Skip Navigation

Cardiovascular Research 2000 46(3):442-449; doi:10.1016/S0008-6363(00)00017-1
© 2000 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Huang, B.
Right arrow Articles by El-Sherif, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, B.
Right arrow Articles by El-Sherif, N.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2000, European Society of Cardiology

Reexpression of T-type Ca2+ channel gene and current in post-infarction remodeled rat left ventricle

Boyu Huang, Dayi Qin, Lili Deng, Mohamed Boutjdir and Nabil El-Sherif*

SUNY-Health Science Center, Cardiology Division, Box 1199, 450 Clarkson Avenue, Brooklyn, NY 11203 USA

* Corrersponding author. Tel.:+718-270-4106; fax: +718-630-3740 nelsherif{at}aol.com

Received 30 September 1999; accepted 10 January 2000


    Abstract
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
Objective: T-type Ca2+ currents (ICa-T) are present in neonatal rat myocytes but is not detected in adult ventricular myocytes. The present study was designed to investigate the expression of the T-type Ca2+ channel gene and current in post-infarction remodeled hypertrophied rat left ventricle (LV). Methods: We compared the expression of T-type Ca2+ channel gene {alpha}-1G in neonatal rat LV, in adult sham-operated LV and remodeled hypertrophied LV 3 to 4 weeks post-myocardial infarction (MI) using RNase protection assay (RPA). The cDNA fragment of {alpha}-1G used in RPA was obtained from poorly conserved region of recently published T-type Ca2+ channel coding sequence of rat by RT-PCR. The fragment was verified by restriction enzyme digestion and sequencing. The presence of ICa-T in LV of sham and post-MI rats was examined using patch-clamp techniques. In the presence of K+-free, Na+-free external solution, ICa-T was separated from ICa-L by different holding potentials (HP). ICa-T was also recorded during depolarization to –40 mV from a HP of –80 mV with NaCl in external solution and INa suppressed by 100 µM tetrodotoxin (TTX). Results: The T-type Ca2+ channel gene {alpha}-1G was expressed in neonatal heart, the expression level decreased by 80%, in adult sham heart and was reexpressed in MI (158% increases compared to sham; P<0.01). ICa-T was recorded in 11 of 31 MI cells in presence of K+-free, Na+-free external solution and in 9 of 14 cells when INa was suppressed by TTX. ICa-T was not detected in any of 21 sham cells. ICa-T density was 1.1±0.4 pA/pF. ICa-T was more sensitive to Ni2+ and less sensitive to nisoldipine. Conclusions: T-type Ca2+ channel gene and current are reexpressed in rat post-MI remodeled LV myocytes. Its functional significance in the post-MI remodeling process remains to be defined.

KEYWORDS Ca-channel; Infarction; Remodeling; Gene expression


This article is referred to in the Editorial by A. Elvan (pages 361–363) in this issue.


    1 Introduction
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
In contrast to neurons that can express up to six types of Ca2+ currents, cardiac myocytes express only L- and T-types [1]. While our knowledge of the structure and function of cardiac ICa-L has increased markedly over the last decade, only recently the structure of T-type channel has been identified [2,3]. Two T-type Ca2+ channel genes, {alpha}1G [2] and {alpha}1H [3] are expressed in rat and human cardiac myocytes, respectively. The functional contribution of ICa-T to both normal and pathophysiologic cardiac states is not fully explored. The presence and density of ICa-T varies in different cardiac tissue from various species. In general, ICa-T is scarce in cardiac ventricular myocytes from mature mammals [1]. In the rat, ICa-T is prominent in neonatal ventricular myocytes but is not detected in adult rat ventricular myocytes [4]. We have previously reported alterations in gene expression and sarcolemmal ion channels in the rat post-MI remodeled LV [5–9]. Some of the gene alterations in the non-infarcted hypertrophied LV myocytes represented reemergence of fetal isogene patterns [5,8,9]. In the present study we investigated the reexpression of {alpha}1G T-type Ca2+ channel gene and current in the rat post-MI LV. Preliminary date were previously reported [10,11].


    2 Methods
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
2.1 Experimental myocardial infarction
Two-month-old female Sprague–Dawley rats weighing 200–250 g were randomly divided into two groups and underwent either left anterior descending coronary artery ligation or sham operation. The operative procedure has been described previously [6]. All rats received standard care including ad libitum food and water and a 12-h day/night cycle. Experiments were performed 3–4 weeks after operation. The investigation conformed to the Guide for the Care and Use of Laboratory Animals published by the US National Institute of Health (NIH Publication No. 85–23, revised 1996).

2.2 Expression of T-type Ca2+ channel gene
The rats from each sham and post-MI experimental group were sacrificed 3–4 weeks post surgery. The animals were dissected and heart isolated. The right ventricle, left and right atrial appendages were carefully excised. For the post-MI experimental group the infarct region was carefully separated from the hypertrophied ventricle (including the septum) under a dissecting microscope. The neonatal rats were sacrificed at 3 and 7 days after birth. The left ventricular tissue was rinsed in saline to remove excess blood, snap-frozen in liquid nitrogen, and stored at –70°C. Total RNA was extracted from left ventricle or myocytes immediately or within 3 days frozen storage using the standard protocol of Chomczynski of homogenization in acid guanidinium thiocyanate followed by phenol–chloroform extraction and ethanol precipitation [12]. The amount of RNA recovered in each sample was determined spectrophotometrically at a wave length of 260 nm and the integrity of each sample was reconfirmed by analysis on a denaturing agarose gel.

2.2.1 Construction of DNA templates
DNA template of {alpha}-1G was prepared by subcloning small cDNA fragment of T-type Ca2+ channel into pCRTMII [Invitrogen]. The cDNA fragment was prepared by reverse transcription and PCR from total cellular RNA isolated from neonatal rat heart. Briefly, total cellular RNA was reverse transcribed to cDNA with RNase H reverse transcriptase using random or oligo (dT) primers [Stratagene]. cDNA obtained from 10 µg of total RNA was reverse transcribed with 0.1 µg of primers in 25 mmol/l Tris–HCl, pH 9.5 and 50 mmol/l KCl and 3U of Hot Tub DNA polymerase [Amersham]. The amplification reaction was run for 30 cycles at 91°C (2 min), 54°C (1 min), and 72°C (2 min), followed by a final extension period of 10 min at 72°C. PCR products were size separated on 1.2% agarose gel. The following sequences were used as primers: 284 bp: (nucleotides 5264–5547) [2] forward CTATGGCCATGGAACATTACC reverse CTTCAGAACTCGAGCAATGC.

2.2.2 RNase protection assay
RPAs were performed with cyclophilin as internal control [7,13]. The previously mentioned cDNA templates were used to prepare a 32P UTP antisense radiolabeled cRNA probes [MAXIscriptTM, Ambion]. To differentiate between the specifically protected region of the probe and any remaining undigested probe, all probes contain regions of plasmid sequence at one end of the transcript. Yeast tRNA (10 µg) were used as a negative control to test for the presence of probe self-complementation by intramolecular hybridization, resulting in smaller than expected protected bands. To account for the relatively greater abundance of internal control mRNA and to avoid saturation of autoradiography in hybridizations, the reaction was carried out in the presence of excess cold UTP (200 µmol/l for cyclophilin), rendering a probe with less specific activity. To obtain full length transcripts and lengthen the shelf life of the cRNA probes for T-type Ca2+ channel, transcription were done in the presence of 25 µmol/l cold UTP. All cRNA probes were purified prior to use over 5% polyacrylamide/8 mol/l urea gel. Concomitant hybridization of the two probes (1x104 cpm T-type Ca2+ channel cRNA and 1x104 cpm cyclophilin cRNA per 10 µg total RNA sample) were carried out at 50°C for 18 h followed by digestion with RNases A (250 U/ml) and T1 (10 000U/ml) [Ambion] at 37°C for 30 min. The reaction was terminated by the addition of SDS and Proteinase K followed by phenol–chloroform extraction and ethanol precipitation. The protected fragments were visualized by autoradiography after electrophoresis on a 5% polyacrylamide/8 mol/l urea gel. Quantitative evaluation was carried out using scanning densitometric analysis.

2.3 Recording of T-type Ca2+ current
Single cells were dissociated from left ventricle 3–4 weeks following experimental myocardial infarction or from sham-operated hearts. The methods used for whole-cell patch-clamp recordings were previously reported [6]. Capacitive currents were elicited by 10 mV depolarization pulses from –80 mV and calculated according to the following equation: Cm={tau}c·I0/{Delta}Em(1–I{infty}/I0), where Cm is membrane capacitance, {tau}c is the time constant of the membrane capacitance, I0 is maximum capacitance current value, {Delta}Em is the amplitude of voltage step, and I{infty} is the amplitude of steady state current [14]. Series resistance was calculated as {Delta}Em/I0. Membrane capacitance and series resistance were compensated.

Two protocols were utilized to record ICa-T. In the first protocol, Ca2+ current was recorded in K+-free Na+-free external solution, which contained (in mmol/l): choline chloride 120, CsCl 20, MgCl2 1, CaCl2 1.8, HEPES 10 and glucose 10 (pH 7.4 with Tris base). Pipette solution contained (in mmol/l) CsCl 130, Mg-ATP 5, Na2-CP 5, Na2-GTP 0.5, EGTA 10, CaCl2 0.062 and HEPES 10 (pH 7.2 with CsOH). Ca2+ currents were elicited at two holding potentials (HP). Depolarizations from an HP of –80 mV could elicit both ICa-T and ICa-L whereas depolarization from a HP of –50 mV could elicit only ICa-L [15–17]. The difference in current recordings obtained from the two conditioning potentials represented the ICa-T elicited at that test potential. Ca2+ currents were recorded during a depolarization pulse of 250 ms delivered every 10 s and increased in a step of 5 mV. On each cell, two HPs were executed: when HP was set at –80 mV the depolarization test pulse was in the range of –70 to +70 mV; when HP was –50 mV the depolarization test pulse was in the range of –45 to +70 mV.

In the second protocol, Ca2+ currents were recorded in the presence of 120 nM NaCl in external solution and tetrodotoxin (TTX-100 µM) was added to block INa. In some experiments Ca2+ channel blockers were used to characterize both ICa-T and ICa-L. Nisoldipine depresses primarily ICa-L while Nickel has higher affinity for ICa-T [18].

Data acquisition was performed using pCLAMP (Axon Instruments, Inc.). Recorded signals were sampled at 400–2500 Hz after being filtered at 3–5 kHz through a low-pass 8- pole Bessel filter (model 902, Frequency Devices Inc., Haverhill, Mass.). All recordings were obtained at room temperature (20–22°C). Recorded data were analyzed using pCLAMP (Axon Instruments, Inc.) and Excel (Microsoft Co.). Figures were plotted with Origin (Microcal Software, Inc.).

2.4 Statistical analysis
For comparisons of T-type Ca2+ channel gene expression between neonatal and sham or sham and post-MI LV myocardium the arbitrary densitometric units were normalized to the value of the cyclophilin gene and were statistically compared by one way ANOVA. The results were reproducible in two independent determinations. i.e., every sample pair had consistent changes in level of mRNA expression in the post-MI relative to sham experimental groups. Differences in the level of mRNA expression were considered significant at P<0.05 and dispersion from the mean was noted as mean±S.E.M. For analysis of ICa-T, data are presented as mean±S.E.M. Current amplitude, current density, and time constants were determined at different test potentials. Differences between groups were determined using t tests, with the Bonferonni correction applied to yield an experimental {alpha} level of P≤0.05.


    3 Results
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
3.1 Expression of T-type Ca2+ channel gene
Fig. 1 illustrates the expression of {alpha}-1G T-type Ca2+ channel gene in 3-day and 7-day neonatal rat LV myocardium and markedly reduced expression in adult rat LV myocardium. The expression level of the {alpha}-1G T-type Ca2+ channel gene was decreased by 80% (P<0.001) in adult sham compared to neonatal rats. Three to four weeks post-MI in the rat, the remodeled hypertrophied non-infarcted LV showed significant reexpression of T-type Ca2+ channel gene (158% increase in post-MI compared to sham; n=5, P<0.005).


Figure 1
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Expression of {alpha}-1G T-type Ca2+ channel gene in the 3 and 7 days neonatal, adult sham and post-MI rat left ventricular myocardium. (A) RNase protection analysis obtained with total RNA isolated from the LV of neonatal (n=6), adult sham (n=5) and post-MI (n=5) rats. Each lane contains 10 µg of total RNA. (B) Densitometric analysis of RNase protection assay. The bars represent means (±S.E.M.) mRNA levels (in arbitrary units) normalized to cyclophilin mRNA values.

 
3.2 T-type Ca2+ current
Ca2+ currents were recorded from 21 sham cells obtained from 5 sham-operated animals and 31 post-MI cells obtained from 7 post-MI animals in the presence of K+-free, Na+-free external solution. Cell membrane capacitance was 141±7 pF in sham cells and 224±11 pF in post-MI cells, which were similar to those reported previously from our laboratory [6]. ICa-T was not detected in any of the 21 adult rat LV myocytes from sham-operated animals (Fig. 2). On the other hand ICa-T was recorded in 11 out 31 post-MI LV myocytes (35.5%) including at least one myocyte from each of the 7 post-MI hearts that were studied. Fig. 3 illustrates Ca2+ current recordings and IV curves from a post-MI LV myocyte. The upper panel shows original tracings at HPs of –80 mV and –50 mV as well as their subtractions. In the lower panel, Ca2+ currents were plotted against the depolarization pulse. Recorded Ca2+ currents at HP of –50 mV were subtracted from those at HP of –80 mV. The subtracted IV relationship of ICa-T shows that the current starts to activate at –60 mV and reached peak at –35 mV. The activation time constant was 5.1±1.3 ms and the current decayed with a time constant of 10.2±2.5 ms. On the other hand, ICa-L has an activation time constant of 11.4±3.5 ms and a decay time constant of 66.5±17.9 ms. The averaged current amplitude of ICa-T was 0.2±0.08 nA with a normalized current density of 1.10±0.40 pA/pF. On the other hand, ICa-L averaged peak amplitude was 1.34±0.11 nA in sham cells and 1.96±0.11 nA in post-MI cells and normalized current density was 9.94±0.87 pA/pF in sham cells and 9.02±0.50 pA/pF in post-MI cells (NS). The ratio of current density of ICa-T to ICa-L was 0.11. The inset on the lower left corner of Fig. 3 illustrates a family of ICa-T currents below the threshold for ICa-L between –50 mV and –30 mV.


Figure 2
View larger version (12K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 IV relationship of ICa-L in a sham-operated left ventricular myocyte obtained in Na+-free solution. Depolarization protocol is illustrated at top. Panel A shows original recordings of Ca2+ currents at holding potential (HP) of –80 mV and –50 mV as well as current subtraction. Lower panel shows IV curves obtained at HP of –80 and –50 mV and their subtraction. Note absence of T-type Ca2+ current. The difference between the IV curves is due to slight run-down of ICa-L..

 

Figure 3
View larger version (13K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 IV relationship of ICa-L and ICa-T in a post-MI remodeled ventricular myocyte obtained in Na+-free solution. Depolarization protocol is illustrated at top. Panel A shows original recordings of Ca2+ currents at holding potential (HP) of –80 mV and –50 mV as well as current subtraction to isolate ICa-T. Lower panel shows IV curves obtained at HP of –80 and –50 mV and their subtraction. The inset on the lower left corner illustrates a family of ICa-T currents below the threshold for ICa-L between –50 mV and –30 mV.

 
Fig. 4 illustrates recordings of ICa-L, INa, and ICa-T obtained from the same post-MI myocyte. Utilizing different HP and an external solution containing NaCl 120 mM+CsCl 20 mM. Panel A illustrates typical ICa-L recorded during depolarization from –40 to 0 mV. In panel B, a large INa was elicited during depolarization to –40 mV from an HP of –80 mV. In panel C, 100 µM TTX was added to the external solution to inhibit INa. Depolarization from –80 to –40 mV revealed a current consistent ICa-T with an amplitude of 0.46 nA that decayed with a time constant of 10.2 ms. Panel D illustrates the IV curve of the TTX-resistant current. Utilizing the TTX protocol, ICa-T was recorded in 9 out of 14 cells obtained from 3 post-MI animals. No ICa-T was recorded from sham operated animal (13 cells obtained from 3 animals). The average current density of 1.1±0.13 pA/pF was similar to that obtained in the presence of Na+-free external solution.


Figure 4
View larger version (10K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Recordings of ICa-L, INa, and ICa-T obtained from the same post-MI myocyte. The external solution contained NaCl 120 mM+CsCl 20 mM. In A, a typical ICa-L current was recorded during depolarization to 0 mV from a holding potential (HP) of –40 mV. In B, a large INa was recorded during depolarization to –40 mV from an HP of –80 mV. Note the rapid activation and inactivation of the current. In C, 100 µM TTX was added to the external solution to suppress INa, and a small current consistent with ICa-T was recorded. Panel D illustrates IV curve of the TTX-resistant current.

 
3.3 Pharmacologic characterization of Ca2+ currents
We used nisoldipine and nickel to illustrate the differential responses of ICa-L and ICa-T. Fig. 5, panels A and B illustrate the effects of nisoldipine (1 µmol/l). The drug resulted in 69% suppression of ICa-L (range 62–85%, n=5). On the other hand, ICa-T was only minimally affected (decreased by 6%, range 4–10%, n=5). Fig. 5, panels C and D show that NiCl2 (100 µmol/l) markedly decreased ICa-T by 87% (range 79–92%, n=4) but only slightly depressed ICa-L (decreased by 18%, range 10–23%, n=4).


Figure 5
View larger version (12K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Differential effects of nisoldipine (panel A, B) and NiCl2 (panel C, D) on ICa-L and ICa-T. The depolarization protocol is illustrated at top. Original recording of Ca2+ currents and IV curves at HP –80 mV before and after drugs are shown. ICa-T was less sensitive to nisoldipine and more sensitive to NiCl2 compared to ICa-L.

 

    4 Discussion
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
We have shown that the T-type Ca2+ channel gene {alpha}-1G and ICa-T are reexpressed in rat post-MI remodeled non-infarcted LV. The insensitivity of the current to TTX differentiates it from the TTX sensitive Ca2+ current described in normal adult rat ventricular myocytes [19]. The reexpression of T-type Ca2+ channel gene is consistent with previously reported gene alterations in rat post-MI LV that represent reemergence of fetal/neonatal isogene patterns. These included reexpression of fetal isogene forms of myosin heavy chain [9], Na-KATPase [9], L-type Ca2+ current [5] and Na+ channel subtype [8].

ICa-T was recorded from some, but not from all ventricular myocytes obtained from rat post-MI LV. On the other hand, LV tissue obtained from sham operated adult rats showed slight expression of the T-type Ca2+ channel {alpha}-1G but no ICa-T current could be recorded from isolated normal LV myocytes. These observations may suggest that a critical level of expression of T-type Ca2+ channel gene is necessary for the ability to detect ICa-T in isolated myocytes. However, other interpretations of our observations could be cited. It is possible that a relationship exists between the degree of myocyte hypertrophy and the expression of T-type Ca2+ channel gene and current. For example, it was suggested that the density of ICa-L could be related to the degree and stage of cardiac hypertrophy [20]. In the present study, however, there was no clear correlation between the LV myocyte estimated capacitance and the ability to record ICa-T. It is also possible that the reexpression of T-type Ca2+ channel gene and current is LV region-specific (i.e. epicardial vs. midmyocardial vs. endocardial regions of the LV) as is the case of some of the K+ channel genes [21] and currents [22]. This possibility was not addressed in the present study.

In contrast to ICa-L, the physiological functions of cardiac ICa-T are not clearly defined. In addition to a putative contribution to automaticity in adult cardiac tissue [23], ICa-T seems to be associated with rapid postnatal growth and hypertrophy. There is growing evidence that T-type Ca2+ channels modulate the responses to various hypertrophic signals [1]. ICa-T is scarce in mammalian adult atrial and ventricular myocytes. ICa-T is reexpressed in atrial myocytes from adult rats with growth hormone-secreting tumors [24]. A similar increase follows exposure of ventricular cells to insulin-like growth factor 1 (IGF-1) in short time primary culture of myocytes [25]. ICa-T is reexpressed in adult feline LV with pressure-overload induced hypertrophy [17], and in a genetically determined Cardiomyopathic Syrian hamster which develops progressive congestive heart failure [26]. In the latter model ICa-T had a 2–3 fold higher density than in normal cells and displayed abnormal activation and inactivation kinetics. It was suggested that the alterations in ICa-T contributed to Ca2+ overload and to arrhythmogenesis in this model [26]. Recently a T-type Ca2+ channel was reported to be expressed in ventricular myocytes from rats with pressure-overload hypertrophy [27]. Further, the T-type Ca2+ channel blocker, mibefradil was recently reported to prevent the development of a substrate for atrial fibrillation by tachycardia-induced atrial remodeling in dogs [28].

We have previously shown that myocytes from 3 to 5 week-old post-MI remodeled rat LV had prolonged action potential duration that was attributed primarily to downregulation of key K+ channel genes [7] and currents [6] while the L-type Ca2+ channel gene [5] and current [6] were not different from control. These myocytes were also shown to generate both early and delayed afterdepolarizations [6]. Although the ICa-T density is smaller compared to that of ICa-L, it is possible that slight augmentation of intracellular Ca2+ at certain phases of action potential can predispose to abnormal afterdepolarizations. Vassort and Alvarez [18] have suggested that a bimodel voltage dependency of T-type Ca2+ channel availability can result in an inward current that flows at two ranges of potential and that such a current might be involved in both early and late afterdepolarization as well as abnormal automaticity. However, an arrhythmogenic potential of reexpressed T-type Ca2+ channel gene and current in the post-MI remodeled rat heart remains to be demonstrated.

Data on the benefit of ICa-T antagonist in experimental models are sparse. The selective ICa-T antagonist, mibefradil was shown to improve survival in a rat model of chronic heart failure compared to the ICa-L antagonist amlodipine [29]. Mibefradil has been introduced in clinical trials for the treatment of hypertension and angina pectoris [30] even though it was recently withdrawn from clinical application. The beneficial effects were attributed to a potent coronary and peripheral vasodilation [30]. So far, no significant ICa-T has been detected in atrial and ventricular cells isolated from human tissues with various pathophysiologic states including heart failure and cardiomyopathy [31,32]. The recent identification of genes encoding T-type Ca2+ channels in the heart [2,3] would make it easier to readdress the functional contribution of cardiac T-type Ca2+ channel(s) to both normal and pathophysiologic states and the mechanisms of potential action of selective ICa-T antagonists.

Time for primary review 29 days.


    Acknowledgements
 
Supported in part by Veterans Administration Medical Research Funds.


    References
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 

  1. Richard S., Leclercq F., Lemaire S., Piot C., Nargeot J. Ca2+ currents in compensated hypertrophy and heart failure. Cardiovasc. Res. (1998) 37(2):300–311.[Abstract/Free Full Text]
  2. Perez-Reyes E., Cribbs L.L., Daud A., et al. Molecular characterization of a neuronal low-voltage-activated T-type calcium channel. Nature (1998) 391:896–900.[CrossRef][Medline]
  3. Cribbs L.L., Lee J.H., Yang J., et al. Cloning and characterization of {alpha}1H from human heart, a member of the T-type Ca2+ channel gene family. Circ. Res. (1998) 83(1):103–109.[Abstract/Free Full Text]
  4. Furukawa T., Ito H., Nitta J., et al. Endothelin-1 enhances calcium entry through T-type calcium channels in cultured neonatal rat ventricular myocytes. Circ. Res. (1992) 71(5):1242–1253.[Abstract/Free Full Text]
  5. Gidh-Jain M., Huang B., Jain P., Battula V., El-Sherif N. Reemergence of the fetal pattern of L-type calcium channel gene expression in non infarcted myocardium during left ventricular remodeling. Biochem. Biophys. Res. Commun. (1995) 216:892–897.[CrossRef][Web of Science][Medline]
  6. Qin D., Zhang Z-H., Boutjdir M., Jain P., El-Sherif N. Cellular and ionic basic of arrhythmias in post-infarction remodeled ventricular myocardium. Circ Res (1996) 79:461–473.[Abstract/Free Full Text]
  7. Gidh-Jain M., Huang B., Jain P., El-Sherif N. Differential expression of voltage-gated K+ channel genes in left ventricular remodeled myocardium after experimental myocardial infarction. Circ. Res. (1996) 79:669–675.[Abstract/Free Full Text]
  8. Huang B., Gidh-Jain M., Jain P., El-Sherif N. Changes in the expression of the sarcolemmal sodium channel subtypes in rat ventricle after myocardial infarction. Biophys. J. (1997) 72(2):A33.
  9. Gidh-Jain M., Huang B., Jain P., El-Sherif N. Alterations in cardiac gene expression during transition to compensated hypertrophy following myocardial infarction. J. Mol. Cell Cardiol. (1998) 30:627–737.[CrossRef][Web of Science][Medline]
  10. Qin D., Jain P., Boutjdir M., El-Sherif N. Expression of T-type calcium current in remodeled hypertrophied left ventricle from adult rat following myocardial infarction. Circulation (1995) 92:I 587. Abstract.
  11. Huang B., Deng L., Qin D., Boutjdir M., El-Sherif N. Reexpression of T-type Ca2+ channel gene and current in post-infarction remodeled rat left ventricle. Circulation (1998) 98:I 840. Abstract.
  12. Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem (1987) 162:156–159.[Web of Science][Medline]
  13. Danielson P., Forss-Petter S., Brow M., et al. p1B15: a cDNA clone of the rat mRNA encoding cyclophilin. DNA (1988) 7:261–267.[Web of Science][Medline]
  14. Reuter H., Scholz H. A study of the ion selectivity and the kinetic properties of the calcium dependent slow inward current in mammalian cardiac muscle. J. Physiol. (Lond) (1977) 264(1):17–47.[Abstract/Free Full Text]
  15. Tseng G.N., Boyden P.A. Different effects of intracellular Ca and protein kinase C on cardiac T and L Ca currents. Am. J. Physiol. (1991) 261(2 Pt 2):H364–H379.[Web of Science][Medline]
  16. Balke C.W., Rose W.C., Marban E., Wier W.G. Macroscopic and unitary properties of physiological ion flux through T-type Ca2+ channels in guinea-pig heart cells. J. Physiol. (Lond) (1992) 456:247–265.[Abstract/Free Full Text]
  17. Nuss H.B., Houser S.R. T-type Ca2+ current is expressed in hypertrophied adult feline left ventricular myocytes. Circ. Res. (1993) 73(4):777–782.[Abstract/Free Full Text]
  18. Vassort G., Alvarez J. Cardiac T-type calcium current: pharmacology and roles in cardiac tissues. J. Cardiovasc. Electrophysiol. (1994) 5(4):376–393.[Web of Science][Medline]
  19. Aggarwal R., Shorofsky S.R., Goldman L., Balke C.W. Tetrodotoxin-blockable calcium currents in rat ventricular myocytes; a third type of cardiac cell sodium current. J. Physiol. (Lond) (1997) 505(Pt 2):353–369.[Abstract/Free Full Text]
  20. Hart G. Cellular electrophysiology in cardiac hypertrophy and failure. Circ. Res. (1994) 28:933–946.
  21. Dixon J.E., McKinnon D. Quantitative analysis of potassium channel mRNA expression in atrial and ventricular muscle of rats. Circ. Res. (1994) 75:252–260.[Abstract/Free Full Text]
  22. Antzelevitch C., Sicouri S., Litovsky S.H., et al. Heterogeneity within the ventricular wall: electrophysiology and pharmacology of epicardial, endocardial, and M cells. Circ. Res. (1991) 69:1427–1449.[Free Full Text]
  23. Hagiwara N., Irisawa H., Kameyama M. Contribution of two types of calcium currents to the pacemaker potentials of rabbit sino-atrial node cells. J. Physiol. (Lond) (1988) 395:233–253.[Abstract/Free Full Text]
  24. Xu X.P., Best P.M. Increase in T-type calcium current in atrial myocytes from adult rats with growth hormone-secreting tumors. Proc. Natl. Acad. Sci. USA (1990) 87(12):4655–4659.[Abstract/Free Full Text]
  25. Fares N., Gomez J.P., Potreau D. T-type calcium current is expressed in dedifferentiated adult rat ventricular cells in primary culture. C R Acad Sci III (1996) 319(7):569–576.[Medline]
  26. Sen L., Smith T.W. T-type Ca2+ channels are abnormal in genetically determined cardiomyopathic hamster hearts. Circ. Res. (1994) 75(1):149–155.[Abstract/Free Full Text]
  27. Martinez M.L., Heredia M.P., Delgado C. Expression of T-type Ca2+ channels in ventricular cells from hypertrophied rat hearts. J. Mol. Cell Cardiol. (1999) 19:1617–1625.
  28. Fareh S., Benardeau A., Thibault B., Nattel S. The T-type Ca2+ channel blocker mibefradil prevents the development of a substrate for atrial fibrillation by tachycardia-induced atrial remodeling in dogs. Circulation (1999) 100:2191–2197.[Abstract/Free Full Text]
  29. Mulder P., Richard V., Compagnon P., et al. Increased survival after long-term treatment with mibefradil, a selective T-channel calcium antagonist, in heart failure. J. Am. Coll. Cardiol. (1997) 29(2):416–421.[Abstract]
  30. Kobrin I., Bieska G., Charlon V., Lindberg E., Pordy R. Anti-anginal and anti-ischemic effects of mibefradil, a new T-type calcium channel antagonist. Cardiology (1998) 89(Suppl_1):23–32.[CrossRef][Web of Science][Medline]
  31. Beuckelmann D.J., Nabauer M., Erdmann E. Characteristics of calcium-current in isolated human ventricular myocytes from patients with terminal heart failure. J. Mol. Cell Cardiol. (1991) 23(8):929–937.[CrossRef][Web of Science][Medline]
  32. Mewes T., Ravens U. L-type calcium currents of human myocytes from ventricle of non-failing and failing hearts and from atrium. J. Mol. Cell Cardiol. (1994) 26(10):1307–1320.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol. Pharmacol.Home page
R.-S. Chen and P. M. Best
A Small Peptide Inhibitor of the Low Voltage-Activated Calcium Channel Cav3.1
Mol. Pharmacol., May 1, 2009; 75(5): 1042 - 1051.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
C.-S. Chiang, C.-H. Huang, H. Chieng, Y.-T. Chang, D. Chang, J.-J. Chen, Y.-C. Chen, Y.-H. Chen, H.-S. Shin, K. P. Campbell, et al.
The CaV3.2 T-Type Ca2+ Channel Is Required for Pressure Overload-Induced Cardiac Hypertrophy in Mice
Circ. Res., February 27, 2009; 104(4): 522 - 530.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
N. Jaleel, H. Nakayama, X. Chen, H. Kubo, S. MacDonnell, H. Zhang, R. Berretta, J. Robbins, L. Cribbs, J. D. Molkentin, et al.
Ca2+ Influx Through T- and L-Type Ca2+ Channels Have Different Effects on Myocyte Contractility and Induce Unique Cardiac Phenotypes
Circ. Res., November 7, 2008; 103(10): 1109 - 1119.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. F. Rossier, S. Lenglet, L. Vetterli, M. Python, and A. Maturana
Corticosteroids and Redox Potential Modulate Spontaneous Contractions in Isolated Rat Ventricular Cardiomyocytes
Hypertension, October 1, 2008; 52(4): 721 - 728.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. F. Heubach, E. M. Graf, J. Leutheuser, M. Bock, B. Balana, I. Zahanich, T. Christ, S. Boxberger, E. Wettwer, and U. Ravens
Electrophysiological properties of human mesenchymal stem cells
J. Physiol., February 1, 2004; 554(3): 659 - 672.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Huang, B.
Right arrow Articles by El-Sherif, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, B.
Right arrow Articles by El-Sherif, N.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?