Cardiovascular Research

Cardiovascular Research 2000 46(3):442-449; doi:10.1016/S0008-6363(00)00017-1
© 2000 by European Society of Cardiology

This Article Abstract FREE Full Text (PDF) E-letters: Submit a response Alert me when this article is cited Alert me when E-letters are posted Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Request Permissions Disclaimer Google Scholar Articles by Huang, B. Articles by El-Sherif, N. Search for Related Content PubMed PubMed Citation Articles by Huang, B. Articles by El-Sherif, N. Social Bookmarking          What's this?

Copyright © 2000, European Society of Cardiology

Reexpression of T-type Ca²⁺ channel gene and current in post-infarction remodeled rat left ventricle

Boyu Huang, Dayi Qin, Lili Deng, Mohamed Boutjdir and Nabil El-Sherif^*

SUNY-Health Science Center, Cardiology Division, Box 1199, 450 Clarkson Avenue, Brooklyn, NY 11203 USA

^* Corrersponding author. Tel.:+718-270-4106; fax: +718-630-3740 nelsherif{at}aol.com

Received 30 September 1999; accepted 10 January 2000

	Abstract

Top Abstract 1 Introduction 2 Methods 3 Results 4 Discussion References

 
Objective: T-type Ca²⁺ currents (I_Ca-T) are present in neonatal rat myocytes but is not detected in adult ventricular myocytes. The present study was designed to investigate the expression of the T-type Ca²⁺ channel gene and current in post-infarction remodeled hypertrophied rat left ventricle (LV). Methods: We compared the expression of T-type Ca²⁺ channel gene -1G in neonatal rat LV, in adult sham-operated LV and remodeled hypertrophied LV 3 to 4 weeks post-myocardial infarction (MI) using RNase protection assay (RPA). The cDNA fragment of -1G used in RPA was obtained from poorly conserved region of recently published T-type Ca²⁺ channel coding sequence of rat by RT-PCR. The fragment was verified by restriction enzyme digestion and sequencing. The presence of I_Ca-T in LV of sham and post-MI rats was examined using patch-clamp techniques. In the presence of K⁺-free, Na⁺-free external solution, I_Ca-T was separated from I_Ca-L by different holding potentials (HP). I_Ca-T was also recorded during depolarization to –40 mV from a HP of –80 mV with NaCl in external solution and I_Na suppressed by 100 µM tetrodotoxin (TTX). Results: The T-type Ca²⁺ channel gene -1G was expressed in neonatal heart, the expression level decreased by 80%, in adult sham heart and was reexpressed in MI (158% increases compared to sham; P<0.01). I_Ca-T was recorded in 11 of 31 MI cells in presence of K⁺-free, Na⁺-free external solution and in 9 of 14 cells when I_Na was suppressed by TTX. I_Ca-T was not detected in any of 21 sham cells. I_Ca-T density was 1.1±0.4 pA/pF. I_Ca-T was more sensitive to Ni²⁺ and less sensitive to nisoldipine. Conclusions: T-type Ca²⁺ channel gene and current are reexpressed in rat post-MI remodeled LV myocytes. Its functional significance in the post-MI remodeling process remains to be defined.

KEYWORDS Ca-channel; Infarction; Remodeling; Gene expression

---

This article is referred to in the Editorial by A. Elvan (pages 361–363) in this issue.

	1 Introduction

Top Abstract 1 Introduction 2 Methods 3 Results 4 Discussion References

 
In contrast to neurons that can express up to six types of Ca²⁺ currents, cardiac myocytes express only L- and T-types [1]. While our knowledge of the structure and function of cardiac I_Ca-L has increased markedly over the last decade, only recently the structure of T-type channel has been identified [2,3]. Two T-type Ca²⁺ channel genes, 1G [2] and 1H [3] are expressed in rat and human cardiac myocytes, respectively. The functional contribution of I_Ca-T to both normal and pathophysiologic cardiac states is not fully explored. The presence and density of I_Ca-T varies in different cardiac tissue from various species. In general, I_Ca-T is scarce in cardiac ventricular myocytes from mature mammals [1]. In the rat, I_Ca-T is prominent in neonatal ventricular myocytes but is not detected in adult rat ventricular myocytes [4]. We have previously reported alterations in gene expression and sarcolemmal ion channels in the rat post-MI remodeled LV [5–9]. Some of the gene alterations in the non-infarcted hypertrophied LV myocytes represented reemergence of fetal isogene patterns [5,8,9]. In the present study we investigated the reexpression of 1G T-type Ca²⁺ channel gene and current in the rat post-MI LV. Preliminary date were previously reported [10,11].

	2 Methods

Top Abstract 1 Introduction 2 Methods 3 Results 4 Discussion References

 
2.1 Experimental myocardial infarction
Two-month-old female Sprague–Dawley rats weighing 200–250 g were randomly divided into two groups and underwent either left anterior descending coronary artery ligation or sham operation. The operative procedure has been described previously [6]. All rats received standard care including ad libitum food and water and a 12-h day/night cycle. Experiments were performed 3–4 weeks after operation. The investigation conformed to the Guide for the Care and Use of Laboratory Animals published by the US National Institute of Health (NIH Publication No. 85–23, revised 1996).

2.2 Expression of T-type Ca²⁺ channel gene
The rats from each sham and post-MI experimental group were sacrificed 3–4 weeks post surgery. The animals were dissected and heart isolated. The right ventricle, left and right atrial appendages were carefully excised. For the post-MI experimental group the infarct region was carefully separated from the hypertrophied ventricle (including the septum) under a dissecting microscope. The neonatal rats were sacrificed at 3 and 7 days after birth. The left ventricular tissue was rinsed in saline to remove excess blood, snap-frozen in liquid nitrogen, and stored at –70°C. Total RNA was extracted from left ventricle or myocytes immediately or within 3 days frozen storage using the standard protocol of Chomczynski of homogenization in acid guanidinium thiocyanate followed by phenol–chloroform extraction and ethanol precipitation [12]. The amount of RNA recovered in each sample was determined spectrophotometrically at a wave length of 260 nm and the integrity of each sample was reconfirmed by analysis on a denaturing agarose gel.

2.2.1 Construction of DNA templates
DNA template of -1G was prepared by subcloning small cDNA fragment of T-type Ca²⁺ channel into pCR^TMII [Invitrogen]. The cDNA fragment was prepared by reverse transcription and PCR from total cellular RNA isolated from neonatal rat heart. Briefly, total cellular RNA was reverse transcribed to cDNA with RNase H^– reverse transcriptase using random or oligo (dT) primers [Stratagene]. cDNA obtained from 10 µg of total RNA was reverse transcribed with 0.1 µg of primers in 25 mmol/l Tris–HCl, pH 9.5 and 50 mmol/l KCl and 3U of Hot Tub DNA polymerase [Amersham]. The amplification reaction was run for 30 cycles at 91°C (2 min), 54°C (1 min), and 72°C (2 min), followed by a final extension period of 10 min at 72°C. PCR products were size separated on 1.2% agarose gel. The following sequences were used as primers: 284 bp: (nucleotides 5264–5547) [2] forward CTATGGCCATGGAACATTACC reverse CTTCAGAACTCGAGCAATGC.

2.2.2 RNase protection assay
RPAs were performed with cyclophilin as internal control [7,13]. The previously mentioned cDNA templates were used to prepare a ³²P UTP antisense radiolabeled cRNA probes [MAXIscript^TM, Ambion]. To differentiate between the specifically protected region of the probe and any remaining undigested probe, all probes contain regions of plasmid sequence at one end of the transcript. Yeast tRNA (10 µg) were used as a negative control to test for the presence of probe self-complementation by intramolecular hybridization, resulting in smaller than expected protected bands. To account for the relatively greater abundance of internal control mRNA and to avoid saturation of autoradiography in hybridizations, the reaction was carried out in the presence of excess cold UTP (200 µmol/l for cyclophilin), rendering a probe with less specific activity. To obtain full length transcripts and lengthen the shelf life of the cRNA probes for T-type Ca²⁺ channel, transcription were done in the presence of 25 µmol/l cold UTP. All cRNA probes were purified prior to use over 5% polyacrylamide/8 mol/l urea gel. Concomitant hybridization of the two probes (1x10⁴ cpm T-type Ca²⁺ channel cRNA and 1x10⁴ cpm cyclophilin cRNA per 10 µg total RNA sample) were carried out at 50°C for 18 h followed by digestion with RNases A (250 U/ml) and T1 (10 000U/ml) [Ambion] at 37°C for 30 min. The reaction was terminated by the addition of SDS and Proteinase K followed by phenol–chloroform extraction and ethanol precipitation. The protected fragments were visualized by autoradiography after electrophoresis on a 5% polyacrylamide/8 mol/l urea gel. Quantitative evaluation was carried out using scanning densitometric analysis.

2.3 Recording of T-type Ca²⁺ current
Single cells were dissociated from left ventricle 3–4 weeks following experimental myocardial infarction or from sham-operated hearts. The methods used for whole-cell patch-clamp recordings were previously reported [6]. Capacitive currents were elicited by 10 mV depolarization pulses from –80 mV and calculated according to the following equation: C_m=_c·I₀/E_m(1–I/I₀), where C_m is membrane capacitance, _c is the time constant of the membrane capacitance, I₀ is maximum capacitance current value, E_m is the amplitude of voltage step, and I is the amplitude of steady state current [14]. Series resistance was calculated as E_m/I₀. Membrane capacitance and series resistance were compensated.

Two protocols were utilized to record I_Ca-T. In the first protocol, Ca²⁺ current was recorded in K⁺-free Na⁺-free external solution, which contained (in mmol/l): choline chloride 120, CsCl 20, MgCl₂ 1, CaCl₂ 1.8, HEPES 10 and glucose 10 (pH 7.4 with Tris base). Pipette solution contained (in mmol/l) CsCl 130, Mg-ATP 5, Na₂-CP 5, Na₂-GTP 0.5, EGTA 10, CaCl₂ 0.062 and HEPES 10 (pH 7.2 with CsOH). Ca²⁺ currents were elicited at two holding potentials (HP). Depolarizations from an HP of –80 mV could elicit both I_Ca-T and I_Ca-L whereas depolarization from a HP of –50 mV could elicit only I_Ca-L [15–17]. The difference in current recordings obtained from the two conditioning potentials represented the I_Ca-T elicited at that test potential. Ca²⁺ currents were recorded during a depolarization pulse of 250 ms delivered every 10 s and increased in a step of 5 mV. On each cell, two HPs were executed: when HP was set at –80 mV the depolarization test pulse was in the range of –70 to +70 mV; when HP was –50 mV the depolarization test pulse was in the range of –45 to +70 mV.

In the second protocol, Ca²⁺ currents were recorded in the presence of 120 nM NaCl in external solution and tetrodotoxin (TTX-100 µM) was added to block I_Na. In some experiments Ca²⁺ channel blockers were used to characterize both I_Ca-T and I_Ca-L. Nisoldipine depresses primarily I_Ca-L while Nickel has higher affinity for I_Ca-T [18].

Data acquisition was performed using pCLAMP (Axon Instruments, Inc.). Recorded signals were sampled at 400–2500 Hz after being filtered at 3–5 kHz through a low-pass 8- pole Bessel filter (model 902, Frequency Devices Inc., Haverhill, Mass.). All recordings were obtained at room temperature (20–22°C). Recorded data were analyzed using pCLAMP (Axon Instruments, Inc.) and Excel (Microsoft Co.). Figures were plotted with Origin (Microcal Software, Inc.).

2.4 Statistical analysis
For comparisons of T-type Ca²⁺ channel gene expression between neonatal and sham or sham and post-MI LV myocardium the arbitrary densitometric units were normalized to the value of the cyclophilin gene and were statistically compared by one way ANOVA. The results were reproducible in two independent determinations. i.e., every sample pair had consistent changes in level of mRNA expression in the post-MI relative to sham experimental groups. Differences in the level of mRNA expression were considered significant at P<0.05 and dispersion from the mean was noted as mean±S.E.M. For analysis of I_Ca-T, data are presented as mean±S.E.M. Current amplitude, current density, and time constants were determined at different test potentials. Differences between groups were determined using t tests, with the Bonferonni correction applied to yield an experimental level of P0.05.

	3 Results

Top Abstract 1 Introduction 2 Methods 3 Results 4 Discussion References

 
3.1 Expression of T-type Ca²⁺ channel gene
Fig. 1 illustrates the expression of -1G T-type Ca²⁺ channel gene in 3-day and 7-day neonatal rat LV myocardium and markedly reduced expression in adult rat LV myocardium. The expression level of the -1G T-type Ca²⁺ channel gene was decreased by 80% (P<0.001) in adult sham compared to neonatal rats. Three to four weeks post-MI in the rat, the remodeled hypertrophied non-infarcted LV showed significant reexpression of T-type Ca²⁺ channel gene (158% increase in post-MI compared to sham; n=5, P<0.005).

View larger version (20K): [in this window] [in a new window] [Download PowerPoint slide]   Fig. 1 Expression of -1G T-type Ca2+ channel gene in the 3 and 7 days neonatal, adult sham and post-MI rat left ventricular myocardium. (A) RNase protection analysis obtained with total RNA isolated from the LV of neonatal (n=6), adult sham (n=5) and post-MI (n=5) rats. Each lane contains 10 µg of total RNA. (B) Densitometric analysis of RNase protection assay. The bars represent means (±S.E.M.) mRNA levels (in arbitrary units) normalized to cyclophilin mRNA values.

 
3.2 T-type Ca²⁺ current
Ca²⁺ currents were recorded from 21 sham cells obtained from 5 sham-operated animals and 31 post-MI cells obtained from 7 post-MI animals in the presence of K⁺-free, Na⁺-free external solution. Cell membrane capacitance was 141±7 pF in sham cells and 224±11 pF in post-MI cells, which were similar to those reported previously from our laboratory [6]. I_Ca-T was not detected in any of the 21 adult rat LV myocytes from sham-operated animals (Fig. 2). On the other hand I_Ca-T was recorded in 11 out 31 post-MI LV myocytes (35.5%) including at least one myocyte from each of the 7 post-MI hearts that were studied. Fig. 3 illustrates Ca²⁺ current recordings and I–V curves from a post-MI LV myocyte. The upper panel shows original tracings at HPs of –80 mV and –50 mV as well as their subtractions. In the lower panel, Ca²⁺ currents were plotted against the depolarization pulse. Recorded Ca²⁺ currents at HP of –50 mV were subtracted from those at HP of –80 mV. The subtracted I–V relationship of I_Ca-T shows that the current starts to activate at –60 mV and reached peak at –35 mV. The activation time constant was 5.1±1.3 ms and the current decayed with a time constant of 10.2±2.5 ms. On the other hand, I_Ca-L has an activation time constant of 11.4±3.5 ms and a decay time constant of 66.5±17.9 ms. The averaged current amplitude of I_Ca-T was 0.2±0.08 nA with a normalized current density of 1.10±0.40 pA/pF. On the other hand, I_Ca-L averaged peak amplitude was 1.34±0.11 nA in sham cells and 1.96±0.11 nA in post-MI cells and normalized current density was 9.94±0.87 pA/pF in sham cells and 9.02±0.50 pA/pF in post-MI cells (NS). The ratio of current density of I_Ca-T to I_Ca-L was 0.11. The inset on the lower left corner of Fig. 3 illustrates a family of I_Ca-T currents below the threshold for I_Ca-L between –50 mV and –30 mV.

View larger version (12K): [in this window] [in a new window] [Download PowerPoint slide]   Fig. 2 I–V relationship of ICa-L in a sham-operated left ventricular myocyte obtained in Na+-free solution. Depolarization protocol is illustrated at top. Panel A shows original recordings of Ca2+ currents at holding potential (HP) of –80 mV and –50 mV as well as current subtraction. Lower panel shows I–V curves obtained at HP of –80 and –50 mV and their subtraction. Note absence of T-type Ca2+ current. The difference between the I–V curves is due to slight run-down of ICa-L..

 

View larger version (13K): [in this window] [in a new window] [Download PowerPoint slide]   Fig. 3 I–V relationship of ICa-L and ICa-T in a post-MI remodeled ventricular myocyte obtained in Na+-free solution. Depolarization protocol is illustrated at top. Panel A shows original recordings of Ca2+ currents at holding potential (HP) of –80 mV and –50 mV as well as current subtraction to isolate ICa-T. Lower panel shows I–V curves obtained at HP of –80 and –50 mV and their subtraction. The inset on the lower left corner illustrates a family of ICa-T currents below the threshold for ICa-L between –50 mV and –30 mV.

 
Fig. 4 illustrates recordings of I_Ca-L, I_Na, and I_Ca-T obtained from the same post-MI myocyte. Utilizing different HP and an external solution containing NaCl 120 mM+CsCl 20 mM. Panel A illustrates typical I_Ca-L recorded during depolarization from –40 to 0 mV. In panel B, a large I_Na was elicited during depolarization to –40 mV from an HP of –80 mV. In panel C, 100 µM TTX was added to the external solution to inhibit I_Na. Depolarization from –80 to –40 mV revealed a current consistent I_Ca-T with an amplitude of 0.46 nA that decayed with a time constant of 10.2 ms. Panel D illustrates the IV curve of the TTX-resistant current. Utilizing the TTX protocol, I_Ca-T was recorded in 9 out of 14 cells obtained from 3 post-MI animals. No I_Ca-T was recorded from sham operated animal (13 cells obtained from 3 animals). The average current density of 1.1±0.13 pA/pF was similar to that obtained in the presence of Na⁺-free external solution.

View larger version (10K): [in this window] [in a new window] [Download PowerPoint slide]   Fig. 4 Recordings of ICa-L, INa, and ICa-T obtained from the same post-MI myocyte. The external solution contained NaCl 120 mM+CsCl 20 mM. In A, a typical ICa-L current was recorded during depolarization to 0 mV from a holding potential (HP) of –40 mV. In B, a large INa was recorded during depolarization to –40 mV from an HP of –80 mV. Note the rapid activation and inactivation of the current. In C, 100 µM TTX was added to the external solution to suppress INa, and a small current consistent with ICa-T was recorded. Panel D illustrates IV curve of the TTX-resistant current.

 
3.3 Pharmacologic characterization of Ca²⁺ currents
We used nisoldipine and nickel to illustrate the differential responses of I_Ca-L and I_Ca-T. Fig. 5, panels A and B illustrate the effects of nisoldipine (1 µmol/l). The drug resulted in 69% suppression of I_Ca-L (range 62–85%, n=5). On the other hand, I_Ca-T was only minimally affected (decreased by 6%, range 4–10%, n=5). Fig. 5, panels C and D show that NiCl₂ (100 µmol/l) markedly decreased I_Ca-T by 87% (range 79–92%, n=4) but only slightly depressed I_Ca-L (decreased by 18%, range 10–23%, n=4).

View larger version (12K): [in this window] [in a new window] [Download PowerPoint slide]   Fig. 5 Differential effects of nisoldipine (panel A, B) and NiCl2 (panel C, D) on ICa-L and ICa-T. The depolarization protocol is illustrated at top. Original recording of Ca2+ currents and I–V curves at HP –80 mV before and after drugs are shown. ICa-T was less sensitive to nisoldipine and more sensitive to NiCl2 compared to ICa-L.

 

	4 Discussion

Top Abstract 1 Introduction 2 Methods 3 Results 4 Discussion References

 
We have shown that the T-type Ca²⁺ channel gene -1G and I_Ca-T are reexpressed in rat post-MI remodeled non-infarcted LV. The insensitivity of the current to TTX differentiates it from the TTX sensitive Ca²⁺ current described in normal adult rat ventricular myocytes [19]. The reexpression of T-type Ca²⁺ channel gene is consistent with previously reported gene alterations in rat post-MI LV that represent reemergence of fetal/neonatal isogene patterns. These included reexpression of fetal isogene forms of myosin heavy chain [9], Na-KATPase [9], L-type Ca²⁺ current [5] and Na⁺ channel subtype [8].

I_Ca-T was recorded from some, but not from all ventricular myocytes obtained from rat post-MI LV. On the other hand, LV tissue obtained from sham operated adult rats showed slight expression of the T-type Ca²⁺ channel -1G but no I_Ca-T current could be recorded from isolated normal LV myocytes. These observations may suggest that a critical level of expression of T-type Ca²⁺ channel gene is necessary for the ability to detect I_Ca-T in isolated myocytes. However, other interpretations of our observations could be cited. It is possible that a relationship exists between the degree of myocyte hypertrophy and the expression of T-type Ca²⁺ channel gene and current. For example, it was suggested that the density of I_Ca-L could be related to the degree and stage of cardiac hypertrophy [20]. In the present study, however, there was no clear correlation between the LV myocyte estimated capacitance and the ability to record I_Ca-T. It is also possible that the reexpression of T-type Ca²⁺ channel gene and current is LV region-specific (i.e. epicardial vs. midmyocardial vs. endocardial regions of the LV) as is the case of some of the K⁺ channel genes [21] and currents [22]. This possibility was not addressed in the present study.

In contrast to I_Ca-L, the physiological functions of cardiac I_Ca-T are not clearly defined. In addition to a putative contribution to automaticity in adult cardiac tissue [23], I_Ca-T seems to be associated with rapid postnatal growth and hypertrophy. There is growing evidence that T-type Ca²⁺ channels modulate the responses to various hypertrophic signals [1]. I_Ca-T is scarce in mammalian adult atrial and ventricular myocytes. I_Ca-T is reexpressed in atrial myocytes from adult rats with growth hormone-secreting tumors [24]. A similar increase follows exposure of ventricular cells to insulin-like growth factor 1 (IGF-1) in short time primary culture of myocytes [25]. I_Ca-T is reexpressed in adult feline LV with pressure-overload induced hypertrophy [17], and in a genetically determined Cardiomyopathic Syrian hamster which develops progressive congestive heart failure [26]. In the latter model I_Ca-T had a 2–3 fold higher density than in normal cells and displayed abnormal activation and inactivation kinetics. It was suggested that the alterations in I_Ca-T contributed to Ca²⁺ overload and to arrhythmogenesis in this model [26]. Recently a T-type Ca²⁺ channel was reported to be expressed in ventricular myocytes from rats with pressure-overload hypertrophy [27]. Further, the T-type Ca²⁺ channel blocker, mibefradil was recently reported to prevent the development of a substrate for atrial fibrillation by tachycardia-induced atrial remodeling in dogs [28].

We have previously shown that myocytes from 3 to 5 week-old post-MI remodeled rat LV had prolonged action potential duration that was attributed primarily to downregulation of key K⁺ channel genes [7] and currents [6] while the L-type Ca²⁺ channel gene [5] and current [6] were not different from control. These myocytes were also shown to generate both early and delayed afterdepolarizations [6]. Although the I_Ca-T density is smaller compared to that of I_Ca-L, it is possible that slight augmentation of intracellular Ca²⁺ at certain phases of action potential can predispose to abnormal afterdepolarizations. Vassort and Alvarez [18] have suggested that a bimodel voltage dependency of T-type Ca²⁺ channel availability can result in an inward current that flows at two ranges of potential and that such a current might be involved in both early and late afterdepolarization as well as abnormal automaticity. However, an arrhythmogenic potential of reexpressed T-type Ca²⁺ channel gene and current in the post-MI remodeled rat heart remains to be demonstrated.

Data on the benefit of I_Ca-T antagonist in experimental models are sparse. The selective I_Ca-T antagonist, mibefradil was shown to improve survival in a rat model of chronic heart failure compared to the I_Ca-L antagonist amlodipine [29]. Mibefradil has been introduced in clinical trials for the treatment of hypertension and angina pectoris [30] even though it was recently withdrawn from clinical application. The beneficial effects were attributed to a potent coronary and peripheral vasodilation [30]. So far, no significant I_Ca-T has been detected in atrial and ventricular cells isolated from human tissues with various pathophysiologic states including heart failure and cardiomyopathy [31,32]. The recent identification of genes encoding T-type Ca²⁺ channels in the heart [2,3] would make it easier to readdress the functional contribution of cardiac T-type Ca²⁺ channel(s) to both normal and pathophysiologic states and the mechanisms of potential action of selective I_Ca-T antagonists.

Time for primary review 29 days.

	Acknowledgements

 
Supported in part by Veterans Administration Medical Research Funds.

	References

Top Abstract 1 Introduction 2 Methods 3 Results 4 Discussion References

 

1. Richard S., Leclercq F., Lemaire S., Piot C., Nargeot J. Ca²⁺ currents in compensated hypertrophy and heart failure. Cardiovasc. Res. (1998) 37(2):300–311.[Abstract/Free Full Text]
2. Perez-Reyes E., Cribbs L.L., Daud A., et al. Molecular characterization of a neuronal low-voltage-activated T-type calcium channel. Nature (1998) 391:896–900.[CrossRef][Medline]
3. Cribbs L.L., Lee J.H., Yang J., et al. Cloning and characterization of 1H from human heart, a member of the T-type Ca²⁺ channel gene family. Circ. Res. (1998) 83(1):103–109.[Abstract/Free Full Text]
4. Furukawa T., Ito H., Nitta J., et al. Endothelin-1 enhances calcium entry through T-type calcium channels in cultured neonatal rat ventricular myocytes. Circ. Res. (1992) 71(5):1242–1253.[Abstract/Free Full Text]
5. Gidh-Jain M., Huang B., Jain P., Battula V., El-Sherif N. Reemergence of the fetal pattern of L-type calcium channel gene expression in non infarcted myocardium during left ventricular remodeling. Biochem. Biophys. Res. Commun. (1995) 216:892–897.[CrossRef][Web of Science][Medline]
6. Qin D., Zhang Z-H., Boutjdir M., Jain P., El-Sherif N. Cellular and ionic basic of arrhythmias in post-infarction remodeled ventricular myocardium. Circ Res (1996) 79:461–473.[Abstract/Free Full Text]
7. Gidh-Jain M., Huang B., Jain P., El-Sherif N. Differential expression of voltage-gated K⁺ channel genes in left ventricular remodeled myocardium after experimental myocardial infarction. Circ. Res. (1996) 79:669–675.[Abstract/Free Full Text]
8. Huang B., Gidh-Jain M., Jain P., El-Sherif N. Changes in the expression of the sarcolemmal sodium channel subtypes in rat ventricle after myocardial infarction. Biophys. J. (1997) 72(2):A33.
9. Gidh-Jain M., Huang B., Jain P., El-Sherif N. Alterations in cardiac gene expression during transition to compensated hypertrophy following myocardial infarction. J. Mol. Cell Cardiol. (1998) 30:627–737.[CrossRef][Web of Science][Medline]
10. Qin D., Jain P., Boutjdir M., El-Sherif N. Expression of T-type calcium current in remodeled hypertrophied left ventricle from adult rat following myocardial infarction. Circulation (1995) 92:I 587. Abstract.
11. Huang B., Deng L., Qin D., Boutjdir M., El-Sherif N. Reexpression of T-type Ca²⁺ channel gene and current in post-infarction remodeled rat left ventricle. Circulation (1998) 98:I 840. Abstract.
12. Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem (1987) 162:156–159.[Web of Science][Medline]
13. Danielson P., Forss-Petter S., Brow M., et al. p1B15: a cDNA clone of the rat mRNA encoding cyclophilin. DNA (1988) 7:261–267.[Web of Science][Medline]
14. Reuter H., Scholz H. A study of the ion selectivity and the kinetic properties of the calcium dependent slow inward current in mammalian cardiac muscle. J. Physiol. (Lond) (1977) 264(1):17–47.[Abstract/Free Full Text]
15. Tseng G.N., Boyden P.A. Different effects of intracellular Ca and protein kinase C on cardiac T and L Ca currents. Am. J. Physiol. (1991) 261(2 Pt 2):H364–H379.[Web of Science][Medline]
16. Balke C.W., Rose W.C., Marban E., Wier W.G. Macroscopic and unitary properties of physiological ion flux through T-type Ca²⁺ channels in guinea-pig heart cells. J. Physiol. (Lond) (1992) 456:247–265.[Abstract/Free Full Text]
17. Nuss H.B., Houser S.R. T-type Ca²⁺ current is expressed in hypertrophied adult feline left ventricular myocytes. Circ. Res. (1993) 73(4):777–782.[Abstract/Free Full Text]
18. Vassort G., Alvarez J. Cardiac T-type calcium current: pharmacology and roles in cardiac tissues. J. Cardiovasc. Electrophysiol. (1994) 5(4):376–393.[Web of Science][Medline]
19. Aggarwal R., Shorofsky S.R., Goldman L., Balke C.W. Tetrodotoxin-blockable calcium currents in rat ventricular myocytes; a third type of cardiac cell sodium current. J. Physiol. (Lond) (1997) 505(Pt 2):353–369.[Abstract/Free Full Text]
20. Hart G. Cellular electrophysiology in cardiac hypertrophy and failure. Circ. Res. (1994) 28:933–946.
21. Dixon J.E., McKinnon D. Quantitative analysis of potassium channel mRNA expression in atrial and ventricular muscle of rats. Circ. Res. (1994) 75:252–260.[Abstract/Free Full Text]
22. Antzelevitch C., Sicouri S., Litovsky S.H., et al. Heterogeneity within the ventricular wall: electrophysiology and pharmacology of epicardial, endocardial, and M cells. Circ. Res. (1991) 69:1427–1449.[Free Full Text]
23. Hagiwara N., Irisawa H., Kameyama M. Contribution of two types of calcium currents to the pacemaker potentials of rabbit sino-atrial node cells. J. Physiol. (Lond) (1988) 395:233–253.[Abstract/Free Full Text]
24. Xu X.P., Best P.M. Increase in T-type calcium current in atrial myocytes from adult rats with growth hormone-secreting tumors. Proc. Natl. Acad. Sci. USA (1990) 87(12):4655–4659.[Abstract/Free Full Text]
25. Fares N., Gomez J.P., Potreau D. T-type calcium current is expressed in dedifferentiated adult rat ventricular cells in primary culture. C R Acad Sci III (1996) 319(7):569–576.[Medline]
26. Sen L., Smith T.W. T-type Ca²⁺ channels are abnormal in genetically determined cardiomyopathic hamster hearts. Circ. Res. (1994) 75(1):149–155.[Abstract/Free Full Text]
27. Martinez M.L., Heredia M.P., Delgado C. Expression of T-type Ca²⁺ channels in ventricular cells from hypertrophied rat hearts. J. Mol. Cell Cardiol. (1999) 19:1617–1625.
28. Fareh S., Benardeau A., Thibault B., Nattel S. The T-type Ca²⁺ channel blocker mibefradil prevents the development of a substrate for atrial fibrillation by tachycardia-induced atrial remodeling in dogs. Circulation (1999) 100:2191–2197.[Abstract/Free Full Text]
29. Mulder P., Richard V., Compagnon P., et al. Increased survival after long-term treatment with mibefradil, a selective T-channel calcium antagonist, in heart failure. J. Am. Coll. Cardiol. (1997) 29(2):416–421.[Abstract]
30. Kobrin I., Bieska G., Charlon V., Lindberg E., Pordy R. Anti-anginal and anti-ischemic effects of mibefradil, a new T-type calcium channel antagonist. Cardiology (1998) 89(Suppl_1):23–32.[CrossRef][Web of Science][Medline]
31. Beuckelmann D.J., Nabauer M., Erdmann E. Characteristics of calcium-current in isolated human ventricular myocytes from patients with terminal heart failure. J. Mol. Cell Cardiol. (1991) 23(8):929–937.[CrossRef][Web of Science][Medline]
32. Mewes T., Ravens U. L-type calcium currents of human myocytes from ventricle of non-failing and failing hearts and from atrium. J. Mol. Cell Cardiol. (1994) 26(10):1307–1320.[CrossRef][Web of Science][Medline]

CiteULike    Connotea    Del.icio.us    What's this?

This article has been cited by other articles:

				F. Pluteanu and L. L. Cribbs T-type calcium channels are regulated by hypoxia/reoxygenation in ventricular myocytes Am J Physiol Heart Circ Physiol, October 1, 2009; 297(4): H1304 - H1313. [Abstract] [Full Text] [PDF]

				A. Maturana, S. Lenglet, M. Python, S. Kuroda, and M. F. Rossier Role of the T-Type Calcium Channel CaV3.2 in the Chronotropic Action of Corticosteroids in Isolated Rat Ventricular Myocytes Endocrinology, August 1, 2009; 150(8): 3726 - 3734. [Abstract] [Full Text] [PDF]

				R.-S. Chen and P. M. Best A Small Peptide Inhibitor of the Low Voltage-Activated Calcium Channel Cav3.1 Mol. Pharmacol., May 1, 2009; 75(5): 1042 - 1051. [Abstract] [Full Text] [PDF]

				C.-S. Chiang, C.-H. Huang, H. Chieng, Y.-T. Chang, D. Chang, J.-J. Chen, Y.-C. Chen, Y.-H. Chen, H.-S. Shin, K. P. Campbell, et al. The CaV3.2 T-Type Ca2+ Channel Is Required for Pressure Overload-Induced Cardiac Hypertrophy in Mice Circ. Res., February 27, 2009; 104(4): 522 - 530. [Abstract] [Full Text] [PDF]

				N. Jaleel, H. Nakayama, X. Chen, H. Kubo, S. MacDonnell, H. Zhang, R. Berretta, J. Robbins, L. Cribbs, J. D. Molkentin, et al. Ca2+ Influx Through T- and L-Type Ca2+ Channels Have Different Effects on Myocyte Contractility and Induce Unique Cardiac Phenotypes Circ. Res., November 7, 2008; 103(10): 1109 - 1119. [Abstract] [Full Text] [PDF]

				M. F. Rossier, S. Lenglet, L. Vetterli, M. Python, and A. Maturana Corticosteroids and Redox Potential Modulate Spontaneous Contractions in Isolated Rat Ventricular Cardiomyocytes Hypertension, October 1, 2008; 52(4): 721 - 728. [Abstract] [Full Text] [PDF]

				N. Laleve, M. C. Rebsamen, S. Barrere-Lemaire, E. Perrier, J. Nargeot, J.-P. Benitah, and M. F. Rossier Aldosterone increases T-type calcium channel expression and in vitro beating frequency in neonatal rat cardiomyocytes Cardiovasc Res, August 1, 2005; 67(2): 216 - 224. [Abstract] [Full Text] [PDF]

				J. K. Larsen, C.-C. Chen, and P. M. Best Disruption of growth hormone secretion alters Ca2+ current density and expression of Ca2+ channel and insulin-like growth factor genes in rat atria Am J Physiol Heart Circ Physiol, February 1, 2005; 288(2): H829 - H838. [Abstract] [Full Text] [PDF]

				W. Dun, S. Baba, T. Yagi, and P. A. Boyden Dynamic remodeling of K+ and Ca2+ currents in cells that survived in the epicardial border zone of canine healed infarcted heart Am J Physiol Heart Circ Physiol, September 1, 2004; 287(3): H1046 - H1054. [Abstract] [Full Text] [PDF]

				N. Niwa, K. Yasui, T. Opthof, H. Takemura, A. Shimizu, M. Horiba, J.-K. Lee, H. Honjo, K. Kamiya, and I. Kodama Cav3.2 subunit underlies the functional T-type Ca2+ channel in murine hearts during the embryonic period Am J Physiol Heart Circ Physiol, June 1, 2004; 286(6): H2257 - H2263. [Abstract] [Full Text] [PDF]

				B. Rosati and D. McKinnon Regulation of Ion Channel Expression Circ. Res., April 16, 2004; 94(7): 874 - 883. [Abstract] [Full Text] [PDF]

				J. F. Heubach, E. M. Graf, J. Leutheuser, M. Bock, B. Balana, I. Zahanich, T. Christ, S. Boxberger, E. Wettwer, and U. Ravens Electrophysiological properties of human mesenchymal stem cells J. Physiol., February 1, 2004; 554(3): 659 - 672. [Abstract] [Full Text] [PDF]

				L. Ferron, V. Capuano, Y. Ruchon, E. Deroubaix, A. Coulombe, and J.-F. Renaud Angiotensin II Signaling Pathways Mediate Expression of Cardiac T-Type Calcium Channels Circ. Res., December 12, 2003; 93(12): 1241 - 1248. [Abstract] [Full Text] [PDF]

				Y. M. Zhang, L. Shang, C. Hartzell, M. Narlow, L. Cribbs, and S. C. Dudley Jr. Characterization and regulation of T-type Ca2+ channels in embryonic stem cell-derived cardiomyocytes Am J Physiol Heart Circ Physiol, December 1, 2003; 285(6): H2770 - H2779. [Abstract] [Full Text] [PDF]

				T. Izumi, Y. Kihara, N. Sarai, T. Yoneda, Y. Iwanaga, K. Inagaki, Y. Onozawa, H. Takenaka, T. Kita, and A. Noma Reinduction of T-Type Calcium Channels by Endothelin-1 in Failing Hearts In Vivo and in Adult Rat Ventricular Myocytes In Vitro Circulation, November 18, 2003; 108(20): 2530 - 2535. [Abstract] [Full Text] [PDF]

				M. Xu, A. Welling, S. Paparisto, F. Hofmann, and N. Klugbauer Enhanced Expression of L-type Cav1.3 Calcium Channels in Murine Embryonic Hearts from Cav1.2-deficient Mice J. Biol. Chem., October 17, 2003; 278(42): 40837 - 40841. [Abstract] [Full Text] [PDF]

				J. BORLAK and T. THUM Hallmarks of ion channel gene expression in end-stage heart failure FASEB J, September 1, 2003; 17(12): 1592 - 1608. [Abstract] [Full Text] [PDF]

				E. Perez-Reyes Molecular Physiology of Low-Voltage-Activated T-type Calcium Channels Physiol Rev, January 1, 2003; 83(1): 117 - 161. [Abstract] [Full Text] [PDF]

				J.-Y. Min, A. Meissner, J. Wang, and J. P. Morgan Mibefradil Improves {beta}-Adrenergic Responsiveness and Intracellular Ca2+ Handling in Hypertrophied Rat Myocardium Experimental Biology and Medicine, May 1, 2002; 227(5): 336 - 344. [Abstract] [Full Text] [PDF]

This Article Abstract FREE Full Text (PDF) E-letters: Submit a response Alert me when this article is cited Alert me when E-letters are posted Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Request Permissions Disclaimer Google Scholar Articles by Huang, B. Articles by El-Sherif, N. Search for Related Content PubMed PubMed Citation Articles by Huang, B. Articles by El-Sherif, N. Social Bookmarking          What's this?

Online ISSN 1755-3245 - Print ISSN 0008-6363

Copyright © 2009 European Society of Cardiology

Oxford Journals Oxford University Press

• Site Map
• Privacy Policy
• Frequently Asked Questions

Other Oxford University Press sites: Oxford University Press Oxford Journals China Oxford Journals Japan American National Biography Booksellers' Information Service Children's Fiction and Poetry Children's Reference Corporate & Special Sales Dictionaries Dictionary of National Biography Digital Reference English Language Teaching Higher Education Textbooks Humanities International Education Unit Law Medicine Music Online Products Oxford English Dictionary Reference Rights and Permissions Science School Books Social Sciences Very Short Introductions World's Classics