Skip Navigation

Cardiovascular Research 2000 45(3):570-578; doi:10.1016/S0008-6363(99)00346-6
© 2000 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Perlman, H.
Right arrow Articles by Walsh, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Perlman, H.
Right arrow Articles by Walsh, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2000, European Society of Cardiology

Adenovirus-encoded hammerhead ribozyme to Bcl-2 inhibits neointimal hyperplasia and induces vascular smooth muscle cell apoptosis

Harris Perlman1,a,b, Masataka Sataa, Kevin Krasinskia, Thambi Doraic, Ralph Buttyanc and Kenneth Walsha,b,*

aDivision of Cardiovascular Research, St. Elizabeth's Medical Center, Tufts University School of Medicine, 736 Cambridge St., Boston, MA 02135, USA
bProgram in Cell, Molecular and Developmental Biology, Sackler School of Biomedical Studies, Tufts University, 136 Harrison Ave., Boston, MA 02111, USA
cDivision of Urologic Oncology, Department of Urology, Columbia Presbyterian Medical Center, 680 West 168th Street, New York, NY 10033, USA

* Corresponding author. Tel.: +1-617-562-7501; fax: +1-617-562-7506 kwalsh{at}opal.tufts.edu

Received 3 May 1999; accepted 20 September 1999


    Abstract
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
Objective: The balance between apoptosis and cell proliferation is vital for cellular homeostasis, yet little is known about the mechanisms that coordinate these two cell fates, particularly in the vessel wall. It is well established that the members of Bcl-2-gene family are regulators of apoptosis, but their role in cellular proliferation is less clear. Methods: We analyzed the effects of disrupting Bcl-2 expression in vascular smooth muscle cells (VSMCs) by adenoviral-mediated delivery of a hammerhead ribozyme against bcl-2 mRNA (Ad-Rbz-Bcl-2). Results: Forced ablation of Bcl-2 in balloon-injured rat carotid arteries reduced cell number and inhibited neointimal hyperplasia. In vitro, VSMCs transduced with the Ad-Rbz-Bcl-2 underwent apoptosis as indicated by a reduction in cell number and DNA fragmentation. Ad-Rbz-Bcl-2-transduced cells also exhibited aberrations in both G1- and S-phases of the cell cycle. However, forced perturbations in cell cycle activity by serum-stimulation or treatment with chemical inhibitors did not affect Ad-Rbz-Bcl-2-induced cell death, indicating that these cell cycle changes are not essential for apoptosis. Conclusion: These data show that physiological levels of Bcl-2 are essential for VSMC viability and that ablation of Bcl-2 alters cell cycle activity through the execution of the apoptotic process.

KEYWORDS Apoptosis; Gene therapy; Gene expression; Restenosis; Smooth muscle; Angioplasty


    1 Introduction
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
Numerous studies have demonstrated increased VSMC proliferation and apoptosis in atherosclerotic lesions [1–5] and following acute arterial injury [6–12]. These processes may also have important roles during blood vessel development as it has been reported that VSMCs of the abdominal aorta undergo high rates of apoptosis immediately after birth [13] and localized VSMC-apoptosis is associated with remodeling of the human ductus arteriosus [14]. Since the balance between VSMC proliferation and death may be critical in the control of vascular remodeling, the identification and manipulation of genes that can affect both processes may be useful in studies of proliferative vessel wall disorders.

Bcl-2 was first identified as an oncogene translocated from chromosome 18 to the heavy chain immunoglobin locus of chromosome 14 in B-cell follicular lymphoma [15]. Overexpression of Bcl-2 inhibits apoptosis induced by a variety of circumstances including growth factor withdrawal, DNA damage, Fas or tumor necrosis factor {alpha} (TNF{alpha}) receptor ligation, or by conflicting subcellular signaling events [16]. Overexpression of Bcl-2 can also modulate cell cycle activity by promoting quiescence [17].

Ribozymes provide a unique tool for understanding gene function because they allow one to assess cellular responses to a rapid ablation of target gene expression. Hammerhead ribozymes bind to RNA in an antisense manner and cleave bound RNA by means of an intrinsic enzyme-like activity [18]. Compared to antisense molecules, ribozymes may be more efficient in downregulating targeted RNA due to their catalytic activity. Recently, VSMC proliferation has been shown to be inhibited by hammerhead ribozyme oligonucleotides to c-myb [19] apolipoprotein [20] and PCNA [21]. To date, hammerhead ribozyme technology has not been utilized to study apoptosis regulatory genes in VSMCs nor have ribozymes been delivered to VSMCs via a replication-defective adenovirus vector which can efficiently transfect VSMCs in vitro and in vivo.

Since Bcl-2 regulates apoptosis and proliferation, key features of stenotic lesion formation in the vasculature [9,11], we examined the effects of acutely disrupting Bcl-2 expression in VSMCs in vitro and in vivo by adenovirus-mediated delivery of a hammerhead ribozyme directed against bcl-2 mRNA (Ad-Rbz-Bcl-2). In a rat model of injury-induced smooth muscle hyperplasia, Ad-Rbz-Bcl-2 attenuated VSMC accumulation and decreased intimal lesion mass. To examine the functional properties of acute Bcl-2 ablation, VSMC cultures were transduced with Ad-Rbz-Bcl-2 and assessed for viability and cell cycle activity. These cultures displayed decreased cell number and increased hypodiploid DNA content, a characteristic of apoptosis. VSMCs transduced with Ad-Rbz-Bcl-2 also displayed cell cycle defects in both low and high serum media. Inhibition of caspase 3 activity partially restored cell cycle activity and reduced hypodiploid DNA content. These data suggest that physiological levels of Bcl-2 in VSMCs are essential for survival and proper cell cycle regulation.


    2 Methods
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
2.1 Cell culture
Cells were incubated at 37°C in Dulbecco's modified Eagle medium (DMEM) containing 10% fetal bovine serum (FBS) and penicillin/streptomycin. Primary cultures of rat smooth muscle cells were prepared from thoracic aortas of adult male Sprague–Dawley rats according to Mader et al. [23]. Rat VSMCs were made quiescent by incubation in 0.5% FBS/DMEM for 2–3 days. Cells were then counted and cultures were incubated with the indicated amounts of adenovirus for 12 h in low mitogen medium. At the end of the infection period the virus was removed by washing with PBS and returned to low mitogen medium for an additional 12 h. The cultures were then stimulated for 24–48 h by the addition of growth (10% FBS) medium.

2.2 Replication-defective adenovirus construction and preparation
The SalI–HindIII fragment containing the human Bcl-2 ribozyme cassette from pBluescript KS [22] was inserted into the pACCMV.pLpA vector containing the Ad5 adenoviral sequences required for homologous recombination [24]. The resulting plasmid was cotransfected in 293 cells with large pJM17 plasmid. The resulting replication-defective recombinant adenoviruses were purified from isolated plaques. The viral preparations used for both in vitro and in vivo studies were purified by CsCl gradient centrifugations, dialyzed against buffer containing 10 mM Tris–HCl pH 7.5, 1 mM MgCl2 and 135 mM NaCl and stored at –80°C in 10% glycerol. Viral titer was determined by plaque assay on 293 cells as previously described [25] and expressed as plaque forming units (pfu) per ml. The construction of the control Ad-β-Gal used in both the in vitro and in vivo studies has been previously described [26].

2.3 Reverse transcriptase–polymerase chain reaction (RT–PCR) analysis
Cultures were harvested for RNA preparation as described by Chomczynski et al. [27]. Total RNA (1 µg) was incubated in reaction buffer containing oligo (dT) primer, MMLV reverse transcriptase, reaction buffer and RNase inhibitor for 1 h at 42°C according to the manufacturer's specifications (Clontech). The reaction was stopped by incubation at 94°C for 5 min. Primers specific for rat Bcl-2 [28] were as follows: Forward 5' CTGCGCTCAGCCCTGTGCCAC 3'; Reverse 5' CAGGGCCAGGCTGAGCA 3'. The PCR reaction was carried out with 5 U Taq polymerase (Perkin Elmer) in a total volume of 100 µl. Amplification was performed for 28 cycles (30 s denaturing at 94°C, 45 s annealing at 50°C, and 90 s extension at 72°C) in a thermal cycler. Control rat β-actin primers were used under parallel conditions (Clontech). The 407 bp Bcl-2 and 764 bp β-actin amplified products were analyzed by 1.5% agarose gel electrophoresis and visualized under UV illumination after staining with ethidium bromide.

2.4 Western blot analysis
Whole-cell extracts were prepared from uninfected and infected cultured primary rat VSMCs. Extract of 25–100 µg were analyzed by SDS–PAGE on 12.5% polyacrylamide gels, and transferred to Immobilon-P (Millipore) by semidry blotting. Filters were blocked for 1 h at room temperature in phosphate-buffered saline PBS/0.2%, Tween 20/5% nonfat dry milk. The filters were then incubated with either mouse anti-PCNA (Signet), anti-tubulin, anti-cyclin A (Calbiochem), anti-Bcl-2, or anti-Bcl-x antibodies (Transduction Laboratories) at a concentration of 0.25–0.4 µg/ml. Rabbit anti-Bax, anti-cyclin E, anti-cdk2, anti-cyclin A, anti-cdc2 (Santa Cruz), and rabbit Ig (Sigma) were used at a concentration of 0.25–0.4 µg/ml overnight at 4°C in PBS with 0.2%, Tween 20 and 2% nonfat dry milk. Filters were washed in PBS/0.2%, Tween 20/2% nonfat dry milk, and incubated with donkey anti-rabbit or anti-mouse secondary antibody (1:2000 dilution) conjugated to horseradish peroxidase (Amersham). Visualization of the immuno-complex was carried out as recommended by the manufacturer (Enhanced Chemiluminescence kit; Amersham).

2.5 Rat model of smooth muscle hyperplasia
The carotid artery model of balloon injury in male Sprague–Dawley rats (400–500 g) was based on that described by Clowes et al. [7]. Immediately after injury, Ad-Rbz-Bcl-2 or Ad-β-Gal (1x109 pfu in a volume of 100 µl) was injected via a cannula inserted just proximal to the carotid bifurcation into a temporarily isolated segment of the artery. The adenovirus solution was incubated for 20 min after which the viral infusion was withdrawn and the cannula removed. Rats were sacrificed at 14 days following treatment with an intraperitoneal injection of pentobarbital (100 mg/kg). Tissue was fixed in 100% methanol and embedded in paraffin. Sections from each specimen were stained with Richardson's combination elastic-trichrome stain for conventional light microscopic analysis. Histological images of cross sections were projected onto a digitizing board (Summagraphics) and the intimal, medial and luminal areas were measured by quantitative morphometric analysis using a computerized sketching program (MACMEASURE, version 1.9, National Institute of Mental Health). Medial cell number was calculated in multiple sections (n=12) by counting the number of nuclei per section stained with hematoxylin and eosin or Hoechst 33258 (Sigma). This experimental protocol was approved by the Institutional Animal Care and Use Committee and complied with the Guide for the Care and Use of Laboratory Animals (NIH Publication No. 86-23, revised 1985).

2.6 Flow cytometric analysis of transduced VSMC cultures
Apoptosis and cell cycle profiles were determined by flow cytometry utilizing a Beckton Dickinson Vantage flow cytometer and Lysis II cell cycle analysis software. Flow cytometry was conducted at the Core Flow Cytometry Facility of the Dana–Farber Cancer Institute, Boston, MA. Ten µM caspase 1 inhibitor (YVAD-fmk) and 20 µM caspase 3 inhibitor (DEVD-fmk) (Clontech) were added to infected cells prior to infection and replaced after infection.

2.7 Statistical analysis
Results were expressed as the mean±standard error of mean (S.E.M.). Differences between two groups were analyzed using an unpaired two-tailed Student's t-test. Alternatively, statistical significance was evaluated by ANOVA followed by Scheffe's procedure.


    3 Results
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
3.1 Adenovirus encoding a Bcl-2-targeting ribozyme selectively downregulates Bcl-2 expression in VSMCs in vitro
A replication defective adenovirus expressing the Bcl-2 ribozyme from the cytomegalovirus promoter (Ad-Rbz-Bcl-2) was constructed (Fig. 1(A)). The regulatory properties of Ad-Rbz-Bcl-2 were compared to those of a control virus, Ad-β-Gal, which expresses the gene for β-Galactosidase under the control of the CMV promoter. The efficiency of adenovirus-mediated gene delivery is such that rat VSMC cultures can be quantitatively transduced with transgene when incubated with virus at a multiplicity of infection of 500 [29], permitting biochemical analyses on whole cell populations following infection. RT–PCR analysis revealed that bcl-2 mRNA expression was attenuated in the cultures infected with Ad-Rbz-Bcl-2 (Fig. 1(B)). Immunoblot analysis of VSMCs transduced with Ad-Rbz-Bcl-2 displayed a marked decrease of Bcl-2 protein (Fig. 1(C)). The expression levels of the Bcl-2 homologous proteins, Bax and Bcl-XL were unaffected, indicating that the ribozyme is a specific inhibitor of Bcl-2.


Figure 1
View larger version (19K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Adenoviral transduction of a ribozyme against bcl-2 mRNA reduces Bcl-2 expression. (A) Structure of the adenovirus encoding a ribozyme directed against bcl-2 (Ad-Rbz-Bcl-2). (B) Ad-Rbz-Bcl-2 reduces bcl-2 mRNA in infected VSMCs. Quiescent VSMCs were transduced at a multiplicity of infection of 500 pfu/cell of Ad-β-Gal or Ad-Rbz-Bcl-2 for 12 h, after which the virus was removed and cultures were returned to low mitogen medium for an additional 12 h. Growth medium was then added for 12 h. RT–PCR analysis was performed on total RNA from transduced cultures and the 407 bp Bcl-2 and 764 bp β-actin PCR fragments were fractionated on 1.5% agarose gel and visualized by ethidium bromide staining. (C) Ad-Rbz-Bcl-2 reduces Bcl-2, but not Bax or Bcl-xL expression. Whole cell extracts were prepared from indicated quiescent and serum-stimulated cultures that were infected with Ad-β-Gal or Ad-Rbz-Bcl-2. Immunoblot analysis was performed with antibodies directed against the indicated proteins. Tubulin immunoblot indicates equal loading of protein (25 µg).

 
3.2 Localized delivery of Ad-Rbz-Bcl-2 inhibits VSMCs hyperplasia in balloon-injured rat carotid arteries
Ad-Rbz-Bcl-2-treatment markedly attenuated the hyperproliferative response of VSMCs in balloon-injured rat carotid arteries (Fig. 2(A)). Vessels transduced with Ad-Rbz-Bcl-2 displayed a 46% (P<0.03) decrease in neointimal area, a 48% (P<0.02) decrease in intima/medial ratio and a 43% (P<0.04) decrease in luminal narrowing compared to the Ad-β-Gal treated vessels (Fig. 2(B)). The action of Ad-Rbz-Bcl-2 on medial hyperplasia was also assessed by examining medial VSMC number at 3 days post-injury. At this time point, Ad-Rbz-Bcl-2 treated arteries displayed significantly fewer (P<0.02) medial cells compared to the uninjured or Ad-β-Gal-treated vessels (Fig. 2(C)). Immunohistochemical analyses of these sections did not reveal detectable differences in smooth muscle {alpha}-actin expression by medial VSMCs in the Ad-Rbz-Bcl-2- and Ad-β-Gal-treated groups.


Figure 2
View larger version (41K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Ad-Rbz-Bcl-2 inhibits neointimal formation and luminal narrowing in the rat carotid model of VSMC hyperplasia. (A) Cross sections of rat carotid arteries reveal Ad-Rbz-Bcl-2-specific inhibition of neointimal formation and luminal narrowing. The common carotid artery of male Sprague–Dawley rats (n=14) were deendothelialized by distention with a balloon catheter to induce the hyperproliferation of VSMCs. The deendothelialized region was then treated with 1x109 pfu of adenovirus in solution for 20 min. The rats were sacrificed at 14 days following treatment and the treated region of each artery was recovered at necropsy. Representative photomicrographs of Richardson's combination elastic-trichrome stain of cross sections from the arteries treated with Ad-β-Gal or Ad-Rbz-Bcl-2. (B) Quantitative analysis of arterial cross sections treated with either Ad-β-Gal or Ad-Rbz-Bcl-2. Injured sections were projected on a digitizing board and the luminal, intimal and medial areas were measured by quantitative morphometric analysis using a computer sketching program. From these measurements the percent luminal narrowing and the intima/medial ratio were calculated. Values represent the mean±standard error and were compared for statistical significance by an unpaired two-tailed Student's t-test. (C) Ad-Rbz-Bcl-2 treatment following injury reduces medial cell number. Uninjured and Ad-Rbz-Bcl-2 or Ad-β-Gal treated (1x109 pfu) balloon injured rat carotid arteries (n=12) were harvested at 3 days post-injury. Cell number was assessed in multiple cross sections by counting the number of nuclei stained by hematoxylin or Hoechst 33258. Values represent the mean±standard error and were compared for statistical significance by unpaired 2-tailed Student's t-test. * indicates P<0.02 relative to uninjured or Ad-β-Gal-treated arteries.

 
3.3 Adenovirus-encoded Rbz-Bcl-2 induces VSMC-apoptosis
To assess mechanisms by which Ad-Rbz-Bcl-2 inhibits proliferative lesion formation, VSMC cultures were infected with Ad-Rbz-Bcl-2 and assessed for viability. Between 24 and 48 h following mitogen-activation, Ad-Rbz-Bcl-2-transduced VSMCs appeared to round-up and lift off the culture plate surface (not shown). A trypan blue exclusion assay revealed an 80–90% decrease in cell viability in VSMCs infected with Ad-Rbz-Bcl-2 compared to the Ad-β-Gal-treated cultures (Fig. 3(A)). Flow cytometric analysis was performed to quantify DNA fragmentation, a characteristic of apoptosis and not necrosis. VSMCs infected with Ad-Rbz-Bcl-2 exhibited hypodiploid DNA content (<2N), while Ad-β-Gal-transduced cultures had normal DNA profiles, devoid of subdiploid DNA (Fig. 3(B)). Notably, VSMC cultures infected with Ad-Rbz-Bcl-2 appeared to exhibit altered cell cycle kinetics by FACS analysis in that the proportion of cells in G2/M phase was reduced relative to S phase (Fig. 3(B)).


Figure 3
View larger version (17K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Ad-Rbz-Bcl-2 reduces VSMC viability. (A) Quantitative analysis of VSMC viability under mitogen-activation (48 h) conditions. Primary cultures of rat VSMCs were made quiescent for 72 h in low mitogen medium (0.5% FBS). Cells were transduced at a multiplicity of infection of 500 pfu/cell with either Ad-β-Gal or Ad-Rbz-Bcl-2 for 12 h, after which the virus was removed and cultures were returned to low mitogen medium for an additional 12 h. High serum medium was then added for 48 h to stimulate proliferation. For analysis of quiescent cells, parallel cultures were retained in low mitogen medium and harvested 72 h after infection. Cells were harvested by trypsinization, fixed and counted with a hemacytometer using the trypan blue exclusion method. Each time point represents the mean±standard error of three determinations from a representative experiment. (B) FACS analysis of serum-stimulated VSMC cultures. Quiescent VSMC cultures were infected with the indicated adenoviral construct at an MOI of 500 pfu/cell for 12 h after which the virus was removed and cultures were returned to low mitogen medium for an additional 12 h. Cultures were transferred to high serum for the indicated period of time prior to analysis by flow cytometry to determine DNA content.

 
3.4 Ad-Rbz-Bcl-2 affects VSMC-cell cycle progression
The effects of acute Bcl-2 ablation on VSMC cell cycle was assessed by flow cytometric analysis. Serum-stimulated VSMCs transduced with Ad-Rbz-Bcl-2 entered S-phase, but were deficient in their ability to progress to G2/M (Fig. 4(A)). In contrast, the Ad-β-Gal-infected cultures exhibited normal cell cycle progression similar to saline-treated cultures (not shown).


Figure 4
View larger version (22K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Ad-Rbz-Bcl-2 alters of cell cycle activity. (A) Ad-Rbz-Bcl-2 prevents progression into G2/M phases. Primary cultures of rat VSMC were made quiescent for 72 h in low mitogen medium (0.5% FBS). Cells were transduced at a multiplicity of infection of 500 pfu/cell of Ad-β-Gal or Ad-Rbz-Bcl-2 for 12 h, after which the virus was removed and cultures were returned to low mitogen medium for an additional 12 h. Growth medium was added for 24 h to allow cell cycle progression. Cells were harvested by trypsinization, fixed and stained with propidium iodide. DNA content was analyzed by flow cytometry. (B) Cell cycle regulatory protein expression is altered in Ad-Rbz-Bcl-2-transduced VSMCs. Quiescent VSMCs were mock-infected or infected with the indicated adenovirus construct at an MOI of 500 for 12 h in low mitogen medium. Virus was removed and cells were incubated in low mitogen medium for an additional 12 h before the virus-infected cells were stimulated with high-mitogen media for 24 h. Whole cell extracts were prepared from the cultures and subjected to SDS-PAGE on 12.5% polyacrylamide gels and transferred to Immobilon P for immunoblot analysis with antibody directed against the indicated protein. Tubulin immunoblot indicates equal loading of protein (25 µg).

 
Immunoblot analyses were performed on S and G2/M phase proteins to further investigate the effects of Ad-Rbz-Bcl-2 on cell cycle activity. The induction of cyclin E, cyclin A, cdk2, cdc2, and PCNA by serum-stimulation was markedly reduced in the Ad-Rbz-Bcl-2-transduced cultures (Fig. 4(B)). Immunoblots for cyclin A in VSMCs transduced with Ad-Rbz-Bcl-2 revealed a immunoreactive protein with an apparent molecular weight of ~40 kd, suggesting that cyclin A may be proteolyzed under these conditions.

Tetrapeptide inhibitors specific for the caspase 1 or caspase 3 family proteases were examined for their effect on Ad-Rbz-Bcl-2-induced apoptosis and altered cell cycle activity. An inhibitor of caspase 3 (DEVD-fmk), but not caspase 1 (YVAD-fmk), partially blocked DNA fragmentation induced by Bcl-2 ablation (Fig. 5(A)). Furthermore, cell cycle analysis revealed that treatment with the caspase 3 inhibitor markedly increased the percentage of Ad-Rbz-Bcl-2-infected cells entering G2/M phase compared to cultures treated with caspase 1 inhibitor or saline (Fig. 5(B)).


Figure 5
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Caspase 3, but not caspase 1 inhibitors rescues Ad-Rbz-Bcl-2 cultures from DNA fragmentation and altered cell cycle activity. (A) The caspase 3 inhibitor DEVD-fmk partially blocks Ad-Rbz-Bcl-2 induced apoptosis. Quiescent A7r5 VSMCs were either treated with saline, YVAD-fmk or DEVD-fmk and infected by the Ad-Rbz-Bcl-2 at an MOI of 500 pfu/cell for 12 h. After which the virus was removed and cultures were returned to low mitogen medium for an additional 12 h in the presence of the same caspase inhibitors. Cultures were then transferred to high serum and incubated with either saline, YVAD-fmk or DEVD-fmk for 36 h prior to analysis by flow cytometry to determine DNA content. (B) Caspase 3 inhibition restores cell cycle activity in Ad-Rbz-Bcl-2 infected cultures. Cultures treated as described above were also analyzed for cell cycle activity by FACS analysis.

 
Quantitative analyses of hypodiploid DNA revealed that mitogen-activated and quiescent cultures of VSMCs underwent similar extents of apoptosis when infected with Ad-Rbz-Bcl-2 (Fig. 6(A)). To test whether alterations in cell cycle activity are an essential feature of the apoptotic process induced by Bcl-2 ablation, serum-stimulated VSMCs infected with Ad-β-Gal or Ad-Rbz-Bcl-2 were also treated with rapamycin, which inhibits cells in G1 [30]. Flow cytometric analyses revealed that rapamycin treatment had no inhibitory effect on Ad-Rbz-Bcl-2-induced DNA fragmentation (Fig. 6(A)). However, G1 cell cycle arrest by this agent was evident in that control VSMCs were inhibited from serum-stimulated entry into S (Fig. 6(B)) and G2/M (Fig. 6(C)) phases of the cell cycle. Similar data were also obtained when cultures were incubated with mimosine (not shown), another cell cycle inhibitor [31]. Finally, cell cycle analysis revealed that Ad-Rbz-Bcl-2-transduced cultures entered S-phase even in low mitogen conditions while the control cultures remained in G0/G1 phase of the cell cycle (Fig. 6(B)).


Figure 6
View larger version (12K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 Ad-Rbz-Bcl-2-induced apoptosis and VSMC cell cycle activity. (A) Ad-Rbz-Bcl-2 induces apoptosis in cycling and non-cycling VSMCs. Primary cultures of rat VSMC were made quiescent for 72 h in low mitogen medium (0.5% FBS). Cells were transduced at a multiplicity of infection of 500 pfu/cell of Ad-β-Gal or Ad-Rbz-Bcl-2 for 12 h, after which the virus was removed and cultures were returned to low mitogen medium for an additional 12 h. Growth medium was added for 24 h to allow cell cycle progression. Parallel quiescent cultures were transferred to low serum for 24 h prior to analysis by flow cytometry to determine DNA content. Rapamycin (10 µM) was added to the indicated cultures at the time of serum stimulation. Cells were harvested by trypsinization, fixed and stained with propidium iodide. DNA content was analyzed by flow cytometry to determine the percentage of hypodiploid DNA content. (B) Ad-Rbz-Bcl-2 induces S-phase entry in cultures maintained in low-mitogen media. Cultures were infected as described above and S-phase entry was determined by FACS analysis. (C) Ad-Rbz-Bcl-2 prevents progression into G2/M phases. Cultures were infected as described above and the proportion of cells in G2/M-phase were determined by FACS analysis.

 

    4 Discussion
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
Tissue homeostasis depends on the balance of cell growth and death, and proper regulation of cell cycle activity is crucial for cell viability [32]. However, the mechanisms by which cell proliferation and cell death are coordinately regulated are largely unknown. Here, we investigated the consequences of acute Bcl-2 ablation on VSMC survival and proliferation by infecting cells with a replication-defective adenovirus that encodes a hammerhead ribozyme directed to bcl-2 mRNA. VSMCs infected with Ad-Rbz-Bcl-2 displayed reduced levels of bcl-2 mRNA and protein, but levels of Bcl-2-homologous proteins were unaffected. VSMCs treated in this manner underwent apoptosis indicating that physiological levels of Bcl-2 are essential for VSMC survival.

It has been shown that, in addition to its protective effects, overexpression of Bcl-2 inhibits cell growth by lengthening the G1 phase of the cell cycle in fibroblasts, T lymphocytes and transformed cells [33–36]. It has also been shown that T-lymphocytes from Bcl-2 null mice enter S-phase more rapidly than wild-type cells following mitogen activation [37]. Here, we addressed the issue of Bcl-2-mediated cell cycle control in VSMCs using ribozyme technology. Our data show that acute Bcl-2 ablation induced quiescent VSMCs to enter S-phase in the absence of serum-stimulation. Surprisingly, these data also revealed that Bcl-2 ablation affects S-phase in that serum-stimulated VSMCs entered, but were unable to exit, S-phase. Aberrant S-phase activity was also indicated by reductions in the expression of the cell cycle regulatory proteins cdk2, PCNA, cdc2 and cyclin A. Chemical inhibition of caspase 3 reduced Ad-Rbz-Bcl-2-induced DNA fragmentation and partially restored the ability of serum-stimulated cells to traverse S phase. Collectively, these data suggest that Bcl-2 is essential for appropriate regulation of both G1- and S-phases of the cell cycle in VSMCs.

The results of our experiments also suggest that the Ad-Rbz-Bcl-2-induced alterations in cell cycle activity are not essential for cell death, but instead, are a non-obligatory consequence of the apoptotic process. This hypothesis is supported by the observation that quiescent VSMCs were as sensitive to Ad-Rbz-Bcl-2-induced apoptosis as proliferating VSMCs. Also, chemical inhibitors of cell cycle activity did not affect Ad-Rbz-Bcl-2-induced apoptosis. Therefore, it is tempting to speculate that acute Bcl-2 ablation affects VSMC cell cycle during the execution phase of apoptosis through the action of caspases on Rb [38–40], the cdk inhibitors p21 and p27 [41] or cyclin A [42].

The findings reported in this study may be relevant to understanding the behavior of VSMCs in vascular lesions that display high rates of cell turnover. In the rat carotid model, balloon injury results in the extensive death of medial smooth muscle cells [9]. Within hours, the remaining medial smooth muscle cells re-enter the cell cycle in a relatively synchronous manner, leading to the repopulation of the media and formation of the intima [11]. In this model, total accumulation of VSMCs in the intima reaches a maximum at 2 weeks post-injury. However, continuous cellular proliferation occurs for up to 12 weeks with no discernible increase in VSMC number [7] due to an increased frequency of VSMC apoptosis in the lesion [5,6]. The local delivery of Ad-Rbz-Bcl-2 to balloon-injured rat carotid arteries decreased medial cell density at three days post-injury, a period where peak VSMC proliferation occurs [11,43]. Ad-Rbz-Bcl-2 also inhibited intimal hyperplasia by 48% at two weeks post-injury. These data indicate that Bcl-2 has a critical role in the proliferative response of VSMCs to acute arterial injury. These data also support the hypothesis that perturbations in Bcl-2 family protein expression within atherosclerotic plaques [44] are indicative of VSMC death within these lesions.

Time for primary review 25 days.


    Acknowledgements
 
This research was supported by National Institutes of Health grants AG15052, AR40197 and HL50692 to K.W. K.W. was an established investigator of the American Heart Association during the course of this study. We thank Linda Whittaker for assistance in preparation of this manuscript.


    Notes
 
1 Present Address: Northwestern Medical Center, Division of Rheumatology, 745 North Fairbanks Court, Tarry 3-770, Chicago, IL 60611, USA. Back


    References
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 

  1. Bennett M.R., MacDonald K., Chan S.-W., Boyle J.J., Weissberg P.L. Cooperative interactions between Rb and p53 regulate cell proliferation, cell senescence, and apoptosis in human vascular smooth muscle cells from atherosclerotic plaques. Circ Res (1998) 82:704–712.[Abstract/Free Full Text]
  2. Isner J.M., Kearney M., Bortman S., Passeri J. Apoptosis in human atherosclerosis and restenosis. Circulation (1995) 91:2703–2711.[Abstract/Free Full Text]
  3. Geng J.Y., Libby P. Evidence for apoptosis in advanced human atheroma: colocalization with interleukin-1β converting enzyme. Am J Pathol (1995) 147:251–266.[Abstract]
  4. Mallat Z., Ohan J., Leseche G., Tedgui A. Colocalization of CPP-32 with apoptotic cells in human atherosclerotic plaques. Circulation (1997) 96:424–428.[Abstract/Free Full Text]
  5. Han D.K., Haudenschild C.C., Hong M.K., Tinkle B.T., Leon M.B., Liau G. Evidence for apoptosis in human atherogenesis and in a rat vascular injury model. Am J Pathol (1995) 147:267–277.[Abstract]
  6. Bochaton-Piallat M.L., Gabbiani F., Redard M., Desmouliere A., Gabbiani G. Apoptosis participates in cellularity regulation during rat aortic intimal thickening. Am J Pathol (1995) 146:1059–1064.[Abstract]
  7. Clowes A.W., Reidy M.A., Clowes M.M. Kinetics of cellular proliferation after arterial injury I: Smooth muscle cell growth in the absence of endothelium. Lab Invest (1983) 49:327–333.[Web of Science][Medline]
  8. Manderson J.A., Mosee P.R.L., Safstron J.A., Young S.B., Campbell G.R. Balloon catheter injury to rabbit carotid artery I. Changes in smooth muscle phenotype. Arteriosclerosis (1989) 9:289–298.[Abstract/Free Full Text]
  9. Perlman H., Maillard L., Krasinski K., Walsh K. Evidence for the rapid onset of apoptosis in medial smooth muscle cells following balloon injury. Circulation (1997) 95:981–987.[Abstract/Free Full Text]
  10. Pollman M.J., Hall J.L., Mann M.J., Zhang L., Gibbons G.H. Inhibition of neointimal cell bcl-x expression induces apoptosis and regression of vascular disease. Nat Med (1998) 4:222–227.[CrossRef][Web of Science][Medline]
  11. Wei G.L., Krasinski K., Kearney M., Isner J.M., Walsh K., Andrés V. Temporally and spatially coordinated expression of cell cycle regulatory factors after angioplasty. Circ Res (1997) 80:418–426.[Web of Science][Medline]
  12. Cho A., Mitchell L., Koopmans D., Langille B. Effects of changes in blood flow rate on cell death and cell proliferation in carotid arteries of immature rabbits. Circ Res (1997) 81:328–337.[Abstract/Free Full Text]
  13. Cho A., Courtman D.W., Langille B.L. Apoptosis (programmed cell death) in arteries of the neonatal lamb. Circ Res (1995) 76:168–175.[Abstract/Free Full Text]
  14. Slomp J., Gittenberger-de Groot A.C., Glukhova M.A., van Munsteren J.C., Kockx M.M., Schwartz S.M., Koteliansky V.E. Differentiation, dedifferentiation, and apoptosis of smooth muscle cells during the development of the human ductus arteriosus. Art Thr Vas Biol (1997) 171:1003–1009.
  15. Tsujimoto Y., Croce C.M. Analysis of the structure, transcripts, and protein products of Bcl-2, the gene involved in human follicular lymphoma. Proc Natl Acad Sci (USA) (1986) 83:5214–5218.[Abstract/Free Full Text]
  16. Yang E., Korsmeyer S.J. Molecular thanatopsis: a discourse on the BCL2 family and cell death. Blood (1996) 88:386–401.[Free Full Text]
  17. Adams J.M., Cory S. The Bcl-2 protein family: arbiters of cell survival. Science (1998) 281:1322–1326.[Abstract/Free Full Text]
  18. Chen T.R., Bass B. Biological catalysis by RNA. Annu Rev Biochem (1986) 55:599–629.[CrossRef][Web of Science][Medline]
  19. Jarvis T., Alby L., Beaudry A., Wincott F., Beigelman L., McSwiggen J., Usman N., Stinchcomb D. Inhibition of vascular smooth muscle cell proliferation by ribozymes that cleave c-myb mRNA. RNA (1996) 2:419–428.[Abstract]
  20. Morishita R., Yamada S., Yamamoto K., Tomita N., Kida I., Sakurabayashi I., Kikuchi A., Kaneda Y., Lawn R., Higaki J., Ogihara T. Novel therapeutic strategy atherosclerosis: Ribozyme oligonucleotides against apolipoprotein(a) selectively inhibit apolipoprotein(a) but not plasminogen gene expression. Circulation (1998) 98:1898–1904.[Abstract/Free Full Text]
  21. Frimerman A., Welch P.J., Eigler N., Yei S., Forrester J., Honda H., Makkar R., Barber J., Litvack F. Chimeric DNA–RNA hammerhead ribozyme to proliferating nuclear antigen reduces stent-induced stenosis in a porcine coronary model. Circulation (1999) 99:697–703.[Abstract/Free Full Text]
  22. Dorai T., Olsson C.A., Katz A.E., Buttyan R. Development of a hammerhead ribozyme against Bcl-2. I. Preliminary evaluation of a potential gene therapeutic agent for hormone-refractory human prostate cancer. Prostate (1997) 32:246–258.[CrossRef][Web of Science][Medline]
  23. Mader S.L. Influence of animal age on the β-adrenergic system in cultured rat aortic and mesenteric artery smooth muscle cells. J Gerontol Biol Sci (1992) 47:B32–B36.
  24. Becker T.C., Noel R.J., Coats W.S., Gomez-foix A.M., Alam T., Gerard R.O., Neward C.B. Use of recombinant adenovirus for metabolic engineering of mammalian cells. Methods Cell Biol (1994) 43:161–189.[Web of Science][Medline]
  25. Graham F.L., van der Eb A.J. A new technique for assay of infectivity of human adenovirus 5 DNA. Virology (1973) 52:456–463.[CrossRef][Web of Science][Medline]
  26. Stratford-Perricaudet L.D., Makeh I., Perricaudet M., Briand P. Widespread long-term gene transfer to mouse skeletal muscles and heart. J Clin Invest (1992) 90:626–630.[Web of Science][Medline]
  27. Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal Biochem (1987) 162:156–159.[Web of Science][Medline]
  28. Tilly J.L., Tilly K.I., Kenton M.L., Johnson A.L. Expression of members of the Bcl-2 gene family in the immature rat ovary: equine chorionic gonadotropin-mediated inhibition of granulosa cell apoptosis is associated with decreased Bax and constitutive Bcl-2 and Bcl-xL messenger ribonucleic acid levels. Endocrinology (1995) 136:232–241.[Abstract]
  29. Smith R.C., Branellec D., Gorski D.H., Guo K., Perlman H., Dedieu J.-F., Pastore C., Mahfoudi A., Denèfle P., Isner J.M., Walsh K. p21CIP1-mediated inhibition of cell proliferation by overexpression of the gax homeodomain gene. Genes & Dev (1997) 11:1674–1689.[Abstract/Free Full Text]
  30. Luo Y., Marx S.O., Kiyokawa H., Koff A., Massague J., Marks A.R. Rapamycin resistance tied to defective regulation of p27Kip1. Mol Cell Biol (1996) 16:6744–6751.[Abstract]
  31. Alpan R.S., Pardee A.B. p21WAF/CIP/SDI1 is elevated through a p53-independent pathway by mimosine. Cell Growth Differ (1996) 7:893–901.[Abstract]
  32. King K.L., Cidlowski J.A. Cell cycle regulation and apoptosis. Annu Rev Physiol (1998) 60:601–617.[CrossRef][Web of Science][Medline]
  33. Borner C. Diminished cell proliferation associated with death-protective activity of Bcl-2. J Biol Chem (1996) 271:12695–12698.[Abstract/Free Full Text]
  34. Huang D.C.S., O’Reilly L.A., Strasser A., Cory S. The anti-apoptotic function of Bcl-2 can be genetically separated from its inhibitory effect on cell cycle entry. EMBO J (1997) 16:4628–4638.[CrossRef][Web of Science][Medline]
  35. Mazel S., Burtrum D., Petrie H.T. Regulation of cell division cycle progression by Bcl-2 expression: a potential mechanism for inhibition of programmed cell death. J Exp Med (1996) 183:2219–2226.[Abstract/Free Full Text]
  36. O’Reilly L.A., Huang D.C.S., Strasser A. The cell death inhibitor Bcl-2 and its homologues influence control of cell cycle entry. EMBO J (1996) 15:6979–6990.[Web of Science][Medline]
  37. Linette G.P., Li Y., Roth K., Korsmeyer S.J. Cross talk between cell death and cell cycle progression: Bcl-2 regulates NFAT-mediated activation. Proc Natl Acad Sci (USA) (1996) 93:9545–9552.[Abstract/Free Full Text]
  38. An B., Dou Q.P. Cleavage of retinoblastoma protein during apoptosis: an interleukin 1β-converting enzyme-like protease as candidate. Cancer Res (1996) 56:438–442.[Abstract/Free Full Text]
  39. Janicke R.U., Walker P.A., Lin X.Y., Porter A.G. Specific cleavage of the retinoblastoma protein by an ICE-like protease in apoptosis. EMBO J (1996) 15:6969–6978.[Web of Science][Medline]
  40. Tan X., Martin S.J., Green D.R., Wang J.Y.J. Degradation of retinoblastoma protein in tumor necrosis factor- and CD95-induced cell death. J Biol Chem (1997) 272:9613–9616.[Abstract/Free Full Text]
  41. Levkau B., Koyama H., Raines E.W., Clurman B.E., Herren B., Orth K., Roberts J.M., Ross R. Cleavage of p21Cip/Waf1 and p27Kip1 mediates apoptosis in endothelial cells through activation of cdk2:role of a caspase cascade. Mol Cell (1998) 1:553–563.[CrossRef][Web of Science][Medline]
  42. Stack J.H., Newport J.W. Developmentally regulated activation of apoptosis early in Xenopus gastrulation results in cyclin A degradation during interphase of the cell cycle. Development (1997) 124:3185–3195.[Abstract]
  43. Clowes A.W., Reidy M.A., Clowes M.M. Mechanisms of stenosis after arterial injury. Lab Invest (1983) 49:208–215.[Web of Science][Medline]
  44. Kockx M.M., DeMeyer G.R.Y., Muhring J., Jacob W., Bult H., Herman A.G. Apoptosis and related proteins in different stages of human atherosclerotic plaques. Circulation (1998) 97:2307–2315.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Anticancer ResHome page
R. HUHN, M. S. STAEGE, M. HESSE, B. LIEBIG, and S. E.G. BURDACH
Cleavage of the Ewing Tumour-specific EWSR1-FLI1 mRNA by Hammerhead Ribozymes
Anticancer Res, June 1, 2009; 29(6): 1901 - 1908.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. Borgers, L.-M. Voipio-Pulkki, and S. Izumo
Apoptosis
Cardiovasc Res, February 1, 2000; 45(3): 525 - 527.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Perlman, H.
Right arrow Articles by Walsh, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Perlman, H.
Right arrow Articles by Walsh, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?