© 2000 by European Society of Cardiology
Copyright © 2000, European Society of Cardiology
Transgenic rat hearts expressing a human cardiac troponin T deletion reveal diastolic dysfunction and ventricular arrhythmias
Department of Internal Medicine II and Department of Pathology, Medical University of Luebeck, Ratzeburger Allee 160, 23538 Luebeck, Germany
* Corresponding author. Tel.: +49-451-500-2363; fax: +49-451-500-2421 franz{at}medinf.mu-luebeck.de
Received 1 February 2000; accepted 10 April 2000
| Abstract |
|---|
|
|
|---|
Objective: Familial hypertrophic cardiomyopathy (FHC) due to mutations of cardiac troponin T (cTnT) is associated with a high frequency of sudden death even in the absence of cardiac hypertrophy. To investigate the causal relationship of cTnT mutations and this particular phenotype, we sought to establish a transgenic rat model for the disease. Methods: Transgenic rats were generated expressing human wild-type cTnT or two truncated cTnT molecules (del ex16, del ex15/16), resulting from an intron 15 splice donor site mutation previously observed in FHC patients. Transgenic rat hearts were characterized by histology, immunohistochemistry and in the working heart. Results: Human wild-type and del ex16 cTnT were stably expressed and incorporated into the sarcomere of transgenic cardiomyocytes. Del ex16 transgenic rats revealed a lower level of expression (4–5%) than human wt cTnT animals (25–40%). In the working heart model del ex16 hearts exhibited significant systolic and diastolic dysfunction without cardiac hypertrophy. In contrast, human wt cTnT hearts showed improved contractile performance and moderate myocardial hypertrophy. After 6 months of daily physical exercise one del ex16 rat died suddenly and three out of five del ex16 hearts revealed ventricular tachycardia/fibrillation. No arrhythmia was observed in human wt cTnT expressors. Myofibrillar disarray was present in del ex16 hearts after training but not in human wild-type cTnT rats or non-transgenic controls. Conclusion: A human cTnT deletion overexpressed in transgenic rats exerts a dominant-negative effect and mimics the phenotype of FHC with diastolic dysfunction and arrhythmias. By contrast, human cTnT wild-type animals reveal a gain of function and cardiac hypertrophy without arrhythmias.
KEYWORDS Cardiomyopathy; Hypertrophy; Contractile function; Ventricular arrhythmias
This article is referred to in the Editorial by P.R. Kowey et al. (pages 210–211) in this issue.
| 1 Introduction |
|---|
|
|
|---|
Familial hypertrophic cardiomyopathy (FHC) is an autosomal-dominant disease caused by mutations of the sarcomeric proteins [1–7]. It is characterized by ventricular hypertrophy, arrhythmias and sudden death. The phenotype of affected individuals may vary from early sudden death, marked hypertrophy with contractile dysfunction to an asymptomatic carrier status [8]. Many cardiac troponin T (cTnT) mutations are associated with a high incidence of arrhythmias and sudden death [9–11]. In contrast to β-myosin heavy chain (MHC) mutations the high mortality of cTnT–FHC is associated with only minor or even absent myocardial hypertrophy [11–13].
The mechanism by which mutations in contractile proteins could cause FHC is poorly understood. At least two hypotheses are discussed [2]: (1) a dominant-negative effect, i.e. the mutated protein acts as a poison peptide, interfering with the function of other sarcomeric proteins, or (2) a stoichiometrical imbalance of the sarcomeric proteins due to failure to incorporate the mutant proteins in a regular manner (haplo-insufficiency).
Missense mutations in the MHC-molecule seem to act in a dominant-negative fashion. Expression of these mutant proteins in vitro [14–16] and in transgenic mice [17,18] alter the regular function and structure of the sarcomere. Similar findings were reported for a human cTnT mutation (Arg92Gln), that caused contractile dysfunction in transfected cardiomyocytes in vitro [19] and in vivo [20]. In contrast, haplo-insufficiency was proposed in case of a splice-donor-site mutation of cTnT (Int15G
A) [2], leading to two truncated cTnT molecules. This view is supported by analogy to a Drosophila troponin T deletion mutation (upheld2) that acts as a null allele without detectable sarcomeric cTnT and loss of thin filaments in mutant muscle [21]. However, cardiac dysfunction was observed in a mouse model expressing one of the cTnT deletion mutations [22]. Our aim therefore was to extend the insight into the pathomechanism of cTnT–FHC by establishing a transgenic rat model expressing two human cTnT deletion mutations (i) lacking exon 16 (ii) lacking exon 15 and 16 and a wild-type human cTnT.
| 2 Methods |
|---|
|
|
|---|
2.1 PCR — mutagenesis and vectors
Mutated cTnT cDNAs were generated by site-directed PCR-mutagenesis [23] using wild-type cTnT [24] as template [EcoRI-subcloned in Bluescript KS vector (Stratagene, La Jolla, CA, USA)]. The cTnT intron 15 splice-donor site mutation [2] led to the transcription of two deletion mutations (Fig. 1a): Activation of a cryptic splice donor site in intron 15 results in premature termination and the loss of the terminal 14 amino acid residues (del ex16). Skipping of exon 15 leads to the loss of the terminal 28 amino acids. Due to a frameshift seven new residues are encoded and a premature termination occurs (del ex15/16).
|
Del ex16: primers F366(GGAGCTCGTTTCTCTC)/R849(CCGCGGGTCTTGGAATGATCA GACTTTCTGGTTATCGTT) and F819(CGATAACCAGAAAGTCTGATCATCCAAGAC CCGCGGG)/R912(GAGGAGCAGATCTTTGG). Del ex15/16: primers F366/R853(CCTTCC CGCGGGTCTTGGAGCTCATATTTTCTGCTGCTTG) and F834(CTCCAAGACCCGCGG GAAGG)/R912. Wild-type cTnT was cloned (XhoI/BamHI) into expression vector pSVL (Pharmacia, Sweden). Mutated cTnT PCR-products were also subcloned (del ex15/16: BalI/BglII; del ex 16: SacI/BglII) into this vector for subsequent in vitro transfection studies.
2.2 Transient transfection of cos-cells
Cos-7 cells (106) were transfected with 15 µg of pSVL plasmid, containing wild-type or mutated cTnT, using a modified calcium phosphate transfection protocol (MBS Transfection Kit, Stratagene). Cells were harvested after 72 h. Western blot analysis was performed as described below, employing cTnT antibody 1B10.
2.3 Microinjection constructs
The human cTnT constructs were under the control of the 2.1-kb myosin light chain-2 (mlc-2) promoter [25]. At the 3'-end the SV40 untranslated region (EcoNI/SalI) of the pGL2 vector (Promega, USA) was introduced via NotI. At the 5'-end of the mlc-2 promoter an oligonucleotide containing an EcoRV and NotI-site was inserted via KpnI. The new NotI-site was used for introduction of the –590/91bp fragment of the human cytomegalovirus (CMV) immediate-early enhancer in order to enhance expression levels [26]. The CMV enhancer fragment was generated by PCR (template: CMV-β vector (Clontech, USA), primers: FCMV: CTATGCGGCCGCCGCTTCGAGCTCGCCCGACATTGATTATTGACTAGT and RCMV: CTATGCGGCCGCATGGGGCGGAGTTGTTACGACATTTTGGAAAGT). CTnT cDNAs were introduced via EcoRI after digestion of pSVL–cTnT with EcoRI. The final microinjection constructs were linearized by restriction with BssHII yielding a fragment of 4.9 kb. Correct sequence of the constructs was confirmed by an automated sequencing device of Applied Biosystems (model 373A) (Medigene, Germany).
2.4 Generation and analysis of transgenic rats
Microinjection constructs (Fig. 2a) were purified as previously described [24] and microinjected into male pronuclei of fertilized Sprague–Dawley rat oozytes [27]. DNA was extracted from rat tail biopsies with the Quiamp tissue kit (Qiagen, Germany). Heterozygote and homozygote transgenic offspring was identified with PCR (primers: MLCF3: GCAGGGGCCGGCCAGCAGGCTC and R412:GCTCTGCCCGACGTCTCTCGAT CC) and Southern blotting according to the protocol of the DIG luminescent detection kit (Roche Diagnostics, Germany).
|
2.5 Protein analysis and Western blot
Rat tissue was immediately harvested and prepared according to the Trizol-protocol (Gibco Life Technologies, Germany). Protein concentration was determined with the protein assay ESL (Roche Diagnostics). A 2.5–5 mg aliquot of total protein homogenate was separated by a 10% SDS–PAGE using a 2.5–5% stacking gel and semidry blotted onto a nitrocellulose membrane. Detection of primary antibodies was carried out with the ECL-kit (Amersham, UK) using peroxidase-labeled secondary antibodies against mouse and rabbit IgG, respectively, according to the manufacturers protocol. The following anti-cTnT antibodies were used: (i) SA4157 (rabbit polyclonal anti-cTnT antibodies, obtained after immunization with a human-specific cTnT peptide (NH2–EEQEEAAEEDAEAEA–COOH); (ii) monoclonal non-species specific cTnT antibodies 1B10 [28] and 1H10 [29]; (iii) monoclonal human specific anti-cTnT antibody 2D10 (Research Diagnostics, USA). Protein concentration on Western Blot was estimated by densitometrical analysis (Molecular Analyst, Bio-Rad, Germany) using purified human cTnT as standard (Biogenesis, UK).
2.6 Preparation of isolated neonatal rat cardiomyocytes
Primary rat neonatal cardiomyocytes were prepared as described [30]. About 200 000 cells were allowed to adhere to 24 well plates. After 48–72 h immunostaining was carried out.
2.7 Immunostaining
Cultured primary rat cardiomyocytes were fixed for 20 min with 3.7% formaldehyde. Cells were then permeabilized using 0.4% Triton X-100 in phosphate buffered saline (PBS). Primary antibodies (monoclonal anti-cardiac troponin I 4B7 [31], monoclonal anti-troponin T (1B10), polyclonal anti-troponin T (SA4157)) and secondary antibodies [Cy3-conjugated goat anti-mouse IgG and goat anti-rabbit IgG (Dianova, Germany)] were incubated in a humidified chamber at 37°C for 60 min. Preparations were visualized using a confocal microscope (MRC 500, Bio-Rad).
2.8 Isolated working heart perfusions
Myocardial function was evaluated using a modified isolated working heart preparation [32]. Animals were anesthetized with pentobarbital sodium (40 mg/kg i.p.). After thoracotomy the aorta was cannulated and retrograde aortic perfusion was initiated in situ to prevent ischemia. Hearts were than rapidly excised, mounted on a perfusion apparatus (Hugo Sachs Elektronik (HSE), Germany) and perfused in a retrograde Langendorff mode with Krebs–Henseleit buffer [33]. The buffer was equilibrated at 37°C with 95% O2–5% CO2. For ECG monitoring suction electrodes were placed on the left ventricular apex and the right atrium, respectively. Left atrial pressure and aortic pressure were measured with an Isotec pressure transducer (HSE), intraventricular pressure with a Millar-tip catheter (HSE) inserted via the aortic valve. After 15 min of Langendorff perfusion, the hearts were switched to the working heart mode with a defined preload of 10 mmHg and afterload of 80 mmHg. Hearts were electrically paced near the sinoatrial node at 300 beats/min. Data on contractile performance were collected on-line at a sampling rate of 100 Hz with an electronic data acquisition system (MacLab ADInstruments, USA). Parameters measured were heart rate, aortic pressure, left ventricular systolic (LVSP) and diastolic pressure and the maximal and minimal first derivatives of LVSP as a function of time (+dP/dt and –dP/dt). Ten sequential beats were averaged for each measurement. The relaxation times (RT) RT50 and RT90 were determined from peak intraventricular pressure to 50% and 90% of maximal stress during relaxation. Experiments were performed by M.D. unaware of the genotype of the animals.
A subset of transgenic and control rats was subjected to exercise. Animals (10–12 weeks old) underwent treadmill exercise for 60 min daily for 6 months. The speed of the treadmill was increased stepwise over 4 weeks up to the maximum velocity that was tolerated for 1 h (0.3 m/s). After the training program, hearts were excised and examined in the working heart model.
The investigation conforms with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996).
2.9 Histological analyses
After CO2 asphyxiation, hearts were immediately removed. Contaminating blood was washed of by PBS. Hearts were then fixed in 4% paraformaldehyde–PBS and later processed for paraffin embedding, sectioning and microscopic analysis. Routine staining was performed with hematoxylin–eosin (HE). Individual myocyte width was quantified microscopically with a measurement scale (Zeiss, Germany). Two pathologists (K.G.; H.M.), blinded to the genotype, independently measured 150 myocytes per animal.
| 3 Results |
|---|
|
|
|---|
3.1 Expression of human cTnT deletion mutations in cos-7 cells
To test whether the cTnT deletion mutations could be stably expressed in vitro, cos-7 cells were transiently transfected with human wt and mutated cTnT deletion constructs under control of the SV40 promoter (Fig. 1a). A Western blot (Fig. 1b) probed with an anti-human cTnT-antibody (1B10) revealed a band with higher electrophoretic mobility in case of the cTnT deletion mutations del ex16 and del ex15/16 as compared to the wt. The Western blot analysis also indicated that cTnT deletion mutations did not lead to significant alterations of protein stability in vitro.
3.2 Generation of transgenic rats overexpressing human cTnT deletion mutations
Microinjections were performed to obtain rat lines expressing cTnT deletion mutations found in FHC patients (del ex16 and del ex15/16). To examine possible effects of human cTnT in the rat background also a wt human cTnT (hcTnT) construct (Fig. 2a) was introduced.
Microinjection of the hcTnT construct into 114 oocytes resulted in four independent lines out of ten potential founders, two expressing the transgene. Microinjection of the del ex16 construct in 61 oocytes led to three independent lines out of ten potential founders, two expressing the deletion mutation. Five independent injections of the del ex15/16 construct with a total of 363 oocytes did not result in viable offspring containing the transgene. A high frequency of resorptions and stillbirths was observed suggesting a lethal effect of the del ex15/16 transgene.
3.3 Expression of the transgene
To detect the expression of the human cTnT transgene in rat a human-specific monoclonal anti-cTnT antibody (2D10) was used. On Western blotting (Fig. 2b) both transgenes, human wild-type (hcTnT) and truncated (del ex16) cTnT were detected by the anti-human cTnT antibody. Endogenous rat cTnT was detected by the non-species-specific antibody 1B10. Densitometric analysis of Western blots using recombinant human cTnT as standard revealed an expression level of the truncated cTnT of
4–5% in relation to endogenous rat cTnT. Human wild-type cTnT was expressed on higher level of
25–40%. The total amount of cTnT expression was not different between non-transgenic [mean (n=6)±standard error of mean: 2.09 arbitrary units±0.21] and wild-type cTnT transgenic rats (1.86±0.23 (n=14); P=n.s.) suggesting a compensatory down-regulation of endogenous cTnT protein.
3.4 Human cTnT is incorporated into the sarcomere of transgenic rats
To test for incorporation of transgenic proteins into the contractile apparatus of neonatal rat cardiomyocytes, transgenic and non-transgenic controls were analyzed by immunostaining (Fig. 3). The non-species-specific anti-cTnT (1B10) antibody (Fig. 3A–C) and the anti-troponin I (4B7) antibody (Fig. 3G–I) revealed a similar regular staining of the sarcomeric structure in del ex16 and hcTnT transgenic animals as well as in non-transgenic controls. Using the anti-human specific antibody SA4157 (Fig. 3D–F) a typical cross-striation was detectable in cardiomyocytes overexpressing human wild-type cTnT (Fig. 3F). Similar results were obtained in cells expressing del ex16 (Fig. 3E), though staining was less intense corresponding to the lower expression level of the deletion mutation (4–5%) compared to human wild-type cTnT (25–40%). No specific staining of the sarcomere was observed in cardiomyocytes of non-transgenic controls. These data demonstrate that the human cTnT deletion del ex16 and human wild-type cTnT are incorporated into the sarcomere of transgenic rats.
|
3.5 Transgenic rats and cardiac hypertrophy
Analysis of the heart weight/body weight ratio and cardiomyocyte size in 12–14- and 30–38-week-old del ex16 transgenic rats did not show significant cardiac hypertrophy compared to non-transgenic controls (Table 1). In contrast, transgenic rats overexpressing human wild-type cTnT displayed a significant increase in heart/body weight ratio at age of 12–14 (+14%) and 30–38 weeks (+11%) and also an increase of cardiomyocyte size (+16%), indicating myocardial hypertrophy. Rats subjected to physical exercise also exhibited a significantly higher heart to body weight ratio as compared to untrained controls (+23% in transgenic rats expressing human wild-type cTnT, +19% in rats expressing truncated cTnT (del ex16) and +18% in non-transgenic rats). Cardiomyocyte width was accordingly increased (19–20%) in all trained animals compared to untrained controls (Table 1).
|
3.6 Del ex16 rats exhibit impaired systolic and diastolic function
To examine the functional consequences of mutated and wild-type cTnT expression in transgenic rats, isolated hearts were analyzed by the working heart perfusion apparatus (Table 2, Fig. 4). Diastolic and systolic dysfunction of del ex16 rats was demonstrated by a 43% increase of the relaxation half time (RT50) and a 39% prolongation of the time to peak pressure. In contrast, rat hearts expressing wild-type human cTnT revealed a markedly enhanced systolic and diastolic function: Time to peak pressure was significantly reduced by 24% and +dP/dt and –dP/dt were increased by 24 and 26%, respectively.
|
|
3.7 Cardiac arrhythmias in del ex16 transgenic rats after physical exercise
The arrhythmogenic potential of the cTnT deletion mutation was tested in rats subjected to daily treadmill exercise in order to imitate triggering events observed in FHC patients [34]. None of four rats overexpressing human wild-type cTnT and none of five non-transgenic controls died suddenly or revealed any arrhythmia in the working heart apparatus (Fig. 5). In contrast, one del ex16 transgenic animal died suddenly after exercise. Furthermore, the hearts of three out of five del ex16 transgenic animals exhibited ventricular tachycardia or ventricular fibrillation in the working heart model. Animals not subjected to exercise revealed neither arrhythmias in the working heart nor died suddenly.
|
3.8 Histological analysis
Histological tissue sections of untrained transgenic or non-transgenic rat hearts revealed no significant disarray or fibrosis (Fig. 6). However, 6 months after physical exercise transgenic rats expressing the del ex16 mutation showed areas of focal disarray (less than 5% of total myocardium), which were neither found in rats overexpressing human wild-type cTnT nor in non-transgenic control animals.
|
| 4 Discussion |
|---|
|
|
|---|
FHC is regarded a genetic disease of the sarcomere. Although there is overwhelming evidence of a causal relationship between sarcomeric protein mutations and FHC, the molecular mechanisms by which a specific mutation leads to a distinct phenotype and the factors affecting penetrance and expressivity of the disease are still unknown. We have established a transgenic rat model of cTnT–FHC to investigate the disease phenotype and its molecular pathogenesis.
4.1 Expression and incorporation of the transgenes into the sarcomere
In the del ex16 transgenic rats expression of the truncated human cTnT molecule was 4% compared to wild-type rat cTnT. This low level of transgene expression is in accordance with other mouse models of FHC [18,20,22]. Low transgene expression is obviously sufficient to induce cardiomyopathy, suggesting a dominant-negative effect of the truncated cTnT protein. It is tempting to speculate that a self-protective mechanism exists that differentially down-regulates the expression of the mutated allele, since wild-type human cTnT was expressed in transgenic rats on an almost 10-fold higher level (25–40% of rat cTnT) whereas the copy numbers of the transgenes were in the same range (3–5, data not shown). This hypothesis on downregulation of the mutated allele is further supported by an in vitro transfection study [35]. In this study the mutated cTnT was only 8% relative to endogenous cTnT compared to 35% when wild-type cTnT was transfected. However, the differential expression levels of mutated and wild-type cTnT could also be explained by differences in the stability of transgenic RNA and/or protein compared to the endogenous gene product.
To test for integration of the transgenes into the contractile apparatus, neonatal rat cardiomyocytes of transgenic and control animals were analyzed by immunofluorescence. Using a human cardiac cTnT-specific antibody sarcomeric cross-striation was only visible in cardiomyocytes of transgenic rats demonstrating integration of both human wild-type and truncated cTnT transgenes into the sarcomere. These data further indicate a dominant-negative effect of mutated cTnT in vivo.
4.2 Mutated human cTnT leads to diastolic dysfunction and arrhythmias
In patients with FHC, diastolic dysfunction is invariably found [36], while end systolic volumes are markedly reduced due to a hypercontractile left ventricle. These clinical findings are largely explained by an increase of left ventricular muscle mass and secondary fibrosis. In our transgenic rats carrying the cTnT deletion mutation diastolic dysfunction was clearly present as indicated by a significant prolongation of relaxation half time (RT50: +43%). In addition, there was evidence of systolic dysfunction indicated by a significant decrease of time to peak pressure (TTP: –39%). Interestingly, the functional abnormalities in the working heart model were present without relevant myocardial hypertrophy or fibrosis. These findings not only correspond to clinical data but also match previous in vitro data on isolated cardiomyocytes or muscle strips, where systolic and diastolic dysfunction cannot be attributed to secondary fibrosis [15,19]. In other studies mutated proteins were found to be incorporated into the sarcomere without major structural changes but still obvious contractile dysfunction [37,38]. Similar observations were made in transgenic mouse models, where introduction of an
-MHC mutation into the mouse genome [17] or expression of a cTnT missense mutation [20] also led to diastolic dysfunction without significant cardiac hypertrophy. In a mouse model expressing the cTnT deletion mutation del ex15/16 diastolic dysfunction was even present in a hypotrophic phenotype with a reduced heart-to-body weight ratio [22]. It is therefore highly likely that diastolic dysfunction seen in FHC patients is primarily due to the dominant-negative effect of the mutant protein and cannot solely be explained by secondary effects of hypertrophy and fibrosis.
The cTnT intron 15 splice-donor mutation leads to two different aberrant splice products either lacking exon 15 and 16 (plus seven nonsense amino acids) or a splice form only lacking exon 16. We therefore sought to establish transgenic lines for both truncations. In contrast to the above-mentioned mouse model [22] we established transgenic rats overexpressing the longer truncation (del ex16).
Several attempts to obtain viable transgenic offspring overexpressing the second cTnT deletion mutation (del ex15/16) (Fig. 1) were unsuccessful. A high frequency of resorption and stillbirths was observed suggesting a lethal phenotype in the presence of cTnT protein lacking two exons. A lethal effect of del ex15/16 might be explained by the high transcriptional activity of the mlc-2 promoter during the embryonic period [25], which may have led to a toxic level of the transgene. In a transgenic mouse model overexpressing del ex15/16 under control of the
-MHC promoter viable heterozygous offspring was observed, whereas homozygous animals died soon after birth [22]. This might also be explained by a gene dosage effect due to the large increase of transcriptional activity of the
-MHC promoter after birth [39]. It can therefore be speculated that cTnT lacking both exons 15 and 16 exhibits a stronger dominant-negative effect compared to cTnT lacking only exon 16. Interestingly, it was recently reported [40] that both truncations confer a higher calcium sensitivity increasing the Ca-activated force generation in vitro. Since at present it is unknown which deletion mutation predominates in the myocardium of FHC patients carrying the intron 15 mutation it is important to establish that the longer cTnT-truncation also leads to contractile dysfunction.
Most cTnT mutations in FHC are associated with a high incidence of sudden death although little or no hypertrophy is found [9,10]. Since it is established that arrhythmic death in FHC patients frequently occurs on exertion [41], we subjected transgenic and control rats to daily physical exercise. In the group carrying the cTnT deletion sudden death and severe ventricular arrhythmias during the working heart performance were observed. Interestingly, focal myocardial disarray was only present in trained rats expressing the deletion mutation possibly acting as the arrhythmogenic substrate. The arrhythmogenic potential of the cTnT deletion mutation resembles the phenotype of human FHC.
The precise mechanism how these cTnT mutations cause cardiomyopathy on the molecular level is still poorly understood. A carboxyterminal deletion might alter the interaction with either
-tropomyosin or troponin I and troponin C or both, which all bind to the C-terminus of the troponin T molecule [42]. Furthermore, the cTnT truncation leads to the deletion of a phosphorylation site of possible importance for the regulation of ATPase activity [43].
A recently published in vitro study of several cTnT mutations in transfected quail myotubes found a reduction of maximal force but an increased unloaded shortening velocity [44]. The authors concluded that a shortened cross-bridge duty cycle may lead to increased energy demands of the myocardium, possibly resulting in energy depletion at higher levels of cardiac work. This hypothesis provides an explanation for typical features of cTnT associated FHC such as diastolic dysfunction and a high incidence of malignant arrhythmias even in the absence of significant hypertrophy.
4.3 Overexpression of wild-type cTnT leads to a gain of function
The findings in the transgenic rats overexpressing human wild-type cTnT were clearly different to those observed in rats overexpressing truncated human cTnT. First, a higher expression level (25–40% of endogenous rat cTnT) was observed in wild-type human cTnT rats. Secondly, there was a moderate but significant increase in heart to body weight ratio of 14% in 12–14-week-old and of 11% in 30–38-week-old rats. Thirdly, a markedly improved systolic and diastolic function was found with a significant increase in maximum dP/dt and time to peak pressure of 24% each and a change of minimum dP/dt, RT50 and RT90 of +20, –5 and –14%, respectively. Fourthly, no arrhythmias were observed in hearts of human wild-type cTnT transgenic rats subjected to physical training.
Thus, in contrast to rats expressing the truncated cTnT molecule, overexpression of human wild-type cTnT leads to myocardial hypertrophy and improved contractile performance without an increased incidence of arrhythmias.
Even in rats expressing 40% of total cTnT as human wild-type cTnT on Western blot analysis no identifiable increase of total cTnT mass could be observed. These findings suggest a tight regulation of sarcomere stoichiometry and are in accordance with a mouse model overexpressing a myosin binding protein c deletion [45]. In this transgenic model total myosin binding protein c mass was not elevated despite high (up to 60% of the endogenous protein) expression of the transgene.
Thus it is likely that the observed effects of transgenic human cTnT are caused by qualitative differences of human and rat cTnT. Though the overall homology on the amino acid level is very high (88.9%), several sequence variations between rat and human cTnT exist at the amino-terminal 72 amino acids. This region determines the antigenic differences of cardiac and skeletal muscle troponin T and is implicated in the regulation of myofilament activation [42]. Recently it could be shown that modifications of the NH2-terminus induced extensive conformational changes of the entire troponin T molecule [46]. It was proposed that the N-terminal region of the cTnT molecule might function to fine tune cross-bridge kinetics and calcium sensitivity [44]. These sequence differences might thus explain the functional distinctions between human and rat cTnT providing a possible explanation for the observed gain of function.
In summary, we generated the first transgenic rat model with typical features of human cTnT–FHC including diastolic dysfunction and a predisposition to ventricular arrhythmias. Since the human del ex16 mutation is incorporated into the sarcomere in vivo and exhibits its effects despite a low level of expression, a dominant-negative effect of the truncated protein is the likely pathomechanism. Similar to the human phenotype of cTnT–FHC contractile dysfunction could be observed in the absence of significant cardiac hypertrophy and fibrosis. The unexpected finding that overexpression of wild-type human cTnT leads to enhanced contractility associated with myocardial hypertrophy questions the hypothesis of a compensatory mechanism of hypertrophy at least in this model. This transgenic cTnT rat model may be useful to further investigate the molecular mechanisms of the FHC disease phenotype.
Time for primary review 35 days.
| Acknowledgements |
|---|
The authors are indebted to Sylvia Bark for excellent technical assistance. The authors thank Dr. J.J. Mercadier for kindly providing the cardiac troponin T cDNA. This work was supported by grants of the Deutsche Forschungsgemeinschaft to H.A.K. (493/3-1) and W.F. (SFB 320/B-6).
| Notes |
|---|
1 Current address: UT Southwestern Medical Center, Department of Mol. Biol., NA8.510, 6000 Harry Hines Blvd, Dallas, TX 75390, USA.
2 The first two authors contributed equally to this work. ![]()
| References |
|---|
|
|
|---|
- Geisterfer-Lowrance A.A., Kass S., Tanigawa G., et al. A molecular basis for familial hypertrophic cardiomyopathy: a beta cardiac myosin heavy chain gene missense mutation. Cell (1990) 62(5):999–1006.[CrossRef][Web of Science][Medline]
- Thierfelder L., Watkins H., MacRae C., et al.
-Tropomyosin and cardiac troponin T mutations cause familial hypertrophic cardiomyopathy: a disease of the sarcomere. Cell (1994) 77(5):701–712.[CrossRef][Web of Science][Medline] - Watkins H., Conner D., Thierfelder L., et al. Mutations in the cardiac myosin binding protein-C gene on chromosome 11 cause familial hypertrophic cardiomyopathy. Nat Genet (1995) 11(4):434–437.[CrossRef][Web of Science][Medline]
- Bonne G., Carrier L., Bercovici J., et al. Cardiac myosin binding protein-C gene splice acceptor site mutation is associated with familial hypertrophic cardiomyopathy. Nat Genet (1995) 11(4):438–440.[CrossRef][Web of Science][Medline]
- Kimura A., Harada H., Park J.E., et al. Mutations in the cardiac troponin I gene associated with hypertrophic cardiomyopathy. Nat Genet (1997) 16(4):379–382.[CrossRef][Web of Science][Medline]
- Poetter K., Jiang H., Hassanzadeh S., et al. Mutations in either the essential or regulatory light chains of myosin are associated with a rare myopathy in human heart and skeletal muscle. Nat Genet (1996) 13(1):63–69.[CrossRef][Web of Science][Medline]
- Mogensen J., Klausen I.C., Pedersen A.K., et al.
-Cardiac actin is a novel disease gene in familial hypertrophic cardiomypathy. J Clin Invest (1999) 103:R39–R43.[Medline] - Watkins H., Rosenzweig A., Hwang D.S., et al. Characteristics and prognostic implications of myosin missense mutations in familial hypertrophic cardiomyopathy. New Engl J Med (1992) 326(17):1108–1114.[Abstract]
- Watkins H., McKenna W., Thierfelder L., et al. Mutations in the genes for cardiac troponin T and
-tropomyosin in hypertrophic cardiomyopathy. New Engl J Med (1995) 332(16):1058–1064.[Abstract/Free Full Text] - Moolman J.C., Corfield V.A., Posen B., et al. Sudden death due to troponin T mutations. J Am Coll Cardiol (1997) 29(3):549–555.[Abstract]
- Koga Y., Toshima H., Kimura A., et al. Clinical manifestations of hypertrophic cardiomyopathy with mutations in the cardiac β-myosin heavy chain gene or cardiac troponin T gene. J Card Fail (1996) 2(4 Suppl):S97–103.[CrossRef][Medline]
- Forissier J.F., Carrier L., Farza H., et al. Codon 102 of the cardiac troponin T gene is a putative hot spot for mutations in familial hypertrophic cardiomyopathy. Circulation (1996) 94(12):3069–3073.
[Abstract/Free Full Text] - Nakajima-Taniguchi C., Matsui H., Fujio Y., Nagata S., Kishimoto T., Yamauchi-Takihara K. Novel missense mutation in cardiac troponin T gene found in Japanese patient with hypertrophic cardiomyopathy. J Mol Cell Cardiol (1997) 29(2):839–843.[CrossRef][Web of Science][Medline]
- Marian A.J., Yu Q.T., Mann D.L., Graham F.L., Roberts R. Expression of a mutation causing hypertrophic cardiomyopathy disrupts sarcomere assembly in adult feline cardiac myocytes. Circ Res (1995) 77(1):98–106.
[Abstract/Free Full Text] - Lankford E.B., Epstein N.D., Fananapazir L., Sweeney H.L. Abnormal contractile properties of muscle fibers expressing β-myosin heavy chain gene mutations in patients with hypertrophic cardiomyopathy. J Clin Invest (1995) 95(3):1409–1414.[Web of Science][Medline]
- Sweeney H.L., Straceski A.J., Leinwand L.A., Tikunov B.A., Faust L. Heterologous expression of a cardiomyopathic myosin that is defective in its actin interaction. J Biol Chem (1994) 269(3):1603–1605.
[Abstract/Free Full Text] - Geisterfer-Lowrance A.A., Christe M., Conner D.A., et al. A mouse model of familial hypertrophic cardiomyopathy. Science (1996) 272(5262):731–734.[Abstract]
- Vikstrom K.L., Factor S.M., Leinwand L.A. Mice expressing mutant myosin heavy chains are a model for familial hypertrophic cardiomyopathy. Mol Med (1996) 2(5):556–567.[Web of Science][Medline]
- Marian A.J., Zhao G., Seta Y., Roberts R., Yu Q.T. Expression of a mutant (Arg92Gln) human cardiac troponin T. known to cause hypertrophic cardiomyopathy, impairs adult cardiac myocyte contractility. Circ Res (1997) 81(1):76–85.
[Abstract/Free Full Text] - Oberst L., Zhao G., Park J.T., et al. Dominant-negative effect of a mutant cardiac troponin T on cardiac structure and function in transgenic mice. J Clin Invest (1998) 102(8):1498–1505.[Web of Science][Medline]
- Fyrberg E.C., Fyrberg C., Beall C., Saville D.L. Drosophila melanogaster troponin-T mutations engender three distinct syndromes of myofibrillar abnormalities. J Mol Biol (1990) 216(3):657–675.[CrossRef][Web of Science][Medline]
- Tardiff J.C., Factor S.M., Tompkins B.D., et al. A truncated cardiac troponin T molecule in transgenic mice suggests multiple cellular mechanisms for familial hypertrophic cardiomyopathy. J Clin Invest (1998) 101(12):2800–2811.[Web of Science][Medline]
- Ho S.N., Hunt H.D., Horton R.M., Pullen J.K., Pease L.R. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene (1989) 77(1):51–59.[CrossRef][Web of Science][Medline]
- Mesnard L.F., Samson F., Espinasse I., Durand J., Neveux J.Y., Mercadier J.J. Molecular cloning and developmental expression of human cardiac troponin T. Febs Lett (1993) 328(1–2):139–144.[CrossRef][Web of Science][Medline]
- Franz W.M., Breves D., Klingel K., Brem G., Hofschneider P.H., Kandolf R. Heart-specific targeting of firefly luciferase by the myosin light chain-2 promoter and developmental regulation in transgenic mice. Circ Res (1993) 73(4):629–638.
[Abstract/Free Full Text] - Boshart M.F., Weber F., Jahn G., et al. A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell (1985) 41(2):521–530.[CrossRef][Web of Science][Medline]
- Mullins J.J., Sigmund C.D., Kane-Haas C., Gross K.W., McGowan R.A. Expression of the DBA/2J Ren-2 gene in the adrenal gland of transgenic mice. Embo J (1989) 8(13):4065–4072.[Web of Science][Medline]
- Katus H.A., Remppis A., Looser S., Hallermeier K., Scheffold T., Kubler W. Enzyme-linked immunoassay of cardiac troponin T for the detection of acute myocardial infarction in patients. J Mol Cell Cardiol (1989) 21(12):1349–1353.[CrossRef][Web of Science][Medline]
- Haller C., Zehelein J., Remppis A., Muller-Bardorff M., Katus H.A. Cardiac troponin T in patients with end-stage renal disease: absence of expression in truncal skeletal muscle. Clin Chem (1998) 44(5):930–938.
[Abstract/Free Full Text] - Sen A., Dunnmon P., Henderson S.A., Gerard R.D., Chien K.R. Terminally differentiated neonatal rat myocardial cells proliferate and maintain specific differentiated functions following expression of SV40 large T antigen. J Biol Chem (1998) 263(35):19132–19136.
- Zehelein J., Remppis A., Scheffold T., Schröder A., Grünig E., Katus H.A. Enzymimmunoassay für kardiales Troponin I. Z Kardiol (1993) 82(Suppl_1):155. Abstract.[Web of Science][Medline]
- Neely J.R., Liebermeister H., Morgan H.E. Effect of pressure development on membrane transport of glucose in isolated rat heart. Am J Physiol (1967) 212(4):815–822.
[Free Full Text] - Krebs H.A., Henseleit K. Untersuchung über die Harnstoffbildung im Tierkörper. Hoppe-Seyler's Z Physiol Chem (1932) 210:33–66.[Web of Science]
- Fewell J.G., Osinska H., Klevitsky R., et al. A treadmill exercise regimen for identifying cardiovascular phenotypes in transgenic mice. Am J Physiol (1997) 273:H1595–H1605.[Web of Science][Medline]
- Rust E.M., Albayya F.P., Metzger J.M. Identification of a contractile deficit in adult cardiac myocytes expressing hypertrophic cardiomyopathy-associated mutant troponin T proteins. J Clin Invest (1999) 103:1459–1467.[Web of Science][Medline]
- Maron B.J., Spirito P., Green K.J., Wesley Y.E., Bonow R.O., Arce J. Noninvasive assessment of left ventricular diastolic function by pulsed Doppler echocardiography in patients with hypertrophic cardiomyopathy. J Am Coll Cardiol (1987) 10(4):733–742.[Abstract]
- Becker K.D., Gottshall K.R., Hickey R., Perriard J.C., Chien K.R. Point mutations in human β cardiac myosin heavy chain have differential effects on sarcomeric structure and assembly: an ATP binding site change disrupts both thick and thin filaments, whereas hypertrophic cardiomyopathy mutations display normal assembly. J Cell Biol (1997) 137(1):131–140.
[Abstract/Free Full Text] - Watkins H., Seidman C.E., Seidman J.G., Feng H.S., Sweeney H.L. Expression and functional assessment of a truncated cardiac troponin T that causes hypertrophic cardiomyopathy. Evidence for a dominant negative action. J Clin Invest (1996) 98(11):2456–2461.[Web of Science][Medline]
- Ng W.A., Grupp I.L., Subramaniam A., Robbins J. Cardiac myosin heavy chain mRNA expression and myocardial function in the mouse heart. Circ Res (1991) 68(6):1742–1750.
[Abstract/Free Full Text] - Nakaura H., Morimoto S., Yunaga F., et al. Functional changes in troponin T by a splice donor site mutation that causes hypertrophic cardiomyopathy. Am J Physiol (1999) 277:C225–232.[Web of Science][Medline]
- Maron B.J., Fananapazir L. Sudden cardiac death in hypertrophic cardiomyopathy. Circulation (1992) 85(1 Suppl):157–163.
- Palmiter K.A., Solaro R.J. Molecular mechanisms regulating the myofilament response to Ca2+: implications of mutations causal for familial hypertrophic cardiomyopathy. Basic Res Cardiol (1997) 92(Suppl 1):63–74.[CrossRef][Web of Science][Medline]
- Noland T.A., Kuo J.F. Protein kinase C phosphorylation of cardiac troponin I or troponin T inhibits Ca2+-stimulated actomyosin MgATPase activity. J Biol Chem (1991) 266(8):4974–4978.
[Abstract/Free Full Text] - Sweeney H.L., Feng H.S., Yang Z., Watkins H. Functional analyses of troponin T mutations that cause hypertrophic cardiomyopathy: insights into disease pathogenesis and troponin function. Proc Natl Acad Sci USA (1998) 95(24):14406–14410.
[Abstract/Free Full Text] - Yang Q., Sanbe A., Osinska H., Hewett T.E., Klevitsky R., Robbins J. A mouse model of myosin binding protein C human familial hypertrophic cardiomyopathy. J Clin Invest (1998) 102(7):1292–1300.[Web of Science][Medline]
- Wang J., Jin J.P. Conformational modulation of troponin T by configuration of the NH2-terminal variable region and functional effects. Biochemistry (1998) 37(41):14519–14528.[CrossRef][Web of Science][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





