© 1999 by European Society of Cardiology
Copyright © 1999, European Society of Cardiology
Distribution and function of recombinant endothelial nitric oxide synthase in transplanted hearts
aDepartment of Surgery, Mayo Clinic and Foundation, 200 First Street SW, Rochester, MN 55905, USA
bDepartment of Endocrinology, Mayo Clinic and Foundation, 200 First Street SW, Rochester, MN 55905, USA
cDepartment of Laboratory Medicine and Pathology, Mayo Clinic and Foundation, 200 First Street SW, Rochester, MN 55905, USA
dDepartment of Physiology, Mayo Clinic and Foundation, 200 First Street SW, Rochester, MN 55905, USA
* Corresponding author. Tel.: +1-507-255-6038; fax: +1-507-255-4500
Received 27 May 1998; accepted 18 November 1998
| Abstract |
|---|
|
|
|---|
Introducing recombinant genes into donor hearts may offer a therapeutic intervention that could potentially attenuate the complications of heart transplantation, including rejection, infection and accelerated atherosclerosis. In the cardiovascular system, reduced bioactivity of endothelial nitric oxide is a feature of atherosclerosis and vascular injury. Nitric oxide is an arterial vasodilator that also inhibits proliferation of vascular smooth muscle cells and platelet aggregation. Experiments were designed to determine the distribution of adenoviral-mediated transfer of recombinant endothelial nitric oxide synthase gene (eNOS) and the effect of recombinant gene expression on the function of transplanted hearts. Adenoviral vectors for (a) bovine eNOS (AdeNOS) or (b) β-galactosidase (AdLacZ; control) were infused into two groups (n=12, per group) of explanted rat hearts. The transduced hearts were then implanted heterotopically into the abdomen of syngeneic recipient rats. After four days, the hearts were excised and examined for distribution and function of the recombinant genes. Polymerase chain reaction (PCR) verified the presence of the recombinant eNOS gene in eNOS-transduced but not in β-galactosidase-transduced hearts; reverse transcriptase-PCR identified mRNA for eNOS in AdeNOS-transduced hearts. NOS activity (conversion of tritiated L-arginine to citrulline) was greater in homogenates of AdeNOS- compared to AdLacZ-transduced hearts. Positive immunoreactivity for eNOS was present in cardiomyocytes predominantly in eNOS-transduced hearts. Myocardial contractility and coronary blood flow, as determined using a Langendorff preparation, were not different between hearts transduced with AdeNOS or AdLacZ. These results suggest that, up to four days post transplantation, adenoviral-mediated transfer of eNOS into transplanted hearts is possible. However, expression of the recombinant protein did not result in measurable changes in myocardial contractility or coronary perfusion.
| 1. Introduction |
|---|
|
|
|---|
The one-year survival for heart transplant patients is approximately 80% and more than 50% of patients are alive after five years [1]. However, limitations to long-term survival include the development of accelerated transplant atherosclerosis [2], rejection [3,4], infection and side effects of immunosuppression [5]. The etiology and pathogenesis of accelerated transplant atherosclerosis appears to be multi-factorial and non-immune mechanisms including early ischemia-induced endothelial cell injury, ischemic reperfusion and cytomegalovirus infection may all contribute [6].
Nitric oxide (NO) derived from the vascular endothelium regulates vascular tone and inhibits proliferation of smooth muscle cells, and adhesion and activation of leukocytes and platelets [7–11]. Therefore, overexpression of nitric oxide may be beneficial in modifying accelerated heart transplant atherosclerosis. Indeed, overexpression of iNOS (by gene transfer) attenuates intimal hyperplasia in aortic allografts in rats [11]. However, the role of nitric oxide in a solid organ such as the heart is complex. Under physiologic conditions, basal release of nitric oxide in the heart is important in preserving ventricular function [12]. In contrast, excessive production of NO, secondary to activation of the inducible form of nitric oxide synthase (iNOS), which occurs in conditions such as allograft rejection [13] and endotoxemia, reduces myocardial contractility [14–16].
Recent advances in molecular biology have resulted in the development of vector systems for transferring recombinant genes into cells and organs [17]. Thus, gene transfer may be a useful tool for studying the pathogenesis of these processes and may have potential therapeutic implications for modifying accelerated transplant atherosclerosis. Therefore, experiments were designed to determine the distribution and functional consequences of overexpressing the eNOS gene in the transplanted heart.
| 2. Methods |
|---|
|
|
|---|
2.1 Construction, propagation and purification of adenoviral vector
A recombinant adenovirus containing the cDNA encoding eNOS was generated as previously described [18]. Briefly, bovine eNOS cDNA was cloned into the shuttle plasmid pACCMVpLpA. The resulting plasmid was linearized with NruI and cotransfected with d1309 into 293 cells by calcium phosphate/DNA coprecipitation. d1309 is a biologically selected, restriction enzyme-site-loss variant of wild type adenovirus type 5, which retains only a single Xba1 site at nucleotide 1339. 293 cells are human embryonic kidney carcinoma cells that have been transformed with the left end of human adenovirus type 5 DNA. Recombinant adenoviral vectors were generated by homologous recombination. Viral plaques were picked and propagated in 293 cells. Viral DNA was enriched by Hirt extraction and screened by restriction mapping and polymerase chain reaction (PCR) for the presence of eNOS cDNA. Positive plaques underwent two further rounds of plaque purification in 293 cells. Stocks were prepared from positive plaques and these were used to generate high titer preparations. Viral preparations were prepared by infecting a confluent monolayer of 293 cells in T175 flasks with viral stock at a multiplicity of infection (MOI) of 1–10. Virus was purified by double cesium gradient ultracentrifugation and was dialyzed against 10 mmol/l Tris, 1.0 mmol/l MgC12, 1.0 mmol/l Hepes and 10% glycerol for 4 h at 4°C. Viral titer was determined by plaque assay. AdCMVLacZ, used in all experiments as a control, was a kind gift from Dr. James M. Wilson (University of Pennsylvania, Philadelphia, PA, USA).
2.2 Animals, operation and gene transfer
Inbred male Lewis (RT-1 [l]) rats (250 to 300 g) were used as donors and recipients. All animals received humane care in compliance with the "Principles of Laboratory Animal Care", formulated by the National Society for Medical Research, and the "Guide for the Care and Use of Laboratory Animals", prepared by the Institute of Laboratory Animal Resources and published by the National Institutes of Health (NIH Publication No. 86-23, revised 1985).
Heterotopic abdominal heart transplantation using standard microsurgical techniques was performed [19]. After anesthesia with pentobarbital (30 mg/kg, intraperitoneally), the donor rat was intubated and ventilated (Harvard Rodent Ventilator). A median sternotomy was performed to expose the heart. The rat was heparinized with 200 U of aqueous heparin injected into the inferior vena cava. The innominate artery was cannulated with a 24-gauge cannula and the venae cavae and pulmonary veins were ligated en bloc with 4/0 silk. The pulmonary artery was divided and the ascending aorta tied distal to the cannula. The donor heart was arrested with an infusion of cold cardioplegic solution (Plegisol, Abbott Laboratory) into the aortic root via the indwelling cannula. The donor heart was then excised and transferred to a cardioplegic solution at 4°C. Either the eNOS or the LacZ (control) gene at a concentration of 1x109 pfu/ml (total volume, 0.350 ml) was infused over 5 s into the coronary arteries via the aortic root. The pulmonary artery was clamped during viral infusion and the viral solution was not flushed out at the end of 60 min cold storage prior to performing heart transplantation. All donor hearts were heterotopically transplanted into the recipients by end-to-side anastomoses of the aorta and the pulmonary artery to the abdominal aorta and inferior vena cava, respectively, using 10/0 monofilament sutures. All rats received Torbugesic as analgesia post-operatively. Viability of the grafts was verified daily by palpation of the beating transplanted heart.
2.3 Tissue analysis
Transplanted hearts (n=12 per group) were harvested four days after surgery. For PCR, RT-PCR, immunohistochemical staining and NOS activity assay, hearts (n=6 per group, except PCR for control, n=2) were flushed with phosphate-buffered saline (PBS) solution and then cut into apical, mid-ventricular and basal sections. For assessment of ventricular function, transplanted hearts (n=6 per group) were removed and prepared for Langendorff perfusion.
2.4 Polymerase chain reaction
The presence of recombinant eNOS DNA from the transduced hearts was analyzed by PCR. Genomic DNA was prepared from apical and basal segments of eNOS- (n=6) and LacZ-transduced hearts, (n=2 as control) by standard proteinase K digestion in phenol and chloroform extraction conditions. Primer sequences utilized for the experiments were as follows: upper 5' AGG CGT CGG TGG GAG GTC TAT, lower 5' GCG CAC AGA GTG TCG TAG GTG ATG. The upper primer was complementary to the CMV promoter. A 1-µg amount of DNA was amplified using 35 PCR cycles (94°C for 30 s, 63°C for 30 s and 72°C for 30 s). The PCR product amplified was 356 base pairs in length.
2.5 Reverse transcriptase PCR (RT-PCR)
Expression of recombinant eNOS mRNA was detected by RT-PCR. Total RNA was prepared from apical and basal segments of transplanted hearts using RNA STAT-60 isolation reagent (Tel-Test "B", Friendswood, TX, USA). Reverse transcription was performed using a SuperScript preamplification system for first strand cDNA synthase kit (Life Technologies, Gaithersburg, MD, USA). Total RNA was transcribed into cDNA using oligo(dT) priming methods according to the manufacturers protocol. RT-generated cDNA encoding for the eNOS gene was amplified using 35 PCR cycles (94°C for 45 s, 60°C for 45 s and 72°C for 60 s). Sequences utilized for the experiments were as follows: upper 5' TCAACCAGTACTACAGCTCC, lower 5' GTGGTTGCAGATGTAGGTGA. These primers were derived from bovine eNOS sequence and they do not generate PCR product with endogenous rat eNOS. Primers designed to detect expression of glyceraldehyde 3-phosphate dehydrogenase (G3PDH; Amplimer set, Clontech Laboratories, Palo Alto, CA, USA) were used to test the efficiency of cDNA synthesis. The PCR product for eNOS migrates to 250 base pairs and the G3PDH at 450 base pairs.
2.6 X-gal staining
Sections (5 µm-thick) of LacZ-transduced hearts were fixed in 1.25% glutaraldehyde for 15 min at 4°C and then rinsed twice with PBS (Gibco BRL, Gaithersburg, MD, USA). The sections were stained in a solution of 500 µg/ml 5-bromo-4-chloro-3-indolyl–β-D-galactopyranoside (X-Gal) (Boehringer Mannheim, Indianapolis, IN, USA) for 4 h at 37°C. The sections were rinsed in PBS and counterstained with eosin. Blue-stained cells indicated the presence of β-galactosidase expression.
2.7 Immunohistochemical staining
Midventricular cross sections of the transplanted hearts were embedded in OCT medium (Miles, Elkhart, IN, USA) and frozen in a liquid nitrogen-cooled isopentane bath. Sections (5 µm thick) were cut at 25 µm intervals, fixed for 10 min in cold acetone (4°C), fan-dried for 10 min and further fixed in 1% paraformaldehyde/EDTA for 3 min. Endogenous peroxidase activity was blocked with 0.1% sodium azide/0.3% H2O2 for 10 min. Incubating sections with 5% goat serum/PBS–Tween 20 blocked non-specific protein binding sites. Then, 5 µg/ml of anti-eNOS monoclonal antibody (N30020
[GenBank]
) (Transduction Laboratories, Lexington, KY, USA) was added and the samples were incubated for 60 min at room temperature. After rinsing, biotinylated rabbit anti-mouse F(ab')2 (1:300) was added for 20 min. After further incubation for 20 min with peroxidase conjugated-streptavidin (1:300), the slides were incubated for 30 s in 0.1 M sodium acetate buffer, pH 5.2. Then the slides were placed in AEC (3-amino-9-ethylcarbazole) substrate solution and incubated for 15 min at room temperature, counterstained in mercury-free hematoxylin for 1 min and further rinsed for 3 min in cold running tap water before being mounted. Myocardial cells with immunoreactivity were then counted from all five sections of both control (LacZ) and experimental (eNOS) groups and a mean was calculated for each heart.
2.8 Assessment of gene transfer efficiency
The area of each section was obtained using an Axiophot photomicroscope (Carl Zeiss, Oberkochen, Germany) equipped with a 2.5x objective lens. Brightfields images were digitized to 256 gray levels on an IBAS image analysis system (Kontron Elektronik, Munich, Germany) using a black and white Newvicon video camera (Hamamatsu, Tokyo, Japan). Each image was analyzed using a macro computer program written with software supplied by the IBAS system. The number of cells per section was estimated by dividing the area by the mean dimension of a cardiomyocyte [20]. Efficiency was calculated as the number of positive cells divided by the total number of cells. As endothelial cells and interstitial cells are present, this results in an underestimate.
2.9 NOS activity
NOS activity of LacZ- (as control) and eNOS-transduced hearts was determined by measuring the conversion of L-[3H]-arginine to L-[3H]-citrulline by methods originally described by Myatt et al. [21] and modified by Miller and Barber [22]. In brief, tissue homogenates from midventricular sections of transplanted hearts were prepared and eluted through 10-DG desalting columns (Bio-Rad Laboratories, Hercules, CA, USA). To quantitate NOS activity, duplicate reactions were carried out in the presence of calcium (total activity), in the absence of calcium plus EGTA (calcium-independent activity) and in the absence of calcium plus EGTA in the presence of NG-monomethyl–L-arginine (L-NMMA; non-specific activity).
Reaction mixtures of homogenate (150 µl) and cofactor (150 µl) were incubated at 27°C for 1 h. Separation of L-[3H]-arginine from L-[3H]-citrulline was accomplished using affinity columns containing AG 50W-X8 Na+ form 200–400 mesh resin (Bio-Rad Laboratories). Nitric oxide produced by NOS is presumably in a 1:1 molar ratio with L-citrulline and, thus, NOS activity is expressed as pmol of [3H]-L-citrulline produced per mg of protein per hour. Calcium-dependent activity equaled total activity minus calcium-independent activity after correcting for non-specific activity.
2.10 Assessment of ventricular function
Functional effects of eNOS transduction on transplanted hearts were determined using the Langendorff preparation (Langendorff, 1895). Explanted eNOS- and LacZ-transduced hearts were arrested with cold saline, quickly excised and then mounted on the Langendorff apparatus and perfused immediately with Krebs buffer (containing, in mmol/l: glucose 11.1, NaCl 118.3, KC1 4.7, MgSO4 1.2, KH2PO4 1.2, NaHCO3 25.0, CaC12 2.5, EDTA calcium disodium 0.026, at pH 7.4 when gassed with 95% O2 plus 5% CO2) with a perfusion pressure of 60 mmHg at 37°C. All hearts were paced using a Grass SD (Pacing Grass SD9 Stimulator, Quincy, MA, USA) via the right atrium at 320 beats/min. After 15 min of equilibration, coronary flow was measured with an in-line flow probe (Transonic System, Ithaca, NY, USA) above the aortic root. An intraventricular balloon (size 4, Radnotti, CA, USA) was introduced into the left ventricular chamber and the left ventricular pressure was measured with a Millar catheter (Millar Instruments, Houston, TX, USA). Left ventricular function was expressed as left ventricular developed pressure (LVDP=left ventricular systolic pressure minus left ventricular diastolic pressure). Left ventricular function curves were constructed by progressively increasing the volume of the balloon to achieve end-diastolic pressures (LVEDP) of 0, 4, 8, 12, 16 and 20 mmHg. Following the assessment of cardiac function, the LVDP was maintained at the optimal level and the heart was allowed to stabilize for 5 min. Coronary flow was measured at 1, 2, 3, 4, 5, 10, 15, 20 and 25 min after beginning a continuous infusion of L-NMMA (10–4 M).
2.11 Statistical analysis
All data are expressed as mean±SEM; n represents the number of animals; the number of cells staining positively for eNOS and NOS activity as picomol/mg protein/h were compared using a two-tailed Students t-test unpaired for unpaired data. For analysis of left ventricular function, areas under the curves were compared by analysis of variance. Analysis of variance for repeated measurements was used to analyze changes in coronary flow. For post hoc analysis, Bonferroni correction was used when a significant F value was found. A P value of less than 0.05 was considered significant.
| 3. Results |
|---|
|
|
|---|
3.1 PCR
To confirm gene transfer, PCR was performed on DNA extracted from eNOS- and LacZ-transduced hearts. Bands at 356 base pairs corresponding to positive control for bovine eNOS were present in all lanes for eNOS-transduced hearts (n=6). In contrast, no bands were seen in the controls (LacZ-transduced hearts, n=2; Fig. 1).
|
3.2 RT-PCR
To confirm transcription of the recombinant eNOS gene, transduced hearts were examined for the presence of eNOS mRNA by RT-PCR. Bands at 250 base-pairs corresponding to positive control for mRNA for eNOS were present in all lanes for eNOS-transduced (n=6) but not in the LacZ-transduced hearts (n=6, Fig. 2). The reaction was negative in the absence of reverse transcriptase.
|
3.3 Transgene expression in AdLacZ-transduced hearts
β-Galactosidase was expressed predominantly in myocytes in AdLacZ-transduced hearts. Transgene expression around a zone of ischemia is shown in Fig. 3. β-Gal expression was not seen in AdeNOS-transduced hearts.
|
3.4 Immunohistochemical staining
To confirm the presence of recombinant protein, immunohistochemical staining was performed. As the antibody to eNOS was not specific for recombinant eNOS, endothelial cells in both the eNOS and the LacZ groups were immunoreactive for eNOS. (Fig. 4 a, b) In the LacZ-transduced hearts, the mean number of immunoreactive myocytes per section was 2±1 (mean±SE, Fig. 4a). In the eNOS-transduced hearts, the mean number of immunoreactive cardiomyocytes per section was 254±102 (mean±SE, Fig. 4b). (P<0.05). The greatest concentration of transduced cells was near zones of organizing ischemia. Zones of ischemia were also present in the LacZ-transduced hearts but myocytes surrounding such foci showed no overexpression of eNOS (Fig. 4a)
|
3.5 Assessment of efficiency of gene transfer
The mean area of the sections (n=30, six animals) was 37.38 mm2. The mean dimensions of a cardiomyocyte are 80x15 µm. This results in an efficiency of 0.81%.
3.6 NOS activity
Total NOS activity was 41.7±5.1 pmol L-[3H]-citrulline/mg protein/h in the LacZ-transduced group and 57.7±5.2 pmol/mg protein/h in the eNOS-transduced group, (n=6 per group, P=0.05)(Fig. 5). Calcium-dependent activity of NOS was 38.4±4.7 pmol/mg protein/h in the LacZ-transduced group vs. 53±5 pmol/mg protein/h in the eNOS-transduced group (P=0.05). Calcium-independent activity of NOS was 3.3±0.5 pmol/mg protein/h in the LacZ-transduced group and 4.7±1.5 pmol/mg protein/h in the eNOS-transduced group (P=NS).
|
3.7 Cardiac functional assessment
Mean coronary flow after the initial period of stabilization was 11.7±0.5 ml/min in the LacZ group and 10.9±0.7 ml/min in the eNOS group. There were no significant differences in cardiac function as measured by LVDP between the two groups (n=6 per group, Fig. 6).
|
L-NMMA affected coronary flow comparably in each group (Fig. 7). During the initial period of L-NMMA infusion, coronary flow in all hearts increased transiently, but then decreased by 25% of baseline flow within 2 min.
|
| 4. Discussion |
|---|
|
|
|---|
The aim of the present study was to demonstrate the feasibility and functional consequences of overexpressing eNOS in the transplanted heart using adenoviral-mediated gene transfer. Successful gene transfer and transgene expression in the transplanted heart was confirmed by PCR, RT-PCR, immunohistochemical staining and measurement of functional NOS activity. Recombinant gene expression, however, did not affect ventricular function or coronary flow, as assessed using a Langendorff preparation following heterotopic heart transplantation (non-loaded left ventricular chamber).
This study demonstrated the feasibility of using adenoviral vectors for gene transfer of a biologically relevant molecule to the transplanted heart. Adenoviral-mediated gene transfer was used because it has been shown to efficiently transduce non-replicative cells. Furthermore, in the transplantation setting, some of the limitations of this technology, including the transient nature of transgene expression [23] and the difficulty of achieving prolonged luminal contact of vector in coronary vessels, may be partially overcome. The period from harvest to implantation of the donor heart may allow for a prolonged period of viral vector exposure of up to 4 h. In addition, the necessary and routine use of immunosuppression may prolong the duration of transgene expression [24,25] in the transplanted heart. In this study, transgene expression was seen predominantly in cardiomyocytes even when the viral solution was injected through the aortic root. We have previously demonstrated, using β-galactosidase as a marker, that this method of administration results predominantly in expression of the transgene in cardiomyocytes [24]. We estimated that the transgene was expressed in approximately 1 in 100 myocytes, which is consistent with a previous report of gene transfer to the transplanted heart [26]. Transgene expression appeared somewhat more accentuated around subepicardial zones of organizing ischemia. This may be explained by the fact that the subepicardial area of the heart rewarms sooner during the transplantation procedure, as it is more exposed to the heat from the operating light and also the ambient temperature of the room. Thus, as the entry of adenovirus into cells is a temperature-dependent process [27], enhanced gene transfer may be seen in areas that have higher temperature than surrounding regions. Interestingly, eNOS was also detected in small numbers of ventricular myocytes of AdLacZ-transduced hearts. This observation is consistent with previous studies [28–30] showing the presence of eNOS in cardiomyocytes.
The potential effect of nitric oxide on myocardial function has been the subject of many studies with conflicting conclusions. The excessive and prolonged production of NO by iNOS in transplantation rejection and sepsis may be responsible for the negative inotropic effect on cardiac muscles [13,15,16]. In contrast, other studies on isolated heart preparations showed that increasing NO using NO donors resulted in enhanced cardiac contractility [31] and supplementation of NO during the period of ischemia–reperfusion has also been shown to have beneficial effects [32,33]. Furthermore, cardiac preservation in the heterotopic heart transplant model was enhanced by supplementation of the nitric oxide pathway [34]. In a recent study, the importance of basal NO production in preserving myocardial systolic function and coronary vascular tone was demonstrated [12]. Therefore, the role of eNOS in cardiomyocytes is unclear. To address this issue, we studied the effect of overexpression of eNOS on the contractility and coronary flow of the transplanted heart in a model in which eNOS overexpression was predominantly in cardiomyocytes. Using the Langendorff model, in spite of documented eNOS overexpression, this study did not show any significant difference in contractility and coronary flow between the eNOS- and the LacZ-transduced hearts. This negative result may suggest that eNOS is not involved in regulating cardiac contractility and coronary blood flow. Alternatively, the distribution or efficiency of transgene expression was probably too low to affect these variables. More efficient means of transferring genes to the myocardium in donor hearts may affect cardiac contractility and coronary blood flow in the setting of transplantation.
It has been proposed that eNOS gene transfer to the donor heart may be useful in the treatment or prevention of transplant-related atherosclerosis. This condition is the greatest limitation to long-term survival after heart transplantation and there is currently no effective treatment except re-transplantation. Endothelial nitric oxide is an important modulator of vascular smooth muscle tone and proliferation. Potential beneficial properties of nitric oxide include inhibition of platelet aggregation, leukocyte adhesion and smooth muscle cell proliferation [7,8]. As smooth muscle cell proliferation forms an integral part of the pathologic process of accelerated transplant atherosclerosis [2], overexpression of eNOS by adenoviral-mediated gene transfer, leading to a controlled release of NO at the target area, may modify this process [9,35] without compromising cardiac function and avoiding systemic effects. In our model, however, transgene expression was mainly detected in cardiomyocytes. In contrast, rare endothelial cells expressed the transgene. The reason for this pattern of transgene expression is unclear. Thus, it remains to be seen if this pattern of overexpression of eNOS will influence intimal processes such as smooth muscle cell hyperplasia. However, NO is diffusible and we have previously shown that adventitial expression of eNOS in the rabbit carotid artery or the canine basilar artery can effect vascular reactivity [36,37]. This suggests that eNOS overexpression outside the intima (e.g. in cardiomyocytes surrounding small vessels) may influence pathological processes involving the intima.
In summary, delivery of genes to the transplanted heart via the aortic root targets cardiomyocytes. In this study, we demonstrate successful gene transfer of eNOS to the transplanted heart using PCR, RT-PCR, immunohistochemistry and measurement of NOS activity in AdeNOS-transduced hearts and controls. Approximately 1 in 100 myocytes expressed the transgene. eNOS overexpression in cardiomyocytes in this model did not result in alteration of myocardial contractility or coronary blood flow. In the future, methods that enhance gene transfer efficiency may prove useful for modifying these variables in the donor organ. Whether or not transduction of cardiomyocytes will modify vascular consequences of transplantation remains to be determined.
Time for primary review 28 days.
| Acknowledgements |
|---|
The Bruce and Ruth Rappaport Program in Vascular Biology supported this work.
| References |
|---|
|
|
|---|
- Hosenpud J.D., Bennett L.E., Keck B.M., Fiol B., Novick R.J. The Registry of the International Society for Heart and Lung Transplantation: Fourteenth Official Report – 1997. J Heart Lung Transplant (1997) 16:691–712.[Web of Science][Medline]
- Billingham M.E. Cardiac transplant atherosclerosis. Transplant Proc (1987) 19:19–25.[Web of Science][Medline]
- Cary N.R.B. Diagnostic criteria of chronic rejection in transplanted hearts. Transplant Proc (1993) 25(2):2026–2028.[Web of Science][Medline]
- Paul L.C., Fellstrom B. Chronic vascular rejection of the heart and the kidney — have rational treatment options emerged? Transplantation (1992) 53:1169–1179.[Web of Science][Medline]
- McGregor C.G.A. Cardiac transplantation: Surgical considerations and early postoperative management. Mayo Clin Proc (1992) 67:577–585.[Web of Science][Medline]
- Day J.D., Rayburn B.K., Gaudin P.B., et al. J Heart Lung Transplant. (1995) (Nov/Dec Suppl):S142–S148.
- Luscher T.F. Imbalance of endothelium-derived relaxing and contracting factors. A new concept in hypertension? [Review]. Am J Hypertens (1990) 3:317–330.[Web of Science][Medline]
- Furchgott R.F. Role of endothelium in responses of vascular smooth muscle. [Review]. Circ Res (1983) 53:557–573.
[Free Full Text] - Garg U.C., Hassid A. Nitric oxide-generating vasodilators and 8-bromo-cyclic guanosine monophosphate inhibit mitogenesis and proliferation of cultured rat vascular smooth muscle cells. J Clin Invest (1989) 83:1774–1777.[Web of Science][Medline]
- Lee S.W., Trapnell B.C., Rade J.J., Virmani R., Dichek D.A. In vivo adenoviral vector-mediated gene transfer into balloon-injured rat carotid arteries. Circ Res (1993) 73:797–807.
[Abstract/Free Full Text] - Shears L.L., Kawaharada N., Tzeng E., et al. Inducible nitric oxide synthase suppresses the development of allograft arteriosclerosis. J Clin Invest (1997) 100:2035–2042.[Web of Science][Medline]
- Mankad P., Yacoub M. Influence of basal release of nitric oxide on systolic and diastolic function of both ventricles. J Thorac Cardiovasc Surg (1997) 113:770–776.
[Abstract/Free Full Text] - Yang X., Chowdhury N., Cai B., et al. Induction of myocardial nitric oxide synthase by cardiac allograft rejection. J Clin Invest (1994) 94:714–721.[Web of Science][Medline]
- Brady A.J.B., Poole-Wilson P.A., Harding S.E., Warren J.B. Nitric oxide production within cardiac myocytes reduces their contractility in endotoxemia. Am J Physiol (1992) 263:H1963–H1966.[Web of Science][Medline]
- Finkel M.S., Oddis C.V., Jacob T.D., et al. Negative inotropic effects of cytokines on the heart mediated by nitric oxide. Science (1992) 257:387–389.
[Abstract/Free Full Text] - de Belder A.J., Radomski M.W., Martin J.F., Moncada S. Nitric oxide and the pathogenesis of heart muscle disease. [Review]. Eur J Clin Invest (1995) 25:1–8.[Web of Science][Medline]
- Mulligan R.C. The basic science of gene therapy. Science (1993) 260:926–932.
[Abstract/Free Full Text] - Spector D.J., Samaniego L.A. Construction and isolation of recombinant adenovirus with gene replacement. Methods Mol Genet (1995) 7:31–44.[CrossRef]
- Ono K., Lindsey E.S. Improved technique of heart transplantation in rats. J Thorac Cardiovasc Surg (1969) 57:225–229.[Web of Science][Medline]
- Fawcett D.W. A Textbook of Histology. (1994) 12th ed. New York: Chapman and Hall. 294.
- Myatt L., Brockman D.E., Langsdon G., Pollock J.S. Constitutive calcium-dependent isoform of nitric oxide synthase in the human placental villous vascular tree. Placenta (1993) 14:373–383.[CrossRef][Web of Science][Medline]
- Miller V.M., Barber D.A. Modulation of endothelium-derived nitric oxide in canine femoral veins. Am J Physiol (1996) 271(40):H668–H673.[Web of Science][Medline]
- Yang Y., Nunes F.A., Berencsi K., et al. Cellular immunity to viral antigens limits E1-deleted adenoviruses for gene therapy. Proc Natl Acad Sci USA (1994) 91:4407–4411.
[Abstract/Free Full Text] - Yap J., OBrien T., Tazelaar H.D., McGregor C.G.A. Immunosuppression prolongs adenoviral mediated transgene expression in cardiac allograft transplantation. Cardiovasc Res (1997) 35:529–535.
[Abstract/Free Full Text] - Yang Y., Greenough K., Wilson J.M. Transient immune blockage prevents formation of neutralizing antibody to recombinant adenovirus and allows repeated gene transfer to mouse liver. Gene Therapy (1996) 3:412–420.[Web of Science][Medline]
- Shiraishi M., Kusano T., Hara J., et al. Adenovirus-mediated gene transfer using ex vivo perfusion of the heart graft. Surg Today Jpn J Surg (1996) 26:624–628.[CrossRef]
- Chardonnet Y., Dales S. Early events in the interaction of adenoviruses with HeLa cells. I. Penetration of type 5 and intracellular release of the DNA genome. Virology (1970) 40:462–477.[CrossRef][Web of Science][Medline]
- Seki T., Hagiwara H., Naruse K., et al. In situ identification of messenger RNA of endothelial type nitric oxide synthase in rat cardiac myocytes. Biochem Biophys Res Commun (1996) 218(2):601–605.[CrossRef][Web of Science][Medline]
- Balligand J.L., Kobzik L., Han X., et al. Nitric oxide-dependent parasympathetic signaling is due to activation of constitutive endothelial (typeIII) nitric oxide synthase in cardiac myocytes. J Biol Chem (1995) 270(24):14582–14586.
[Abstract/Free Full Text] - Wei C., Jiang S., Lust J.A., Daly R.C., McGregor C.G.A. Genetic expression of endothelial nitric oxide synthase in human atrial myocardium. Mayo Clin Proc (1996) 71(4):346–350.[Abstract]
- Kamelgard J., Crestanello J.A., Fullerton D., Whitman G.J. Nitric oxide as a positive inotropic agent in isolated rat hearts. J Surg Res (1995) 59:482–484.[CrossRef][Web of Science][Medline]
- Vinten-Johansen J., Zhao Z.-Q., Sato H. Reduction in surgical ischemic reperfusion injury with adenosine and nitric oxide therapy. Ann Thorac Surg (1995) 60:852–857.
[Abstract/Free Full Text] - Kurose I., Wolf R., Grisham M.B., Granger D.N. Modulation of ischemia–reperfusion-induced microvascular dysfunction by nitric oxide. Circ Res (1994) 74:376–382.
[Abstract/Free Full Text] - Pinsky D.J., Oz M.C., Koga S., et al. Cardiac preservation is enhanced in a heterotopic rat transplant model by supplementing the nitric oxide pathway. J Clin Invest (1994) 93:2291–2297.[Web of Science][Medline]
- Lou H., Kodama T., Wang Y.N., et al. L-Arginine prevents heart transplant arteriosclerosis by modulating the vascular cell proliferative response to insulin-like growth factor-I and interleukin-6. J Heart Lung Transplant (1996) 15(12):1248–1257.[Web of Science][Medline]
- Kullo I.J., Mozes G., Schwartz R.S., et al. Adventitial gene transfer of recombinant endothelial nitric oxide synthase to rabbit carotid arteries alters vascular reactivity. Circulation (1997) 96:2254–2261.
[Abstract/Free Full Text] - Chen A.F.Y., Jiang S.W., Crotty T.B., et al. Effects of in vivo adventitial expression of recombinant endothelial nitric oxide synthase gene in cerebral arteries. Proc Natl Acad Sci USA (1997) 94:12568–12573.
[Abstract/Free Full Text]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






