D.W., Lester D.C. Determination of vitamins E and A in serum and plasma using a simplified clarification method and high-performance liquid chromatography. J Chromatogr (1985) 345:275–284.[Web of Science][Medline]
- Floyd R.A., Watson J.J., Wong P.K. Sensitive assay of hydroxyl free radical formation utilizing high pressure liquid chromatography with electrochemical detection of phenol and salicylate products. J Biochem Biophys Methods (1984) 10:221–235.[CrossRef][Web of Science][Medline]
- Takemura G., Onodera T., Ashraf M. Quantification of hydroxyl radical and its lack of relevance to myocardial injury during early reperfusion after graded ischaemia in rat heart. Circ Res (1992) 71:96–105.
[Abstract/Free Full Text] - Powell S.R. Salicylate trapping of OH• as a tool for studying post-ischemic oxidative injury. Free Radic Res (1994) 21:355–370.[Web of Science][Medline]
- Wolff S.P., Jiang Z.Y., Hunt J.U. Protein glycation and oxidative stress in diabetes mellitus and aging. Free Radic Biol Med (1991) 10:339–352.[CrossRef][Web of Science][Medline]
- Ohkuwa T., Sato Y., Naoi M. Hydroxyl radical formation in diabetic rats induced by streptozotocin. Life Sci (1995) 57:1789–1798.
- Onodera T., Ashraf M. Detection of hydroxyl radicals in the postischemic reperfused heart using salicylate as a trapping agent. J Mol Cell Cardiol (1991) 23:365–370.[CrossRef][Web of Science][Medline]
- Lang H., Jochum M., Fritz H., Redl H. Second Vienna shock forum. Shlag G., Redl H., eds. (1991) New York: Alan R. Liss. 701–706.
- Yamada T., Matsumori A., Sasayama S. Therapeutic effects of anti-tumor necrosis factor-alpha antibody on the murine model of viral myocarditis induced by encephalomyocarditis virus. Circulation (1994) 8:846–851.
- Hsu S.M., Raine L., Fanger H. A comparative study of the peroxidase-antiperoxidase method and an avidin–biotin complex method for studying polypeptide hormones with radioimmunoassay antibodies. Am J Clin Pathol (1981) 75:734–737.[Web of Science][Medline]
- Steinberg D., Parthasarathy S., Carew T.E., Khoo J.C., Wiztum J.L. Beyond cholesterol: modifications of low-density lipoprotein cholesterol that increase its atherogenicity. N Engl J Med (1989) 320:915–924.[Web of Science][Medline]
- Quinn M.T., Parthasarathy S., Fong L.G., Steinberg D. Oxidatively modified low density lipoproteins: a potential role in recruitment and retention of monocyte/macrophages during atherogenesis. Proc Natl Acad Sci USA (1987) 84:2995–2998.
[Abstract/Free Full Text] - Gokce N., Frei B. Basic research in antioxidant inhibition of steps in atherogenesis. J Cardiovasc Risk (1996) 3:352–357.[Medline]
- Ferrari R., Ceconi C., Curello S., Cargnoni A., De Giuli F., Visioli O. Occurrence of oxidative stress during myocardial reperfusion. Mol Cell Biochem (1992) 111:61–69.[CrossRef][Web of Science][Medline]
- Grisham M.B., Granger D.M. Metabolic sources of reactive oxygen metabolites during oxidant stress and ischemia and reperfusion. Clin Chest Med (1989) 10:71–81.[Web of Science][Medline]
- Li C., Browder W., Kao R.L. Early activation of transcription factor NF-kappa B during ischemia in perfused rat heart. Am J Physiol (1999) 276(2):H543–552.[Web of Science][Medline]
- Stampfer M.J., Hennekens C.H., Manson J.E., Colditz J.A., Rosner B., Willett W.C. Vitamin E consumption and the risk of coronary heart disease in women. N Engl J Med (1993) 328:1444–1449.
[Abstract/Free Full Text] - Rimm E.B., Stampfer M.J., Ascherio A., Giovannucci E., Colditz G.A., Willett W.C. Vitamin E consumption and the risk of coronary heart disease in men. N Engl J Med (1993) 328:1450–1456.
[Abstract/Free Full Text] - Azen S.P., Qian D., Mack W.J., et al. Effect of supplementary antioxidant vitamin intake on carotid arterial wall intima-media thickness in a controlled clinical trial of cholesterol lowering. Circulation (1996) 94:2369–2372.
[Abstract/Free Full Text] - Singh R.B., Niaz M.A., Rastogi S.S., Rastogi S. Usefulness of antioxidant vitamins in suspected acute myocardial infarction (The Indian experiment of infarct survival: 3). Am J Cardiol (1996) 77:232–236.[CrossRef][Web of Science][Medline]
- Tardif J.C., Cote G., Lesperance J., et al. Probucol and multivitamins in the prevention of restenosis after coronary angioplasty: Multivitamins and Probucol Study Group. N Engl J Med (1997) 337:365–372.
[Abstract/Free Full Text] - Massey K.D., Burton K. -Tocopherol attenuates myocardial membrane related alterations resulting from ischemia and reperfusion. Am J Physiol (1989) 256:H1192–H1199.[Web of Science][Medline]
- Campo G.M., Ceccarelli S., Squadrito F., Altavilla D., Dorigotti L., Caputi A.P. Raxofelast (IRFI 016): A new hydrophilic vitamin E-like antioxidant agent. Cardiovasc Drug Rev (1997) 15:157–173.[CrossRef][Web of Science]
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  A. Shimamoto, A. J. Chong, M. Yada, S. Shomura, H. Takayama, A. J. Fleisig, M. L. Agnew, C. R. Hampton, C. L. Rothnie, D. J. Spring, et al. Inhibition of Toll-like Receptor 4 With Eritoran Attenuates Myocardial Ischemia-Reperfusion Injury Circulation, July 4, 2006; 114(1_suppl): I-270 - I-274. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Nahrendorf, K. Hu, S. Frantz, F. A. Jaffer, C.-H. Tung, K.-H. Hiller, S. Voll, P. Nordbeck, D. Sosnovik, S. Gattenlohner, et al. Factor XIII Deficiency Causes Cardiac Rupture, Impairs Wound Healing, and Aggravates Cardiac Remodeling in Mice With Myocardial Infarction Circulation, March 7, 2006; 113(9): 1196 - 1202. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Messina, D. Altavilla, M. Aguennouz, P. Seminara, L. Minutoli, M. C. Monici, A. Bitto, A. Mazzeo, H. Marini, F. Squadrito, et al. Lipid Peroxidation Inhibition Blunts Nuclear Factor-{kappa}B Activation, Reduces Skeletal Muscle Degeneration, and Enhances Muscle Function in mdx Mice Am. J. Pathol., March 1, 2006; 168(3): 918 - 926. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. F. Merrill, T. H. Rork, N. M. Spiler, and R. Golfetti Acetaminophen and myocardial infarction in dogs Am J Physiol Heart Circ Physiol, November 1, 2004; 287(5): H1913 - H1920. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Ogata, T. Miyauchi, S. Sakai, M. Takanashi, Y. Irukayama-Tomobe, and I. Yamaguchi Myocardial fibrosis and diastolic dysfunction in deoxycorticosterone acetate-salt hypertensive rats is ameliorated by the peroxisome proliferator-activated receptor-alpha activator fenofibrate, partly by suppressing inflammatory responses associated with the nuclear factor-kappa-b pathway J. Am. Coll. Cardiol., April 21, 2004; 43(8): 1481 - 1488. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Li, T. Ha, J. Kelley, X. Gao, Y. Qiu, R. L Kao, W. Browder, and D. L Williams Modulating Toll-like receptor mediated signaling by (1->3)-{beta}-D-glucan rapidly induces cardioprotection Cardiovasc Res, February 15, 2004; 61(3): 538 - 547. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Viswanathan, B. D. Hammock, J. W. Newman, P. Meerarani, M. Toborek, and B. Hennig Involvement of CYP 2C9 in Mediating the Proinflammatory Effects of Linoleic Acid in Vascular Endothelial Cells J. Am. Coll. Nutr., December 1, 2003; 22(6): 502 - 510. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.C. Monici, M. Aguennouz, A. Mazzeo, C. Messina, and G. Vita Activation of nuclear factor-{kappa}B in inflammatory myopathies and Duchenne muscular dystrophy Neurology, March 25, 2003; 60(6): 993 - 997. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L. Evans, I. D. Goldfine, B. A. Maddux, and G. M. Grodsky Oxidative Stress and Stress-Activated Signaling Pathways: A Unifying Hypothesis of Type 2 Diabetes Endocr. Rev., October 1, 2002; 23(5): 599 - 622. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q.-D. Wang, J. Pernow, P.-O. Sjoquist, and L. Ryden Pharmacological possibilities for protection against myocardial reperfusion injury Cardiovasc Res, July 1, 2002; 55(1): 25 - 37. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Altavilla, G. Squadrito, L. Minutoli, B. Deodato, A. Bova, A. Sardella, P. Seminara, M. Passaniti, G. Urna, S. F Venuti, et al. Inhibition of nuclear factor-{kappa}B activation by IRFI 042, protects against endotoxin-induced shock Cardiovasc Res, June 1, 2002; 54(3): 684 - 693. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Stenvinkel Endothelial dysfunction and inflammation--is there a link? Nephrol. Dial. Transplant., October 1, 2001; 16(10): 1968 - 1971. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||