Skip Navigation

Cardiovascular Research 2000 45(4):1026-1034; doi:10.1016/S0008-6363(99)00385-5
© 2000 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Rivard, A.
Right arrow Articles by Andrés, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rivard, A.
Right arrow Articles by Andrés, V.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2000, European Society of Cardiology

Age-dependent increase in c-fos activity and cyclin A expression in vascular smooth muscle cells

A potential link between aging, smooth muscle cell proliferation and atherosclerosis

Alain Rivard1,a, Nicole Principea and Vicente Andrésa,b,*

aDepartment of Medicine (Cardiology), St. Elizabeth's Medical Center, Tufts University School of Medicine, Boston, MA 02135, USA
bUnit of Vascular Biology, Instituto de Biomedicina de Valencia, Consejo Superior de Investigaciones Cientìficas, 46010-Valencia, Spain

* Corresponding author. Tel.: +96-33-91-752; fax: +96-36-90-800 vandres{at}ibv.csic.es

Received 7 April 1999; accepted 18 October 1999


    Abstract
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
Objective: Aging can be defined as a progressive deterioration of biological functions after the organism has attained its maximal reproductive competence, which is usually associated with a decrease in proliferative ability in most cell types. However, in certain pathological situations such as atherosclerosis and restenosis, aging has been shown to be associated with a higher level of vascular smooth muscle cell (VSMC) proliferation and neointimal lesion formation after angioplasty. In the present study, we investigated potential mechanisms involved in the age-dependent increase in VSMC proliferation. Methods and results: Primary cultures of VSMCs were isolated from young (6–8-month-old) and old (4–5-year-old) New Zealand rabbits. Results from cell counting assays and FACS analysis were consistent with a shortening of the cell cycle in old VSMCs. Western blot analysis in serum stimulated cells showed a significant increase in the level of cyclin A and cyclin-dependent kinase 2 proteins in the old vs. young VSMCs. In marked contrast, expression of cyclin E in VSMCs was not influenced by aging. Transient transfection assays showed an age-dependent increase in transcription from the human cyclin A promoter. Parallel studies demonstrated that the expression of the AP1 transcription factor c-fos, which interacts with the cyclin A promoter and stimulates VSMC proliferation, was also increased in old VSMCs. Consistent with this notion, electrophoretic mobility shift assays demonstrated an increase in AP1 DNA-binding activity in old VSMCs. Conclusions: These studies suggest that age-associated increase in c-fos activity contributes to augmented cyclin A expression and VSMC proliferation in old animals. These mechanisms might contribute to the higher prevalence and severity of atherosclerosis in the elderly.

KEYWORDS Aging; Gene expression; Smooth muscle


    1 Introduction
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
Many investigations have established a link between aging in vivo and the proliferation potential of cells in culture. In general, the decline of many functions seen during aging has been correlated with a decrease in the growth capability of different cell types including fibroblasts, endothelial cells, T lymphocytes and epithelial cells [1]. However, paradoxically, aging is also a major risk factor for cancer [2] and atherosclerosis [3–5], both diseases being classically associated with an increased level of cellular proliferation. In the case of atherosclerosis, it is generally accepted that abnormal proliferation and migration of vascular smooth muscle cells (VSMCs) play an important role in the pathophysiology of the disease [6–11]. Excessive proliferation of VSMCs is also thought to contribute to restenosis, an accelerated form of atherosclerosis that limits the long-term success of revascularization in ~25–55% of patients undergoing percutaneous transluminal coronary angioplasty [12–14].

It has previously been shown that, in marked contrast to most cell types, VSMCs isolated from old rats replicate more actively than corresponding cultures from young animals [15–18]. Moreover, aging in rats was associated with a greater and more prolonged proliferative response of VSMCs to balloon angioplasty [19], and transplantation experiments have suggested that this response appears to be a function of the age of the arterial segment rather than the host environment [20]. Taken together, these findings suggest that the age-dependent increase in VSMC proliferation may contribute to the increased prevalence and severity of atherosclerosis in the elderly. However, the cellular and molecular mechanisms that contribute to augmented proliferation in old VSMCs remain largely undefined.

The AP-1 transcription factors have been implicated in positive control of cellular proliferation [21,22]. Moreover, it has been suggested that reduction in AP-1 activity may be one of the major molecular defects responsible for the habitual decline in the proliferative response seen in most cell types with aging [23,24]. We have previously shown that the AP-1 family member c-fos is an important component of the signaling cascade that links Ras activity to cyclin A transcription and VSMC proliferation in vitro and after arterial injury in vivo [25]. In the present study, we used VSMCs isolated from the aorta of young and old rabbits to elucidate potential mechanisms involved in the age-dependent increase in VSMCs proliferation. Our results show that augmented proliferation in older VSMCs is associated with an increase in serum-induced expression of cyclin-dependent kinase 2 (CDK2) and cyclin A. We also demonstrate an age-dependent increase in cyclin A promoter activity, suggesting that higher cyclin A expression in old VSMCs is achieved, at least in part, through increased cyclin A gene transcription. Finally, parallel studies demonstrated that the expression of the AP1 transcription factor c-fos, which has been shown to interact with the cyclin A promoter and stimulate VSMC proliferation [25], was also increased in old VSMCs. Consistent with this notion, electrophoretic mobility shift assays using both a consensus AP-1 probe or the c-fos binding site within the cyclin A promoter showed increased DNA-binding activity in old VSMCs. Thus, this study illustrates for the first time a transcriptional regulatory network by which age-related increase c-fos activity might contribute to the greater VSMC proliferation and higher incidence of atherosclerosis seen with aging.


    2 Methods
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
2.1 Isolation of VSMCs and proliferation studies
The investigation conforms with the ‘Guide for the Care and Use of Laboratory Animals’ published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996). VSMCs were isolated from the aorta of young (6–8-month-old) and old (4–5-year-old) New Zealand White male rabbits as described by Pickering et al. [26]. In our hands, this technique typically gives a high plating efficiency (around 80%) both in young and old VSMCs. Cells were incubated at 37°C in a humidified 5% CO2–95% O2 atmosphere in a DME medium supplemented with 2 mM L-glutamine, 200 units/ml penicillin, 0.25 mg/ml streptomycin, and serum as indicated. We used early passage (P2 or P3) rabbit VSMCs in all our experiments. To render cells quiescent, primary cultures were maintained for 3 days in DME supplemented with 0.5% FBS and then stimulated with 10% FBS/DME for different periods of time. When indicated, cells were starvation-synchronized in serum-free IT medium [27]. Cells for flow cytometry analysis were trypsinized, fixed in 70% ethanol and stained with a solution containing 50 µg/ml each of propidium iodide and ribonuclease A (Boehringer Mannheim). Samples were analyzed in triplicate with a Becton-Dickinson FACScan using the CellFIT Cell-Cycle Analysis software (Becton-Dickinson).

The CellTiter 96 AQ nonradioactive cell-proliferation assay (Promega) was also used to assess cell growth. The assay is composed of the tetrazolium compound MTS and the electron-coupling reagent PMS. Viable cells reduce MTS to formazan, which can be measured with a spectrophotometer by the amount of absorbance at 490 nm. Formazan production is time-dependent and proportional to the number of viable cells. VSMCs from young and old animals were cultured in 10% FBS/DME in 96-well flat-bottomed culture plates (Becton Dickinson). Cultures were seeded at 1000 cells/well and allowed to attach overnight. After the indicated time of culture, 20 µl MTS/PMS (1:0.05) mixture was added per well, and cells were incubated 2 h before measuring absorbance at 490 nm. Background absorbance from the control wells (same media, no cells) was subtracted. Eight duplicate measurements were performed for each experimental condition.

2.2 Transient tansfections and luciferase assays
VSMCs from young and old rabbits were seeded into 100 mm dishes and maintained in DME supplemented with 10% FBS. The next day, cells (~60–80% confluence) were transiently transfected with 10 µg of a reporter construct containing the firefly luciferase gene under the transcriptional control of the –924/+245 promoter region from the human cyclin A gene [28] and 30 µg of Lipofectamine reagent (GIBCO Laboratories). To correct for differences in transfection efficiency, luciferase activity was normalized relative to the level of alkaline phosphatase activity produced from cotransfected pSVAPAP plasmid (0.5 µg), which contains the reporter gene under the control of the simian virus 40 enhancer-promoter [29]. Cells were incubated with transfection mixtures for 90 min and were then washed with PBS and starvation-synchronized with the indicated media for 3 days after transfection. Cells were restimulated with 10% FBS for different periods of time prior to the preparation of cell lysates. Luciferase and alkaline phosphatase activities were measured as previously described [30]. Results represent the mean±S.E. of three independent transfections.

2.3 Whole cell extracts and Western blot analysis
Whole cell extracts were prepared as previously described [31]. After separation on SDS-polyacrylamide gels [32], proteins were transferred by semi-dry blotting to Immobilon-P (0.45 µm, Millipore). Membranes were blocked for 1 h with PBS containing 0.05% Tween-20 (TPBS) and 4% non-fat dry milk, and then incubated for 1 h with primary antibodies diluted in TPBS containing 2% non-fat dry milk. The following rabbit polyclonal antibodies were purchased from Santa Cruz Biotechnology and were diluted as follows: anti-cdk2 (sc-163, 1:500), anti-cyclin A (sc-751, 1:100), anti-cyclin E (sc-451, 1:250), and anti-c-fos (sc-052, 1:200). After washes with TPBS, membranes were incubated for 30 min with anti-rabbit horseradish peroxidase-conjugated secondary antibodies (Amersham), washed with TPBS and finally with PBS. Visualization of the immune complexes was carried out with an enhanced chemiluminescent system (Amersham). Densitometric analysis of the autoradiograms exposed in the linear range of film density was made using a Hewlett Packard scanner with National Institute of Health Image Software.

2.4 Electrophoretic mobility shift assay
Electrophoretic mobility shift assays were carried out in buffer containing 10 mM Tris–HCl (pH 7.5), 4% glycerol, 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM DTT, 50 mM NaCl, and 0.05 mg/ml poly(dI-dC)/poly(dI-dC). Radiolabeled double-stranded oligonucleotide probes spanning either the AP1 consensus binding site (5'–CGCTTGATGACGTCAGCCGGAA–3'; AP1 site underlined) or the CRE from the human cyclin A promoter region (position –84 to –63; 5'–TTGAATGACGTCAGGCCGCG–3'; CRE underlined) were used. Whole cell extracts were preincubated in binding buffer for 10 min on ice. Then probe was added for an additional 30 min. Competition assays were performed by adding a 20-fold molar excess of unlabeled oligonucleotide to the preincubation mixture prior to the addition of radiolabeled probe. The CRE mut oligonucleotide contains mutations within the CRE sequence (5'–TTAAATGAATTCAAGGCCGCG–3') [33]. Binding reactions were separated at 4°C in non-denaturing 4% acrylamide gels in 0.5X TBE running buffer. Supershift experiments using lysates from rat pulmonary artery cells (PAC1) [34] and anti-c-fos antibodies were done as previously described [25].


    3 Results
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
3.1 Aging causes increased serum-induced VSMC proliferation
We isolated VSMCs from the aorta of young and old rabbits and analyzed their kinetics of proliferation. Cells were plated at a density of 60 000 cells/well, maintained in serum-rich medium and the number of cells was counted every other day over a period of 4 days. As seen in Fig. 1A, the old VSMCs showed a 2.1-fold increase in cell number when compared to the young VSMCs 4 days after plating (old=175 000±6600, young=82 500±8700, P=0.001). Consistent with these findings, in cultures maintained for 5 days in high-serum medium, the MTS cell-proliferation assay showed a 1.7-fold increase in activity in the old compared to the young VSMCs (old=1.0±0.03 vs. young=0.6±0.03, P<0.001) (Fig. 1B). These results suggested that old VSMCs proliferate faster than young cells when stimulated with serum-rich medium. To test whether old cells proceed through the cell cycle faster than young cells, starvation-synchronized VSMCs were serum restimulated and their cell cycle profile was analyzed at different time points after addition of serum. As shown by the flow cytometry analysis of Fig. 1C, old VSMCs disclosed maximal DNA synthesis (S phase) around 18 h after serum restimulation, whereas increased DNA replication in young cells occurred at later time points. Collectively, these findings indicate that aortic VSMCs isolated from old rabbits proliferate at a higher rate than young cells when stimulated with serum.


Figure 1
View larger version (14K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Age-dependent increase in VSMC proliferation. VSMCs were isolated from the aortas of a young and an old rabbit and cultured in 10% FBS/DME. Three duplicate measurements were performed for each experimental condition. Similar results were obtained with 2 different sets of cells (i.e. cells isolated from 2 young and 2 old animals). Representative results are shown in each case. (A) Cultures were seeded at 60 000 cells/well in 6-well dishes and counted with a hemacytometer every other day over a period of 4 days. (B) Cells were seeded at 1000 cells/well in 96-well flat-bottomed culture plates to perform the CellTiter 96 AQ cell-proliferation assay (see methods). After the indicated time in culture, 20 µl of MTS/PMS (1:0.05) mixture was added per well, and cells were incubated 2 h before measuring absorbance at 490 nm. Eight duplicate measurements were performed for each experimental condition. (C) The cells were rendered quiescent by maintaining them for 3 days in DME medium supplemented with 0.5% FBS and then stimulated with 10% FBS. After the indicated periods of time, the cells were trypsinized, fixed with 70% ethanol and stained with a solution containing 50 µg/ml each of propidium iodine and ribonuclease A. Samples were analyzed in triplicate with a Becton-Dickinson FACScan using the CellFIT Cell-Cycle Analysis software.

 
3.2 Age-dependent increase in VSMC proliferation is associated with augmented cyclin A protein expression and promoter activity
CDK2 and its regulatory subunits, cyclins E and A are essential for progression through the G1 and S phase of the mammalian cell cycle [35–38]. We previously showed that VSMC proliferation in response to mechanical acute injury in rat and human arteries correlates with the induction of CDK2, cyclin E and cyclin A [39,40]. To investigate whether age-dependent increase in VSMC proliferation is associated with increased expression of these cell cycle regulators, Western blot analysis was performed following serum restimulation of starvation-synchronized young and old VSMCs. While serum refeeding resulted in the induction of cyclin A and CDK2 protein levels in both young and old VSMCs, increased cyclin A and CDK2 expression appeared more robust in old VSMCs (Fig. 2). Similar results were observed using other preparations of young and old VSMCs (data not shown). Densitometric analysis disclosed maximum levels of cyclin A and CDK2 in old VSMCs that were 36- and 2.4-fold higher that the maximum seen in young cells, respectively (Fig. 2). Of note, induction of cyclin A in old VSMCs preceded the induction observed in young cells, in agreement with our flow cytometry analysis (see Fig. 1C). In marked contrast, cyclin E protein levels did not appear to be regulated by serum and aging (Fig. 2). Thus, increased proliferation in older VSMCs correlates with higher levels of CDK2 and cyclin A protein expression.


Figure 2
View larger version (21K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Expression of cell cycle regulatory proteins in serum restimulated old and young VSMCs. Whole cell extracts were prepared from VSMCs isolated from old and young rabbits after serum stimulation for the indicated periods of time (in hours). Western blot analysis was performed for different regulatory proteins implicated in the cell cycle. Similar results were obtained with 2 different sets of cells (i.e. cells isolated from 2 young and 2 old animals). Representative results are shown. Densitometric analysis was performed to quantify the relative amount of protein in each band, the results of which are shown below each lane. For cyclin A, the results are expressed relative to the amount in young cells 24 h after refeeding (zero indicates undetectable levels). For cyclin E and CDK2, results are expressed relative to the amount in starvation-synchronized young cells (first lane=1). Serum stimulation resulted in the induction of cyclin A and CDK2 protein levels in both young and old VSMCs, although the ultimate level was higher in old VSMCs. In marked contrast, cyclin E protein levels did not appear to be regulated by serum or aging.

 
We next examined the kinetics of induction of cyclin A promoter activity following serum restimulation in young and old VSMCs. To this end, cells were transiently transfected with a luciferase reporter construct driven by the human cyclin A promoter region from –924 to +245 relative to the main transcription initiation site [28]. In agreement with previous studies in fibroblasts [28,41–44] and pulmonary arterial VSMCs [25], transcription from the cyclin A promoter was induced by serum refeeding in both young and old VSMCs (Fig. 3A,B), although maximum serum-inducible cyclin A promoter activity was higher in old than in young VSMCs (Fig. 3C). Moreover, increased transcription from the cyclin A promoter in old versus young VSMCs was also seen in serum-starved cells. Indeed, old VSMCs maintained in low serum (0.5% FBS/DME) or in serum-free IT media disclosed a 6-fold increase in cyclin A promoter activity when compared to young VSMCs (Fig. 3D). These findings indicate that basal and maximal serum-induced cyclin A promoter activity is higher in old VSMCs. Moreover, these results suggest that increased cyclin A gene transcription contributes to augmented cyclin A protein expression in older VSMCs.


Figure 3
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Age-dependent increase in cyclin A promoter activity. VSMCs from young and old rabbits were transiently transfected with 10 µg of a reporter construct containing the firefly luciferase gene under the transcriptional control of the human cyclin A gene promoter. To correct for differences in transfection efficiency, luciferase activity was normalized relative to the level of alkaline phosphatase activity produced from cotransfected pSVAPAP plasmid containing the reporter gene under the control of the SV40 promoter. Results are expressed as the ratio of luciferase over alkaline phosphatase activity (mean±S.E.M of three independent assays). Following transfection, young (A) and old (B) VSMCs were kept in 0.5% FBS/DME for 3 days and then serum restimulated for the indicated periods of time (in hours). (C) The results shown in A and B are plotted together to point out the marked increase in maximal cyclin A promoter activity in the serum-stimulated old VSMCs. (D) After 3 days incubation in serum-free medium (IT) or in 0.5% FBS/DME (DME), transfected cells were harvested without serum restimulation. The results for DME are the same as shown in C (0 h time point). Similar results were obtained with 2 different sets of cells (i.e. cells isolated from 2 young and 2 old animals). Representative results are shown.

 
3.3 Age-dependent increase in cyclin A expression in VSMCs is associated with augmented c-fos expression and DNA-binding activity
Members of the AP-1 family of transcription factors have been implicated in the control of cellular growth [22] and their expression correlates with VSMC proliferation in response to balloon angioplasty [25,45–47]. We have recently shown that the AP1 transcription factor c-fos links Ras-dependent mitogenic signaling to cyclin A transcription and VSMC growth [25]. Therefore, we sought to investigate whether increased c-fos expression and DNA-binding activity might contribute to age-related augmented cyclin A gene expression. Western blot analysis disclosed higher levels of c-fos in old VSMCs maintained in low serum medium and at 12 h after serum restimulation (Fig. 4A). Moreover, electrophoretic mobility shift assays using a radiolabeled probe containing the AP1 consensus binding site disclosed higher levels of DNA-binding activity in serum-restimulated old VSMCs (Fig. 4B; lanes 2–5 vs. 7–10). Competition experiments using an excess of unlabeled AP1 binding site demonstrated the specificity of the retarded bands (Fig. 4B; lane 5 vs. 6, lane 9 vs. 11, and lane 10 vs. 12). These results indicate that aging causes increased serum-inducible AP-1 DNA-binding activity.


Figure 4
View larger version (28K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Age-dependent increase in AP1 and CRE DNA-binding activity. VSMCs isolated from old and young rabbits were serum-starved and then serum restimulated for the indicated periods of time (in hours). Similar results were obtained with 2 different sets of cells (i.e. cells isolated from 2 young and 2 old animals). Representative results are shown. (A) Western blot analysis for the AP1 transcription factor c-fos. Below each line is shown the amount of c-fos as revealed by densitometric analysis. Results are expressed relative to the amount of c-fos in starvation-synchronized young cells (first lane=1). Both basal c-fos expression in starvation-synchronized cells (0) and 12 h after serum restimulation was higher in old cultures as compared to young cells. (B) Electrophoretic mobility shift assays were carried out with a radiolabeled double-stranded oligonucleotide probe spanning the AP1 consensus binding site. Competition assays were performed by preincubating the cell lysates with a 20-fold molar excess of unlabeled oligonucleotide (lanes 6, 11 and 12). (C) Electrophoretic mobility shift assays were carried out with a radiolabeled probe containing the CRE sequence from the human cyclin A gene promoter. For competition assays, cell lysates were preincubated with a 20-fold molar excess of unlabeled CRE wild type (wt) or mutant (mt) oligonucleotide. Only the specific retarded bands are shown. (D) Supershift experiments using PAC1 cells and anti-c-fos antibodies demonstrated the interaction of c-fos with the cyclin A CRE in VSMCs.

 
VSMC proliferation induced by serum in vitro and balloon angioplasty in vivo is associated with increased binding of c-fos to the cAMP-responsive element (CRE) in the cyclin A promoter, and this interaction is essential for c-fos-dependent induction of cyclin A gene expression [25]. Therefore, we next investigated the DNA-binding activity associated with the cyclin A CRE in young and old VSMCs. As shown in Fig. 4C, serum stimulation caused a transient increase in CRE-dependent binding activity in both young (lanes 1–3) and old (lanes 8–10) VSMCs. However, maximum activity at 12 h after addition of serum was more pronounced in old VSMCs (Fig. 4C, compare lanes 2 and 9). Incubation with an excess of unlabeled wild-type CRE oligonucleotide was efficient at reducing binding (Fig. 4C; lanes 1–3 vs. 4–6, and 8–10 vs. 11–13), whereas an oligonucleotide containing a mutated CRE sequence did not compete (Fig. 4C; lane 3 vs. 7, and lane 10 vs. 14). To demonstrate the interaction of c-fos with the cyclin A CRE in VSMCs, supershift experiments were performed using anti-c-fos antibodies. As shown in Fig. 4D, these antibodies produced a supershift when added to reaction mixtures containing the cyclin A CRE probe and lysates from serum-stimulated VSMCs. Age-dependent increase in c-fos protein levels and CRE-binding activity was also seen using other preparations of young and old VSMCs (data not shown). Collectively, these results suggest that age-dependent increase in the expression and DNA-binding activity of c-fos contribute to augmented cyclin A expression in old VSMCs.


    4 Discussion
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
Aging can be defined as a progressive deterioration of biological functions after the organism has attained its maximal reproductive competence [48]. At the cellular level, this is usually associated with a decrease in proliferative ability in most cell types [1]. However, in certain pathological situations such as cancer and atherosclerosis, aging seems to be associated with a paradoxical increase in cellular proliferation. According to the response-to-injury hypothesis, abnormal VSMC proliferation plays an important role in the pathogenesis of atherosclerosis and restenosis [6–11]. In this regard, several in vitro and in vivo studies have suggested that an age-dependent increase in VSMC proliferation may contribute to the increased risk of atherosclerosis seen with aging [15–20]. To our knowledge, the present study reports for the first time changes in the transcriptional and cell cycle machinery that might be involved in this age-dependent increase in VSMCs proliferation.

In all our experiments we used early passage (P2 or P3) rabbit VSMCs isolated from the aortas of young and old animals. Consistent with previous findings in rats [15–19], rabbit VSMCs showed a significant age-dependent increase in proliferative activity in vitro (Fig. 1A,B and data not shown). This increase in cellular proliferation was associated with a shortening of the cell cycle in old VSMCs (Fig. 1C). We therefore hypothesized that aging was associated with increased expression of positive regulators of the cell cycle machinery in VSMCs. CDK2 and its regulatory subunits, cyclin E and A have been shown to be essential for progression through G1 and S phase of the cell cycle [35–38], and their expression is induced in human and rat arteries following vascular injury [39,40]. Therefore, we analyzed the expression of these cell-cycle regulators in VSMCs isolated from young and old rabbits. Our results demonstrate that age-dependent increased proliferation following serum restimulation of starvation-synchronized VSMCs is associated with higher cyclin A and CDK2 protein levels, without significant change in the level of cyclin E expression (Fig. 2 and data not shown). Of note, disruption of CDK2 [49] and cyclin A [50–52] function inhibits S-phase entry and overexpression of cyclin A accelerates the G1-to-S transition [53,54], suggesting that cyclin A expression can be rate limiting for cellular proliferation. Thus, age-dependent increase in cyclin A and CDK2 expression might contribute to enhanced proliferation in old VSMCs.

To further characterize the increased expression of cyclin A in old VSMCs, we analyzed the activity of reporter genes containing a luciferase expression cassette under the transcriptional control of the human cyclin A promoter region extending from –924 to +245. Previous studies on fibroblasts [28,41–44] and pulmonary arterial VSMCs [25] have demonstrated that the cyclin A gene is transcribed in a cell cycle-dependent manner, starting in late G1 and increasing until G2 phase. As expected, our results show a marked induction of cyclin A promoter activity in both young and old VSMCs, although maximum activity was significantly increased in old versus young VSMCs (Fig. 3). Thus, the higher expression of cyclin A in old VSMCs seems to be due, at least in part, to a higher level of transcriptional activity.

The expression and/or the binding activity of several transcription factors have been shown to be modified during aging [48]. In general, the reduced capability of senescent cells to proliferate has been associated with a reduction in the binding activity of several transcription factors including AP1, stimulatory protein-1 (Sp1), age-dependent factor (ADF), heat shock factor-1 (HSF-1) and E2F. AP1 transcription factors (i.e. c-fos and c-jun) have been shown to constitute a critical control point for G1 progression [21,22]. In senescent fibroblasts, c-fos expression is markedly reduced and cannot be induced by the mitogenic constituents of blood serum [23,24]. Here we sought to determine whether increased activity of c-fos could account for the age-dependent increase in cyclin A expression and cellular proliferation in VSMCs. Both c-fos and c-jun have been shown to be induced in the arterial wall after balloon angioplasty [25,45–47]. Moreover, we have recently shown that c-fos, through its interaction with the CRE site in the cyclin A promoter, contributes to Ras-dependent induction of cyclin A gene expression and VSMC growth [25]. Increased binding of c-fos to the cyclin A CRE preceded the onset of DNA replication in VSMCs induced by serum in vitro and by angioplasty in vivo. Taken together, these findings suggest that c-fos is a critical component of the signaling cascade that links Ras activity to VSMC proliferation and neointimal lesion formation. Using a consensus AP-1 probe, we show here a marked age-associated increase in AP1 DNA-binding activity after serum restimulation of starvation-synchronized cells (Fig. 4B). Likewise, old VSMCs disclosed increased binding to the CRE site in the cyclin A promoter (Fig. 4C), consistent with a role of c-fos in age-dependent increase of cyclin A expression and VSMC proliferation. Our results also show a 6-fold increase in cyclin A promoter activity even in serum-starved old VSMCs (Fig. 3D), which disclosed a 2.4-fold increase in c-fos protein levels than their young counterparts (Fig. 4A and data not shown). In this regard, McCaffrey et al. have demonstrated that older VSMCs display increased proliferation even in the absence of mitogens [16]. Thus, this predisposition of old VSMCs to proliferate faster than young cells may be related to higher basal levels of c-fos.

Whether the upregulation of c-fos activity in old VSMCs is a primary event or secondary to stimulation from upstream signals is presently unknown. For example, previous studies have documented an increased response to stimulatory growth factors (i. e., PDGF) and a decreased response to inhibitory growth factors (i. e., TGF-β) in old VSMCs [16,55], which could lead to higher c-fos expression and activity. Likewise, the results of the present study do not rule out the involvement of mitogenic inhibitory proteins in the age-dependent regulation of VSMCs growth. In this regard, it has been suggested that the cyclin-dependent kinase inhibitor p27 contributes to VSMC growth arrest in vitro and during vascular remodeling after arterial injury [31,56]. However, we have found similar levels of p27 protein in old and young cultured VSMCs (data not shown).

In summary, our results suggest that augmented cyclin A expression via the action of the AP1 transcription factor c-fos contributes to increased VSMC proliferation with advanced age. To the best of our knowledge, these findings illustrate for the first time a transcriptional regulatory network that might contribute to the increased prevalence and severity of atherosclerosis in the elderly.

Time for primary review 27 days.


    Acknowledgements
 
Supported in part by grants to V. A. from the Spanish Dirección General de Enseñanza Superior e Investigación Cientìfica (PM97-0136), and National Institutes of Health (AG15227). A. R. is supported by a grant from the Heart and Stroke Foundation of Canada.


    Notes
 
1 Present address: Department of Medicine (Cardiology), Centre Hospitalier de l’Université de Montréal, Montréal, Québec, H2L 4M1 Canada. Back


    References
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 

  1. Smith J.R., Pereira-Smith O.M. Replicative senescence: implications for in vivo aging and tumor suppression. Science (1996) 273:63–67.[Abstract]
  2. Cohen H.J. Biology of aging as related to cancer. Cancer (1994) 74:2092–2100.[CrossRef][ISI][Medline]
  3. Roberts J., Goldberg P.B. Changes in basic cardiovascular activities during the lifetime of the rat. Exp Aging Res (1976) 2:487–517.[Medline]
  4. Folkow B., Svanborg A. Physiology of cardiovascular aging. Physiol Rev (1993) 73:725–764.[Free Full Text]
  5. Marín J. Age-related changes in vascular responses: a review. Mech Ageing Dev (1995) 79:71–114.[CrossRef][ISI][Medline]
  6. Owens G.K. Regulation of differentiation of vascular smooth muscle cells. Physiol Rev (1995) 75:487–517.[Abstract/Free Full Text]
  7. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature (1993) 362:801–809.[CrossRef][Medline]
  8. Fuster V., Badimón L., Badimón J.J., Chesebro J.H. The pathogenesis of coronary artery disease and the acute coronary syndromes. N Engl J Med (1992) 236:242–250.
  9. Hegele R.A. The pathogenesis of atherosclerosis. Clin Chim Acta (1996) 246:21–38.[CrossRef][ISI][Medline]
  10. Libby P., Schwartz D., Brogi E., Tanaka H., Clinton S.K. A cascade model for restenosis: a special case of atherosclerosis progression. Circulation (1992) 86:III47–III52. (Supplement).[Medline]
  11. Spyridopoulos I., Andrés V. Control of vascular smooth muscle and endothelial cell proliferation and its implication in cardiovascular disease. Front Biosc (1998) 3:269–287.
  12. Leimgruber P.P., Roubin G.S., Hollman J., Cotsonis G.A., Meier B., Douglas J.S., King S.B., Gruentzig A.R. Restenosis after successful coronary angioplasty in patients with single-vessel disease. Circulation (1986) 73:710–717.[Abstract/Free Full Text]
  13. Nobuyosihi M., Kimura T., Nosaka H., Mioka S., Ueno K., Yokoi H., Hamasaki N., Horiuchi H., Ohishi H. Restenosis after successful percutaneous transluminal coronary angioplasty: serial angiographic follow-up of 229 patients. J Am Col Cardiol (1988) 12:616–623.[Abstract]
  14. RITA Trial Participants. Coronary angioplasty versus coronary artery bypass surgery: the Randomised Intervention Treatment of Angina (RITA) trial. Lancet 1993;341:573–580.
  15. Hariri R.J., Hajjar D.P., Coletti D., Alonso D.R., Wekser M.E., Rabellino E. Aging and atherosclerosis. Cell cycle kinetics of young and old arterial smooth muscle cells. Am J Pathol (1988) 131:132–136.[Abstract]
  16. McCaffrey T.A., Nicholson A.C., Szabo P.E., Weksler M.E., Weksler B.B. Aging and atherosclerosis. The increased proliferation of arterial smooth muscle cells isolated from old rats is associated with increased platelet-derived growth factor-like activity. J Exp Med (1988) 167:163–174.[Abstract/Free Full Text]
  17. Porreca A., Ciccarelli R., Di Febbo C., Cuccurullo F. Protein kinase C pathway and proliferative response of aged and young rat vascular smooth muscle cells. Atherosclerosis (1993) 104:137–145.[CrossRef][ISI][Medline]
  18. Bochaton-Piallat M.L., Gabbiani F., Ropraz P., Gabbiani G. Age influences the replicative activity and the differentiation features of cultured rat aortic smooth muscle cell populations and clones. Arterioscler Thromb (1993) 13:1449–1455.[Abstract/Free Full Text]
  19. Stemerman M.B., Weinstein R., Rowe J.W., Maciag T., Fuhro R., Gardner R. Vascular smooth muscle cell growth kinetics in vivo in aged rats. Proc Natl Acad Sci USA (1982) 79:3863–3866.[Abstract/Free Full Text]
  20. Hariri R., Alonso D.R., Hajjar D.P., Coletti D., Weksler M.E. Aging and atherosclerosis. I. Development of myointimal hyperplasia following endothelial injury. J Exp Med (1986) 164:1171–1178.[Abstract/Free Full Text]
  21. Angel P., Karin M. The role of Jun, Fos and the AP-1 complex in cell proliferation and transformation. Biochim Biophys Acta (1991) 1072:129–157.[Medline]
  22. Karin M., Liu Z., Zandi E. AP-1 function and regulation. Curr Opin Cell Biol (1997) 9:240–246.[CrossRef][ISI][Medline]
  23. Riabowol K., Schiff J., Gilman M.Z. Transcription factor AP-1 activity is required for initiation of DNA synthesis and is lost during cellular aging. Proc Natl Acad Sci USA (1992) 89:157–161.[Abstract/Free Full Text]
  24. Seshadri T., Campisi J. Repression of c-fos transcription and an altered genetic program in senescent human fibroblasts. Science (1990) 247:205–209.[Abstract/Free Full Text]
  25. Sylvester A.M., Chen D., Krasinski K., Andres V. Role of c-fos and E2F in the induction of cyclin A transcription and vascular smooth muscle cell proliferation. J Clin Invest (1998) 101:940–948.[ISI][Medline]
  26. Pickering J.G., Weir L., Rosenfield K., Stetz J., Jekanowski J., Isner J.M. Smooth muscle cell outgrowth from human atherosclerotic plaque: implications for the assessment of lesion biology. J Am Coll Cardiol (1992) 20:1430–1439.[Abstract]
  27. Libby P., O’Brien K.V. Culture of quiescent vascular smooth muscle cells in a defined serum-free medium. J Cell Physiol (1983) 115:217–223.[CrossRef][ISI][Medline]
  28. Henglein B., Chenivesse X., Wang J., Eick D., Bréchot C. Structure and cell cycle-regulated transcription of the human cyclin A gene. Proc Natl Acad Sci USA (1994) 91:5490–5494.[Abstract/Free Full Text]
  29. Henthorn P., Zervos P., Raducha M., Harris H., Kadesch T. Expression of a human placental alkaline phosphatase gene in transfected cells: use as a reporter for studies of gene expression. Proc Natl Acad Sci USA (1988) 85:6342–6346.[Abstract/Free Full Text]
  30. Andrés V., Fisher S., Wearsch P., Walsh K. Regulation of Gax homeobox gene transcription by a combination of positive factors including MEF2. Mol Cell Biol (1995) 15:4272–4281.[Abstract]
  31. Chen D., Krasinski K., Chen D., Sylvester A., Chen J., Nisen P.D., Andrés V. Downregulation of cyclin-dependent kinase 2 activity and cyclin A promoter activity in vascular smooth muscle cells by p27Kip1, an inhibitor of neointima formation in the rat carotid artery. J Clin Invest (1997) 99:2334–2341.[ISI][Medline]
  32. Laemmli U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (1970) 227:680–685.[CrossRef][Medline]
  33. Desdouets C., Matesic G., Molina C.A., Foulkes N.S., Sassone-Corsi P., Bréchot C., Sobczak-Thépot J. Cell cycle regulation of cyclin A gene expression by the cyclic AMP-responsive transcription factors CREB and CREM. Mol Cell Biol (1995) 15:3301–3309.[Abstract]
  34. Rothman A., Kulik T.J., Taubman M.B., Berk B.C., Smith C.W.J., Nadal-Ginard B. Development and characterization of a cloned rat pulmonary arterial smooth muscle cell line that maintains differentiated properties through multiple subcultures. Circulation (1992) 86:1977–1986.[Abstract/Free Full Text]
  35. Pardee A.B. G1 events and regulation of cell proliferation. Science (1989) 246:603–608.[Abstract/Free Full Text]
  36. Sherr C.J. Cancer cell cycles. Science (1996) 274:1672–1677.[Abstract/Free Full Text]
  37. Hunter T., Pines J. Cyclins and cancer: cyclin D and cdk inhibitors come on age. Cell (1994) 79:573–582.[CrossRef][ISI][Medline]
  38. Morgan D.O. Principles of CDK regulation. Nature (1995) 374:131–134.[CrossRef][Medline]
  39. Wei G.L., Krasinski K., Kearney M., Isner J.M., Walsh K., Andrés V. Temporally and spatially coordinated expression of cell cycle regulatory factors after angioplasty. Circ Res (1997) 81:418–426.
  40. Kearney M., Pieczek A., Haley L., Losordo D.W., Andrés V., Schainfield R., Rosenfeld R., Isner J.M. Histopathology of in-stent restenosis in patients with peripheral artery disease. Circulation (1997) 95:1998–2002.[Abstract/Free Full Text]
  41. Zwicker J., Liu N., Engeland K., Lucibello F.C., Müller R. Cell cycle regulation of E2F site occupation in vivo. Science (1996) 271:1595–1597.[Abstract]
  42. Schulze A., Zerafass K., Spitkovsky D., Middendorp S., Berges J., Helin K., Jansen-Dürr P., Henglein B. Cell cycle regulation of the cyclin A gene promoter is mediated by a variant E2F site. Proc Natl Acad Sci USA (1995) 92:11264–11268.[Abstract/Free Full Text]
  43. Huet X., Rech J., Plet A., Vié A., Blanchard J.M. Cyclin A expression is under negative transcriptional control during the cell cycle. Mol Cell Biol (1996) 16:3789–3798.[Abstract]
  44. Desdouets C., Ory C., Matesic G., Soussi T., Bréchot C., Sobczak-Thépot J. ATF/CREB site mediated transcriptional activation and p53 dependent repression of the cyclin A promoter. FEBS Lett (1996) 385:34–38.[CrossRef][ISI][Medline]
  45. Miano J.M., Vlasic N., Tota R.R., Stemerman M.B. Localization of Fos and Jun proteins in rat aortic smooth muscle cells after vascular injury. Am J Pathol (1993) 142:715–724.[Abstract]
  46. Miano J.M., Tota R.R., Vlasic N., Danishefsky K.J., Stemerman M.B. Early proto-oncogene expression in rat aortic smooth muscle cells following endothelial removal. Am J Pathol (1990) 137:761–765.[Abstract]
  47. Mills C.J., Northrup J.L., Hullinger T.G., Simmons C.A., Shebuski R.J., Jones D.A. Temporal expression of c-fos mRNA following balloon injury in the rat common carotid artery. Cardiovascular Res (1996) 32:954–961.[Abstract/Free Full Text]
  48. Roy A.K. Transcription factors and aging. Mol Med (1997) 3:496–504.[ISI][Medline]
  49. van den Heuvel S., Harlow E. Distinct roles for cyclin-dependent kinases in cell cycle control. Science (1993) 262:2050–2054.[Abstract/Free Full Text]
  50. Girard F., Strausfeld U., Fernández A., Lamb N. Cyclin A is required for the onset of DNA replication in mammalian fibroblasts. Cell (1991) 67:1169–1179.[CrossRef][ISI][Medline]
  51. Pagano M., Pepperkok R., Verde F., Ansorge W., Daretta G. Cyclin A is required at two points in the human cell cycle. EMBO J (1992) 11:961–971.[ISI][Medline]
  52. Zindy F., Lamas E., Chenivesse X., Sobczak-Thépot J., Wang J., Fesquet D., Henglein B., Bréchot C. Cyclin A is required in S phase in normal epithelial cells. Biochem Biophys Res Commun (1992) 182:1144–1154.[CrossRef][ISI][Medline]
  53. Resnitzky D., Hengst L., Reed S.I. Cyclin A-associated kinase activity is rate limiting for entrance into S phase and is negatively regulated in G1 by p27Kip1. Mol Cell Biol (1995) 15:4347–4352.[Abstract]
  54. Rosenberg A.R., Zindy F., Le Deist F., Mouly H., Metezeau P., Bréchot C., Lamas E. Overexpression of human cyclin A advances entry into S phase. Oncogene (1995) 10:1501–1509.[ISI][Medline]
  55. McCaffrey T.A., Falcone D.J. Evidence for age-related dysfunction in the antiproliferative response to transforming growth factor-beta in vascular smooth muscle cells. Mol Biol Cel (1993) 4:315–322.[Abstract]
  56. Tanner F.C., Yang Z.-Y., Duckers E., Gordon D., Nabel G.J., Nabel E.G. Expression of cyclin-dependent kinase inhibitors in vascular disease. Circ Res (1998) 82:396–403.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Rivard, A.
Right arrow Articles by Andrés, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rivard, A.
Right arrow Articles by Andrés, V.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?