© 1999 by European Society of Cardiology
Copyright © 1999, European Society of Cardiology
Heterogeneous transmural gene expression of calcium-handling proteins and natriuretic peptides in the failing human heart
aAbteilung Kardiologie und Pneumologie, Georg-August-Universität Göttingen, D-37075 Göttingen, Germany
bAbteilung Kardiologie und Angiologie, Universität Freiburg, D-79106 Freiburg, Germany
* Corresponding author. Tel.: +49-551-39-6380; fax: +49-551-39-2953 jprestle{at}mdv.gwdg.de
Received 20 October 1998; accepted 22 February 1999
 |
Abstract |
|---|
 Top Abstract 1 Introduction2 Methods3 Results4 DiscussionReferences |
|---|
Objective: Human heart failure is associated with a disturbed intracellular calcium (Ca2+) homeostasis. In this regard, ventricular wall stress is considered to be a determinant for expression of sarcoplasmic reticulum Ca2+-ATPase (SERCA2a). In the present study, we analyzed the transmural protein and/or mRNA levels of SERCA2a, other Ca2+-handling proteins, and of atrial and brain natriuretic peptides (ANP and BNP) in the human heart. Methods: Subepicardial (epi), midmyocardial (mid), and subendocardial (endo) sections of the left ventricular free wall from end-stage failing (n=17) and nonfailing (n=5) human hearts were analyzed by Western blot for immunoreactive protein levels of SERCA2a, phospholamban (PLN), and calsequestrin (CS). Subepi- and subendocardial sections were analyzed by Northern blot for steady-state mRNA levels of SERCA2a, Na+-Ca2+ exchanger (NCX1), ANP, and BNP. Results: SERCA2a protein and mRNA levels were reduced by 40±5% (P<0.01) and 25±7% (P<0.05) in endo compared to epi in the failing heart and by 27±14% and 16±12% (non-significant) in the nonfailing heart, respectively. PLN protein levels were reduced by 23±6% (P<0.05) in endo compared to epi in the failing heart and by 17±25% (non-significant) in the nonfailing heart, whereas CS protein levels and NCX1 mRNA levels were similar across the left ventricular wall. Strikingly, in the failing heart, both BNP and ANP mRNA levels were upregulated predominantly in endo. Conclusions: In the failing human heart, SERCA2a and PLN, as well as natriuretic peptides but not CS and NCX1 are differentially expressed across the left ventricular wall, implicating (1) different susceptibility of subendocardium and subepicardium to factors affecting expression of these proteins and (2) differences in regulation of the distinct calcium-cycling proteins.
KEYWORDS Human (Species); Experimental (Discipline); Heart (Object); Molecular biology (Level); Ca-pump; Gene expression; Heart failure; Na/Ca-exchanger; Natriuretic peptide
See Editorial of this article by S.M. Krause (pages 279–281) in this issue.
|
1 Introduction |
|---|
|
TopAbstract1 Introduction2 Methods3 Results4 DiscussionReferences |
|---|
Heart failure is a multifactorial disease of different ethiologies. Although it is yet difficult to differentiate between cause and effect, both mechanical stress and neurohumoral changes may contribute to the onset and progression of heart failure. Because of a disproportionate increase in ventricular radius relative to wall thickness, ventricular wall stress is increased in end-stage failing hearts [1]. Besides other factors, increased wall stress is considered to be a major determinant for ventricular secretion of atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP) [2,3]. In the normal adult heart, ANP is primarily produced by atrial myocytes whereas BNP is expressed at low level in both the atrium and ventricle. Both genes are highly upregulated by chronic hemodynamic overload and plasma levels of ANP and BNP correlate with left ventricular dysfunction [4,5]. In a transmural cross-section, wall stress is highest in the subendocardial layer decreasing towards the subepicardium [6,7]. Thus, it can be hypothesized that a transmural gradient exists for expression of both natriuretic peptides.
At the subcellular level, disturbed intracellular Ca2+-handling may be of significant pathophysiological relevance in human heart failure and several studies indicate that disturbed intracellular Ca2+-handling may result from altered sarcoplasmic reticulum (SR) function [8–12]. In this regard, there is convincing evidence that the inverse force-frequency behavior or diminished post-rest potentiation in failing human hearts is due to diminished SR function [13,14]. Despite ongoing controversies, substantial amounts of data indicate that in human heart failure, reduced expression of the sarcoplasmic reticulum Ca2+-ATPase (SERCA2a), the key enzyme sequestering Ca2+ into the SR during diastole, would be ultimately responsible, at least in part, for dysfunctional SR Ca2+-handling [15–20].
If ventricular wall stress is also a determinant for gene expression of SERCA2a, possibly accounting for its reduced expression in failing hearts, then it can be hypothesized that the higher the wall stress the lower the SERCA2a expression. Therefore, a transmural gradient in SERCA2a expression should exist. To test this hypothesis, we quantitatively delineated the transmural distribution of SERCA2a in left ventricular cross-sections of end-stage failing and nonfailing human hearts. Furthermore, we analyzed the transmural protein levels of phospholamban (PLN) and calsequestrin (CS) and the transmural mRNA levels of Na+-Ca2+ exchanger (NCX1), as well as of ANP and BNP, whose expression is thought to be regulated by wall stress.
|
2 Methods |
|---|
|
TopAbstract1 Introduction2 Methods3 Results4 DiscussionReferences |
|---|
2.1 Patients
Hearts from 23 patients with end-stage heart failure undergoing cardiac transplantation were investigated. Age and hemodynamic data at the time of cardiac transplantation are listed in Table 1. Fourteen patients underwent cardiac transplantation due to idiopathic dilated cardiomyopathy (DCM) and nine due to ischemic cardiomyopathy (ICM). Five donor hearts from patients without any history of cardiac disease that were ultimately rejected for transplantation due to technical reasons were also included in this study.
|
The protocol of this study was reviewed and approved by the Ethical Committee of the University Clinics of Freiburg and the investigation conforms with the principles outlined in the Declaration of Helsinki.
2.2 Tissue preparation
Excised hearts were rinsed immediately in cardioplegic Krebs-Henseleit solution containing 30 mM 2,3-butanedione monoxime (BDM) and a portion of approximately 20x20 mm in size was removed from the left ventricular free wall and frozen in liquid nitrogen [21]. The tissue was thawed in homogenization buffer (see below) and samples of about 2 mm thickness from each of the trabeculated endocardial region (further denoted as endo), the epicardial surface (epi), and the middle of the ventricular wall (mid) devoid of adipose tissue or great vessels were carefully dissected and immediately frozen in liquid nitrogen and stored at –80°C until use.
2.3 Western-immunoblot analysis
About 150 mg of tissue from each transmural section was thawed on ice and chilled in a nine-fold volume of homogenization buffer (containing in mM: 20 Na-HEPES, pH 7.4, 2 EDTA, 2 EGTA, 1 DTT, 1 phenylmethylsulfonyl-fluoride, 0.05 leupeptin and 1 iodacetamide). After homogenization by sonification at 4°C, protein concentration of crude suspension was determined in triplicates by the method of Lowry et al. [22]. Samples were denatured in electrophoresis buffer (containing in mM: 100 Tris/Cl pH 6.8, 10 DTT, 2% SDS, 2% glycerol and 0.05% bromophenol blue) at 95°C and subjected to SDS–PAGE. Proteins were transferred to nitrocellulose membranes by electroblotting and membranes were blocked in 5% nonfat dry milk in Tris-buffered saline. The blots were probed with a rabbit-anti-calsequestrin polyclonal antibody (1:2000) [18], a monoclonal (clone 2A7-A1) anti-SERCA2 ATPase antibody (1:10000, Affinity Bioreagents, Inc.), and a monoclonal anti-phospholamban antibody (1:5000, Upstate Biotechnology, Inc.). Visualization of immunoreactive bands was performed using the enhanced chemoluminescence assay (ECL-Kit, Amersham) and band densities were evaluated by two-dimensional densitometry using a 2202 Ultrascan laser densitometer (LKB). The CS data were used as an internal standard to normalize the respective SERCA2a and PLN data.
2.4 Northern blot analysis
Tissue (100–150 mg) was ground in liquid nitrogen and homogenized in lysis buffer RTL (Qiagen) using a FP 120 Fast PrepTM Cell Disruptor (Savant Instruments). Total RNA was extracted using RNeasy-Mini Kit (Qiagen) according to manufacturer és instructions. Integrity of RNA was verified by agarose gel electrophoresis and the ratio of optical density 260/280 nm was 1.8–2.0 in all cases. Seven µg total RNA per lane were size-fractionated on a 0.7 mol/L formaldehyde/1% agarose gel, transferred to nylon membrane (Duralon-UVTM, Stratagene) by overnight capillary blotting and fixed by UV irradiation. Hybridization was performed using QuickHyb Hybridization Solution (Stratagene) for 2 h at 68°C. Blots were probed with a 0.57 kb XbaI/XhoI cDNA fragment of the human SERCA2a gene [23], a 0.65 kb EcoRI/PstI cDNA fragment of the human NCX1 gene [24], and a 0.58 kb PstI/PstI cDNA fragment of the rat ANP gene [25]. Specific DNA probes for detection of BNP and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcripts were generated by polymerase chain reaction (PCR) from a cardiac specific cDNA sample using the following primers: BNP forward: 5' GCGCTCCTGCTCCTGCTCTTCTTG 3', reverse: 5' CTTTGCAGCCCAGGCCACTG 3' (nucleotide position 525-1116) according to the sequence of the human BNP gene [26]; GAPDH forward: 5' CCACCCAGAAGACTGTGGAT 3'; reverse: 5' GTTGAAGTCAGAGGAGACCACC 3' (nucleotide position 608-921) according to the sequence of the human GAPDH gene [27]. The identity of the PCR fragments was verified by sequencing. DNA probes were labeled with [
32P]dCTP by random priming (DNA-Labeling Kit, Pharmacia Biotech) and unbound radioactivity was removed by spin columns. Blots were washed 2x10 min in 2xSSC/0.1% SDS at room temperature and 1x30 min in 0.1xSSC/0.1% SDS at 60°C. After autoradiography, specific signals were quantified by two dimensional laser densitometry. The GAPDH data were used as an internal standard to normalize the SERCA2a, NCX1, BNP, and ANP data.
2.5 Statistics
Each individual experimental value represents the mean of at least two independent determinations. Data are expressed as mean±SEM. If not mentioned otherwise in the text, overall group differences were first assessed by non-parametric-one-way ANOVA for normalized data. When a significant difference was found, multiple pairwise comparisons involving the epi or endo group as a reference were performed with the Dunn correction. For graphical reasons, normalized protein or mRNA levels of transmural layers are given in percent increase or decrease relative to one layer which was set to 100%. A value of P<0.05 was accepted as statistically significant.
|
3 Results |
|---|
|
TopAbstract1 Introduction2 Methods3 Results4 DiscussionReferences |
|---|
3.1 Transmural protein levels of CS, PLN, and SERCA2a
CS is the major Ca2+-binding protein in the SR lumen. Protein levels of CS were not different between transmural layers. In Fig. 1, a representative Western-Immunoblot from a single failing and nonfailing heart and the statistical analysis of all hearts examined is shown. Total protein concentrations in crude homogenates of the transmural sections from failing and nonfailing hearts were not significantly different from each other. CS protein levels of mid and endo normalized per total protein are expressed relative to normalized protein levels of epi, which was set to 100%. The respective CS protein levels were further used as an internal standard to normalize the SERCA2a and PLN protein levels of each heart sample [18].
|
PLN is the regulatory protein of SERCA2a activity. As shown in Fig. 2, in the failing hearts, PLN protein levels were reduced in endo vs. epi by 23±6% (P<0.05; ICM 27±12%, DCM 19±7%). In the nonfailing hearts, reduction in endo compared to epi was 17±25% (non-significant).
|
In Fig. 3 the transmural protein levels of SERCA2a are shown. A marked transmural gradient in SERCA2a protein levels in the failing hearts is evident. Relative to epi there was an overall reduction in endo of 40±5% (P<0.01). The transmural gradient tended to be more pronounced in the subgroup of ICM hearts (50±4% reduction in endo vs. epi) than in the subgroup of DCM hearts (34±8% reduction in endo vs. epi), yet the difference between ICM and DCM hearts was not statistically significant. In the nonfailing hearts, SERCA2a protein level also tended to be reduced towards endo. Reduction in mid and endo compared to epi was 13±19% and 27±14%, respectively, yet, due to the limited number of hearts, there was no statistically significant difference in protein levels between endo and epi (P=0.13).
|
In the failing hearts, the relative decrease in SERCA2a protein level in endo compared to epi was significantly more pronounced than for PLN (40±5% vs. 23±6%; P<0.05, paired t-test). This results in a decrease in SERCA2a protein levels relative to PLN protein levels in endo vs. epi.
By normalizing the transmural SERCA2a and PLN protein levels to total protein concentration in crude homogenates instead of using CS as an internal standard, reduction in endo compared to epi was 35.4±5.6% (P<0.05) and 17.0±6.2% (non-significant), respectively (Table 2).
|
3.2 Transmural mRNA levels of SERCA2a and NCX1
It was argued that in comparing tissue probes from different experimental groups, protein levels of SERCA2a may not necessarily reflect the corresponding mRNA levels [19,20]. Therefore, we also investigated the transmural mRNA levels of SERCA2a (Fig. 4). Due to tissue limitations only mRNA levels of subendocardial and subepicardial sections were compared. In accordance with the protein data, we found a significant reduction in SERCA2a mRNA by 25±7% in endo relative to epi in the failing hearts (P<0.05). In the nonfailing hearts, reduction in endo compared to epi was 16±12% (non-significant).
|
During muscle relaxation, cytosolic Ca2+ is both restored into the SR by the SR Ca2+-ATPase and extruded to the extracellular space by the sarcolemmal Na+-Ca2+ exchanger. Interestingly and in contrast to SERCA2a, we found no significant differences in NCX1 mRNA levels between the different transmural layers in both failing and nonfailing hearts (Fig. 5). However, the average of these data does not reflect the great variability in transmural NCX1 mRNA levels within the heart samples. In four failing hearts we found a 38±18% increase and in five failing hearts a 63±8% decrease in NCX1 mRNA levels in endo vs. epi. There was a significant positive correlation of NCX1 endo/epi mRNA ratio to SERCA2a endo/epi mRNA ratio (r=0.73, P<0.05, n=9). Thus, those hearts with a lower NCX1 mRNA level in endo as compared with epi were found to have a steeper transmural SERCA2a mRNA gradient than those hearts with a higher NCX1 mRNA level in endo as compared with epi. mRNA levels of SERCA2a and NCX1 were normalized to the respective GAPDH mRNA levels. Similar results were obtained by normalizing SERCA2a and NCX1 mRNA levels to internal CS mRNA levels (data not shown).
|
3.3 Transmural mRNA levels of the natriuretic peptides ANP and BNP
The most pronounced transmural differences were observed for ANP and BNP mRNA levels. As shown in Fig. 6, in the failing heart, BNP mRNA is highly upregulated predominantly in endo. In epi, relative BNP mRNA levels represented only 31±8% of mRNA levels in endo (P<0.01). In the nonfailing heart, BNP mRNA is expressed at low level in both endo and epi to equal amounts. As expected, no ANP steady-state mRNA levels were detected in the nonfailing heart by means of Northern blot analysis. In the failing heart however, the transmural differences in ANP mRNA levels (Fig. 7) were even more pronounced than for BNP mRNA. ANP mRNA was detected predominantly in endo. The mRNA level in epi relative to endo reached only 7±3% (P<0.01). In seven out of nine hearts analyzed, we detected no ANP steady-state mRNA levels at all in epi by means of Northern blot analysis. Using the more sensitive RT-PCR approach, we were able to amplify ANP transcripts in all subepicardial sections, but still the mRNA level in endo was higher by orders of magnitude (data not shown).
|
|
|
4 Discussion |
|---|
|
TopAbstract1 Introduction2 Methods3 Results4 DiscussionReferences |
|---|
There is general agreement that reduced ability of the SR to control cytosolic Ca2+ is one fundamental finding explaining diminished myocardial performance of the failing human heart. Whereas numerous studies focused on the comparison of expression levels of major Ca2+-cycling proteins, such as SERCA2a and PLN in normal and end-stage failing human myocardium [15–20], this is the first study which describes a marked transmural heterogeneity of these proteins within the human heart. We demonstrate that in hearts from patients with severe ischemic or dilated cardiomyopathy, a distinct transmural gradient in both protein and mRNA levels of SERCA2a exists across the left ventricular free wall, decreasing from epi towards endo. To a smaller extent we also found a transmural protein gradient for PLN. However, the difference in protein levels between endo and epi was statistically significant only if PLN protein levels were normalized to CS protein levels. A transmural gradient was also observed for ANP and BNP which were predominantly expressed in the subendocardial layers. In contrast, no significant transmural gradient exists for CS protein levels and NCX1 mRNA levels.
Various possibilities relating to functional, structural, or metabolic differences across the ventricular wall may account for the marked regional difference in SERCA2a, PLN, BNP and ANP expression in the failing human heart. Since CS protein levels are similar across the ventricular wall, this would argue against any marked structural differences, i.e. number of myocytes, between endo and epi. The wall stress gradient across the left ventricular wall may therefore be a plausible candidate underlying the transmural distribution of SERCA2a. Since wall stress is increased in congestive heart failure, one may speculate that a reciprocal correlation between wall stress and SERCA2a expression may account for reduced expression of this protein in failing human hearts.
Noteworthy, a tendency for a reduced expression of SERCA2a in endo compared to epi was also obvious in the control hearts, although, due to the limited number of samples, the protein and mRNA levels between endo and epi were not significantly different from each other. Nevertheless, assuming wall stress as a possible determinant for SERCA2a expression, this would be conceivable, as in the nonfailing heart a transmural gradient in ventricular wall stress also exists, and a more pronounced gradient in failing hearts would be consistent with a steeper transmural wall stress gradient in these hearts [6,7].
Regarding PLN, the transmural protein gradient in the failing heart was significantly less pronounced compared to that of SERCA2a, suggesting that regulation of PLN gene expression may include additional factors to wall stress. Recently, Koss et al. showed that SERCA2a and PLN are differentially expressed in murine cardiac compartments [28]. Both mRNA and protein levels of PLN were found to be higher in the ventricle compared with the atrium but SERCA2a expression was not different between these compartments. In the present study we demonstrate intraventricular differences in SERCA2a and PLN expression levels in failing human myocardium. Together, these results indicate that even though PLN is the regulatory protein of SERCA2a activity, expression of both proteins may be regulated by distinct mechanisms.
Expression of NCX1 was found to be upregulated in human heart failure [29,30]. In contrast to SERCA2a, we observed no significant difference in transmural NCX1 mRNA levels. However, we found a positive correlation between transmural SERCA2a and NCX1 mRNA levels in the failing heart, consistent with the notion that both genes may be regulated co-ordinately, as well as by independent mechanisms [29].
In previous studies, a heterogeneous transmural distribution was also demonstrated for β-adrenergic receptor subtypes in failing human hearts. Using quantitative autoradiography of radioligand binding sites, Saffitz and coworkers showed that both total and β1-receptors were selectively downregulated in subendocardium from patients with ischemic and idiopathic dilated cardiomyopathy compared with control hearts [31,32]. Furthermore, the V1 to V3 myosin isoform shift in rat models of cardiac hypertrophy was shown to be most evident in subendocardium [33,34]. These findings indicate that subendocardium is affected most by structural and functional as well as by subcellular alterations, i.e. reinduction of the ‘fetal’ gene program during chronic heart failure. Our results showing upregulation of ANP and BNP expression predominantly in the subendocardial region of failing human hearts further support this hypothesis. Myocyte stretch is regarded to be a determinant for ventricular upregulation of both genes [2]. However, in this respect, it is not established yet whether wall stress itself is the primary stimulus or the wall stress induced release of neuroendocrine factors such as endothelin-1 or angiotensin II. It would be interesting to know whether the transmural distribution of angiotensin-converting enzyme or endothelin-converting enzyme gene expression in the failing heart follows the transmural ANP and BNP expression. This, however, deserves further analysis.
Besides wall stress differences across the ventricular wall, some investigators have demonstrated reduced subendocardial oxygen tension and increased glycolytic activity in subendocardium, which may influence gene expression [35,36]. Moreover, in animal models of hypertrophy, coronary perfusion was shown to be reduced in subendocardium compared with subepicardium [37,38]. Given the slightly exaggerated transmural gradient in SERCA2a expression in the subgroup of ICM hearts, altered flow characteristics, i.e. decreased perfusion in endo compared to epi, may as well account for the described gradients in gene expression. As heart failure itself is of different etiologies, numerous stress factors may thus act in concert in determining the expression level of defined proteins.
In our study, we used tissue sections of the endocardial and epicardial surfaces, and from the midmyocardial layer (each about 2 mm thick) of the free left ventricular wall to determine transmural protein and/or mRNA levels of the respective genes. By electrophysiological characterization of cells spanning the left ventricular wall, Drouin et al identified three cell subtypes: Endocardial, epicardial, and subepicardial cells (M cells), the M cells exhibiting a longer action potential duration as compared with endo- and epicardial cells [39]. From this study it is evident that epicardial cells are located in a thin layer, whereas endocardial cells represent the major area. M cells were found to be located in an area between epicardial and endocardial cells, 4 to 5 mm thick. Therefore, it is possible that the tissue sections denoted as epicardium in the present study, may have comprised epicardial and M cells, and the sections denoted as midmyocardium may have contained M cells and endocardial cells.
In summary, the present study shows that in failing human myocardium there is a pronounced difference in transmural mRNA levels of ANP and BNP, SERCA2a protein and mRNA levels and to a lesser extend of PLN protein levels, whereas CS protein levels and NCX1 mRNA levels are similar across the ventricular wall, implicating (1) different susceptibility of subendocardium and subepicardium to factors affecting expression of these proteins and (2) differences in regulation of the distinct calcium-cycling proteins. Finally, from an experimental point of view, these results clearly indicate that for comparison of protein or mRNA expression levels in myocardial samples from different experimental groups, samples should be of the same transmural origin.
Time for primary review 21 days.
|
Acknowledgements |
|---|
This work was supported by Deutsche Forschungsgemeinschaft, grant HA 1233/3-3. We are very grateful to Dr. KD Philipson, Los Angeles, for providing a cDNA probe of the human NCX1 gene, and to Dr. DH MacLennan, Toronto, for providing a cDNA probe of the human SERCA2a gene. We also would like to thank Dr. S. Baudet, Freiburg for critical reading of the manuscript.
|
References |
|---|
|
TopAbstract1 Introduction2 Methods3 Results4 DiscussionReferences |
|---|
- Opie L.H. The heart: physiology and metabolism. (1991) New York, NY: Raven Press.
- Ruskoaho H., Leskinen H., Taskinen J.M.P., Mäntymaa P., Leppäluoto O.V. J Mechanisms of mechanical load-induced atrial natriuretic peptide secretion: role of endothelin, nitric oxide, and angiotensin II. J Mol Med (1997) 75:876–885.[CrossRef][Web of Science][Medline]
- Kinnunen P., Vuolteenaho O., Marttila M., Ruskoaho H. Mechanisms of atrial and brain natriuretic peptide release from rat ventricular myocardium: effect of stretching. Endocrinology (1993) 132:1961–1970.
[Abstract/Free Full Text] - Muders F., Kromer E.P., Griese D.P., et al. Evaluation of plasma natriuretic peptides as markers for left ventricular dysfunction. Am Heart J (1997) 134:442–449.[CrossRef][Web of Science][Medline]
- McDonagh T.A., Robb S.D., Murdoch D.R., et al. Biochemical detection of left-ventricular systolic dysfunction. Lancet (1998) 351:9–13.[CrossRef][Web of Science][Medline]
- Mirsky I. Ventricular and arterial wall stresses based on large deformation analysis. Biophys J (1973) 13:1141–1159.[Web of Science][Medline]
- Yin F.C.P. Ventricular wall stress. Circ Res (1981) 49:829–842.
[Free Full Text] - Katz A.M. Cardiomyopathy of overload. A major determinant of prognosis in congestive heart failure. N Engl J Med (1990) 322:100–110.[Web of Science][Medline]
- Morgan J.P. Abnormal intracellular modulation of calcium as a major cause of cardiac contractile dysfunction. New Engl J Med (1991) 325:625–632.[Web of Science][Medline]
- Dhalla N.S., Wang X., Beamish R.E. Intracellular calcium handling in normal and failing hearts. Exp Clin Cardiol (1996) 1:7–20.
- Gwathmey J.K., Slawsky M.T., Hajjar R.J., Briggs G.M., Morgan J.P. Role of intracellular calcium handling in force-interval relationships of human ventricular myocardium. J Clin Invest (1990) 85:1599–1613.[Web of Science][Medline]
- Hasenfuss G., Mulieri L.A., Leavitt J.B., et al. Alterations of contractile function and excitation-contraction coupling in dilated cardiomyopathy. Circ Res (1992) 70:1225–1232.
[Abstract/Free Full Text] - Pieske B., Kretschmann B., Meyer M., et al. Alterations in intracellular calcium handling associated with the inverse force-frequency relation in human dilated cardiomyopathy. Circulation (1995) 92:1169–1178.
[Abstract/Free Full Text] - Pieske B., Sütterlin M., Schmidt-Schweda S., et al. Diminished post-rest potentiation of contractile force in human dilated cardiomyopathy. J Clin Invest (1996) 98:764–776.[Web of Science][Medline]
- Mercadier J.J., Lompré A.M., Duc P., et al. Altered sarcoplasmic reticulum Ca-ATPase gene expression in the human ventricle during end-stage heart failure. J Clin Invest (1990) 85:305–309.[Web of Science][Medline]
- Arai M., Alpert N.R., McLennan D.H., Barton P., Periasamy M. Alterations in sarcoplasmic reticulum gene expression in human heart failure: a possible mechanism for alterations in systolic and diastolic properties of the failing myocardium. Circ Res (1993) 72:463–469.
[Abstract/Free Full Text] - Movsesian M.A., Karimi M., Green K., Jones L.R. Ca2+-transporting ATPase, phospholamban, and calsequestrin levels in nonfailing and failing human myocardium. Circulation (1994) 90:653–657.
[Abstract/Free Full Text] - Meyer M., Schillinger W., Pieske B., et al. Alterations of sarcoplasmic reticulum proteins in failing human dilated cardiomyopathy. Circulation (1995) 92:778–784.
[Abstract/Free Full Text] - Schwinger R.H., Böhm M., Schmidt U., et al. Unchanged protein levels of SERCA II and phospholamban but reduced Ca2+ uptake and Ca2+-ATPase activity of cardiac sarcoplasmic reticulum from dilated cardiomyopathy patients compared with patients with nonfailing hearts. Circulation (1995) 92:3220–3228.
[Abstract/Free Full Text] - Linck B., Boknik P., Eschenhagen T., et al. Messenger RNA expression and immunological quantification of phospholamban and SR-Ca2+-ATPase in failing and nonfailing human hearts. Cardiovasc Res (1996) 31:625–632.
[Abstract/Free Full Text] - Mulieri L.A., Hasenfuss G., Ittleman F., Blanchard E.M., Alpert N.R. Protection of human left ventricular myocardium from cutting injury with 2,3-butanedione monoxime. Circ Res (1992) 65:1441–1444.
- Lowry O.H., Roseborough N.J., Farr A.L., Randall R.J. Protein measurements with the Folin phenol reagent. J Biol Chem (1951) 193:265–275.
[Free Full Text] - Lytton J., MacLennan D.H. Molecular cloning of cDNAs from human kidney coding for two alternatively spliced products of the cardiac Ca2+-ATPase gene. J Biol Chem (1988) 263:15024–15031.
[Abstract/Free Full Text] - Izumo S., Philipson K.D., Wenninger K.E., Komuro I. Molecular cloning and characterization of the human cardiac Na+-Ca2+ exchanger cDNA. Proc Natl Acad Sci. USA (1992) 89:4769–4773.
[Abstract/Free Full Text] - Seidman C.E., Duby A.D., Choi E., et al. The structure of rat preproatrial natriuretic factor as defined by a complementary cDNA clone. Science (1984) 225:324–326.
[Abstract/Free Full Text] - Seilhamer J.J., Arfsten A.E., Miller J.A., et al. Human and canine gene homologs of porcine brain natriuretic peptide. Biochem Biophys Res Commun (1989) 165:650–658.[CrossRef][Web of Science][Medline]
- Tokunaga K., Nakamura Y., Sakata K., et al. Enhanced expression of a glyceraldehyde-3-phosphate dehydrogenase gene in human lung cancers. Cancer Res (1987) 47:5616–5619.
[Abstract/Free Full Text] - Koss K.L., Ponniah S., Jones W.K., Grupp I.L., Kranias E.G. Differential phospholamban gene expression in murine cardiac compartments. Circ Res (1995) 77:342–353.
[Abstract/Free Full Text] - Studer R., Reinecke H., Bilger J., et al. Gene expression of the cardiac Na+-Ca2+ exchanger in end-stage human heart failure. Circ Res (1994) 75:443–453.
[Abstract/Free Full Text] - Flesch M., Schwinger R.H., Schiffer F., et al. Evidence for functional relevance of an enhanced expression of the Na+-Ca2+ exchanger in failing human myocardium. Circulation (1996) 94:992–1002.
[Abstract/Free Full Text] - Murphree S.S., Saffitz J.E. Distribution of β-adrenergic receptors in failing human myocardium: Implications for mechanisms of downregulation. Circulation (1989) 79:1214–1225.
[Abstract/Free Full Text] - Beau S.L., Tolley T.K., Saffitz J.E. Heterogeneous transmural distribution of β-adrenergic receptor subtypes in failing human hearts. Circulation (1993) 88:2501–2509.
[Abstract/Free Full Text] - Bugaisky L.B., Anderson P.G., Hall R.S., Bishop S.P. Differences in myosin isoform expression in the subepicardial and subendocardial myocardium during cardiac hypertrophy in the rat. Circ Res (1990) 66:1127–1132.
[Abstract/Free Full Text] - Dool J.S., Mak A.S., Friberg P., et al. Regional myosin heavy chain expression in volume and pressure overload induced cardiac hypertrophy. Acta Physiol Scand (1995) 155:397–404.[CrossRef][Web of Science]
- Kirk E.S., Honig C.R. Nonuniform distribution of blood flow and gradients of oxygen tension within the heart. Am J Physiol (1964) 207:661–668.
[Abstract/Free Full Text] - Takala T.E.S., Ruskoaho H.J., Hassinen I.E. Transmural distribution of cardiac glucose uptake in rat during physical exercise. Am J Physiol (1983) 244:H132–H137.
- Bache R.J., Vrobel T.R., Ring W.S., Emery R.W., Andersen R.W. Regional myocardial blood flow during exercise in dogs with chronic left ventricular hypertrophy. Circ Res. (1981) 48:76–87.
[Free Full Text] - Smolich J.J., Weissberg P.L., Friberg P., Broughton A., Korner P.I. Left ventricular blood flow during aortic pressure reduction in hypertensive dogs. Hypertension (1991) 18:665–673.
[Abstract/Free Full Text] - Drouin E., Charpentier F., Gauthier C., Laurent K., LeMarec H. Electrophysiologic characteristics of cells spanning the left ventricular wall of human heart: Evidence for presence of M cells. J Am Coll Cardiol (1995) 26:185–192.[Abstract]
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  N. Gaborit, S. Le Bouter, V. Szuts, A. Varro, D. Escande, S. Nattel, and S. Demolombe Regional and tissue specific transcript signatures of ion channel genes in the non-diseased human heart J. Physiol., July 15, 2007; 582(2): 675 - 693. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Leszek, M. Szperl, A. Klisiewicz, J. Janas, A. Biederman, T. Rywik, W. Piotrowski, M. Kopacz, and J. Korewicki Alteration of myocardial sarcoplasmic reticulum Ca2+-ATPase and Na+-Ca2+ exchanger expression in human left ventricular volume overload Eur J Heart Fail, June 1, 2007; 9(6-7): 579 - 586. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Vinereanu, P. O. Lim, M. P. Frenneaux, and A. G. Fraser Reduced myocardial velocities of left ventricular long-axis contraction identify both systolic and diastolic heart failure--a comparison with brain natriuretic peptide Eur J Heart Fail, June 1, 2005; 7(4): 512 - 519. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F R Quinn, S Currie, A M Duncan, S Miller, R Sayeed, S M Cobbe, and G L Smith Myocardial infarction causes increased expression but decreased activity of the myocardial Na+--Ca2+ exchanger in the rabbit J. Physiol., November 15, 2003; 553(1): 229 - 242. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||