Skip Navigation

Cardiovascular Research 1999 42(2):543-549; doi:10.1016/S0008-6363(99)00025-5
© 1999 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Balzer, M.
Right arrow Articles by Groschner, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Balzer, M.
Right arrow Articles by Groschner, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 1999, European Society of Cardiology

Evidence for a role of Trp proteins in the oxidative stress-induced membrane conductances of porcine aortic endothelial cells1

Monika Balzer, Birgit Lintschinger and Klaus Groschner*

Department of Pharmacology and Toxicology, Karl-Franzens-University Graz, A-8010 Graz, Austria

Klaus.Groschner{at}kfunigraz.ac.at

* Corresponding author. Tel.: +43-316-380-5570; fax: +43-316-380-9890

Received 5 October 1998; accepted 21 December 1998


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Objective: Expression of homologues of the Drosophila transient receptor potential (Trp) protein has recently been demonstrated for vascular endothelium. Some Trp isoforms such as Trp3, are known to constitute cation conductances with biophysical properties similar to those of the endothelial oxidant-activated cation conductance. Therefore we tested whether Trp proteins provide the molecular basis of the oxidant-induced membrane currents in porcine aortic endothelial cells (ECAP). Methods: Expression of the Trp3 isoform in ECAP was tested by RT–PCR and subsequent southern blot analysis. In order to knock-out the function of endogenous Trp channels, ECAP were transiently transfected to express NTRP3, a dominant negative fragment of Trp3. Oxidative-stress was introduced by exposure of cells to tert-butylhydroperoxide (tBHP; 400 µM), and membrane currents as well as membrane potential were recorded using the conventional whole cell patch–clamp technique. Results: RT–PCR experiments demonstrated the expression of a Trp3 isoform in ECAP. The oxidant tert.-butylhydroperoxide (tBHP) completely depolarized endothelial cells by activation of a cation conductance which allowed significant Na+ inward currents at negative potentials (mean inward current 462 pA at –80 mV). The tBHP-induced currents resembled Trp-related currents in terms of cation selectivity, La3+ sensitivity and lack of voltage dependence. Expression of the N-terminal fragment of hTrp3 (NTRP3), but not of a C-terminal fragment of hTrp3 (CTRP3), abolished the oxidant-induced cation current and reduced membrane depolarization. Conclusion: Our results strongly suggest Trp proteins as the molecular basis of endothelial oxidant-activated cation channels. It is concluded that Trp proteins play an important role in the redox sensitivity of the vascular endothelium.

KEYWORDS Endothelial functions; Ion channels; Oxidative stress; Trp


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Homologues of the Drosophila transient receptor potential gene product are expressed in many excitable and non-excitable tissues. This family of proteins appear to form ion channel structures that are highly conserved from Caenorhabditis elegans to human. So far, various cellular mechanisms have been implicated in the activation of Trp channels, most importantly PLC-mediated depletion of intracellular Ca2+ stores [1–3]. It appears likely that a variety of TRP channels with different activation and permeation properties are formed by assembly of heterooligomers composed of different Trp isoforms. Recently, expression of multiple Trp homologues has been demonstrated for vascular endothelium [4,5], and evidence for a role of Trp proteins in terms of store-operated cation conductances has been presented [6]. However, the physiologic and/or pathophysiologic role of endothelial Trp channels remains to be determined.

A cation channel that is considered of particular pathophysiologic significance is the non-selective channel which serves as a redox sensor in vascular endothelium [7,8]. Oxidative stress induces a membrane conductance which allows Na+ ions to enter the cell, causing transmembrane ion gradients and membrane potential of endothelial cells to break down [7,8]. The initial redox sensor in this cascade appears to be the non-selective cation channel itself. Oxidant-induced activation of this Na+ channel may be initiated by intracellular accumulation of oxidized glutathione (GSSG) and subsequent thiol–disulfide exchange between GSSG and critical sulfhydrylgroups of the channel protein [7,8].

The cation current induced by various oxidants such as tBHP or GSSG is characterized by La3+ sensitivity, low cation selectivity and the lack of voltage-dependence. Thereby, this current is reminiscent of cation currents previously observed in human umbilical vein endothelial cells (HUVEC) during activation of PLC-linked receptors or store depletion [6,9,10] but also of the currents associated with oxidative stress. Similarities between the membrane conductance provided by specific isoforms (e.g. Trp3) and the endothelial redox-activated cation conductances prompted us to test for a role of Trp proteins in this pathophysiologically relevant membrane property of vascular endothelial cells.

We present evidence for the expression of a Trp3 protein in ECAP, and demonstrate suppression of oxidant-induced membrane currents by expression of a dominant negative fragment of hTrp3. These results indicate a role of Trp channels in vascular pathophysiology.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
2.1 Materials
Tissue culture media were from Gibco BRL (Vienna, Austria), all other chemicals from Sigma Chemical (Vienna, Austria).

2.2 Cell culture
Porcine aortic endothelial cells (ECAP) were isolated and cultured as described [11], using Dulbecco’s modified Eagle’s medium (DMEM) containing antibiotics and 10% foetal calf serum. Primary cultures and subcultures (passage 1–3) were used for experimentation. For preparation of total RNA, subconfluent cells were used. For transient transfection and electrophysiological experiments ECAP were plated on coverslips and used just before confluence was obtained. Oxidative stress was introduced by incubation of cells in serum-free medium containing 400 µM tBHP 60 min prior to experimentation.

Viability of the endothelial cells in the presence of oxidants was tested by a lactate-dehydrogenase [LDH]-leakage assay [12]. None of the treatments caused a significant increase in LDH-leakage from the endothelial cells.

2.3 RT–PCR
RNA was prepared from ECAP cells using the RNeasy Mini-Kit from Qiagen. A mass of 3 µg total RNA was reverse-transcribed into first-strand cDNA with the T-Primed First Strand Kit from Pharmacia Biotech. Aliquots of the cDNA products were used as templates for PCR amplification using primers specific for human Trp3 homologues:
Gene Acc. No. Orientation Primer sequence Location

hTrp3 U47050 Forward 5' atgctgcttttaccactgtag 3' 1985–2005
Reverse 5' tgagttagactgagtgaagag 3' 2413–2433

Cycling conditions were: Three min at 94°C followed by 30 cycles of 30 s at 94°C/30 s at 58–64°C/30 s at 72°C, and a final extension at 72°C for 6 min. ‘No-template’ controls were run along all experiments. PCR products were separated on 1% agarose gels by electrophoresis. Southern blots were performed according to the manufacturers instructions (Boehringer Mannheim, Germany) and hybridized overnight at 42°C with a nested digoxigenin-labeled oligonucleotide designed to bind to the expected PCR products. Sequence of the oligonucleotide probe for hTrp3 was: 5' gacagtgatgtagaatggaag 3'.

2.4 DNA constructs and cell transfection
Constructs used for expression in ECAP were in the bicistronic expression vector pIRES–EGFP (Clontech). NTRP3 consisted of a fragment corresponding to the amino acids 1–302 of hTrp3 (U47050 [GenBank] , [13]). CTRP3 consisted of a fragment comprising the amino acids 725–848 of hTrp3. Subconfluent ECAP were transiently transfected using Superfect reagent (Qiagen). Experiments were performed with cells which expressed green fluorescent protein (GFP) as a marker of successful transfection [10]. Expression of GFP was directed by the pIRES–EGFP vector. Electrophysiological experiments were performed 2–3 days after transfection.

2.5 Electrophysiology
Whole-cell currents were recorded with standard patch–clamp technique at room temperature using an Axopatch 200A amplifier (Axon Instruments, Foster City, CA, USA). Patch pipettes were fabricated from borosilicate glass (Clark Electromedical Instruments; Pangbourne, UK) and had resistances of 1–3 MOhm. The pipette solution contained: 110 mM K-gluconate, 10 mM KCl, 5 mM MgCl2, 10 mM HEPES, 10 mM BAPTA. The free Ca2+ concentration of the pipette solution was approximately 50 nM. The standard bath solution contained: 137 mM NaCl, 5.4 mM KCl, 2 mM CaCl2, 15 mM HEPES, pH of all solutions was adjusted to 7.4 with NMDG (N-methyl-D-glucamine). In some experiments NaCl was omitted in the bath solution and substituted by choline chloride.

Voltage clamp and current amplification were performed with an Axopatch 200A patch-clamp amplifier (Axon Instruments, USA). Effects on membrane conductance were studied by holding the cells at –60 mV and applying slow voltage ramps (0.06 V*s–1; 0.2 Hz) employing pClamp software (Axon Instruments). Membrane potential was measured in current clamp mode or alternatively derived from voltage clamp experiments as the potential corresponding to zero current during voltage ramp protocols.

2.6 Statistics
Averaged data are given as mean±S.E.M. Statistical analysis was performed using Student's t-test for unpaired values and differences were considered statistically significant at P<0.05.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
3.1 Porcine aortic endothelial cells express a Trp3 isoform
RT–PCR products of the expected size (448 bp) were obtained from total RNA preparations of porcine aortic endothelial cells (ECAP; Fig. 1A, lane 1). For comparison, total RNA of HEK293, which are known to express hTrp3 [4] were also subjected to RT–PCR (lane 2), as well as a hTrp3 plasmid clone (lane 5). Primers were designed for specific amplification of the hTrp3 isoform (Acc# U47050 [GenBank] ) [13]. Southern blot hybridization confirmed the identity of the obtained RT–PCR products as hTrp3 homologues (Fig. 1B). These results indicate the expression of a Trp3 isoform in porcine aortic endothelial cells.


Figure 1
View larger version (32K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 (A) ECAP express a Trp3 isoform. RT–PCR products were amplified with specific primers for hTrp3. Arrow indicates the expected fragment size of 448 bp. Lane M: Molecular weight marker (100 bp DNA ladder, New England Biolabs). Lane 1: RT–PCR product of ECAP total RNA. 2: RT–PCR product of HEK293 total RNA. Lanes 3 and 4: No-template controls, 3: PCR from ECAP total RNA without reverse transcription, 4: RT–PCR without nucleic acid template. 5: Positive control: amplification from a hTrp3 plasmid clone. (B) Southern blot analysis of the RT–PCR fragments visible in Panel A. Oligonucleotide probes were designed to bind specifically to the amplified fragment.

 
3.2 Tert-butylhydroperoxide (tBHP) activates a cation conductance in ECAP
ECAP displayed a mean membrane potential of –67.1 mV±24.2 (N=5). Prolonged exposure (60 min) of ECAP to tBHP (400 µM) in serum-free medium resulted in a dramatic increase in membrane conductance and complete elimination of cell potential (mean membrane potential: –4.3 mV±1.3; N=13; Table 1). In tBHP-treated cells, large inward currents were detectable at negative membrane potentials (–80 mV). These inward currents were strongly reduced by removal of extracellular Na+ (Fig. 2), which shifted the zero potential to more negative values. This result indicates a significant contribution of Na+ to the tBHP-induced inward current. This current was completely blocked by 50 µM La3+ (data not shown).


View this table:
[in this window]
[in a new window]

 
Table 1 Membrane current (I–80 mV) and membrane potential (Em) of control cells (non-transfected ECAP, sham-transfected ECAP, pIRES–EGFP-transfected or CTRP3-transfected) and NTRP3-transfected cells without (–tBHP) or with (+tBHP) treatment of cells with the oxidant

 

Figure 2
View larger version (17K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 tBHP activates a cation conductance in ECAP. Upper panel: time course of membrane currents at –80 mV (filled circles) and 0 mV (open circles) recorded from a cell after exposure to tBHP (400 µM, 60 min). Removal of extracellular Na+ [Nae+] leads to reversible shift in the current to voltage relationship. Lower panel: Current to voltage relationships derived at the time points indicated in the upper panel.

 
3.3 Expression of an amino terminal fragment of hTrp3 inhibits tBHP-induced membrane currents
To test whether a Trp protein such as the detected isoform of hTrp3 is involved in the tBHP-induced cation conductance, ECAP were transfected with the N-terminal domain of hTrp3. The rational for this strategy is the recent observation that N-terminal fragments of Trp proteins exert a dominant negative effect on Trp channel function [14].

To confirm expression of the Trp3 fragments in individual cells we cloned the fragments into the bicistronic vector pIRES–EGFP. This vector directs simultaneous expression of the desired protein and the marker protein GFP. ECAP were transiently transfected to express two different cytosolic domains of hTrp3: either (i) the amino terminal domain (aa 1–302, referred to as NTRP3), or (ii) the carboxy terminal domain (aa 725–848, referred to as CTRP3; Fig. 3). Experiments with expression of CTRP3 were performed as controls since the carboxy termini of Trp proteins are not expected to interfere with channel function [14]. Additional controls were performed with sham-transfected or pIRES–EGFP-transfected ECAP. The transfection procedure itself did not affect the response of ECAP to tBHP. tBHP depolarized sham-transfected ECAP from a membrane potential of –40±7 mV to –1.9±1.6 mV (Table 1). The corresponding mean inward currents at –80 mV were 58.5±29.3 pA for untreated and 403.1±68.1 pA for tBHP-treated cells (Table 1). Similarly, ECAP expressing only GFP due to transfection with pIRES–EGFP displayed no modification of the response to tBHP (mean inward current was 442±219 pA, Table 1). In clear contrast, transfection of ECAP with the NTRP3 construct resulted in a significant suppression of the tBHP-induced current at –80 mV (– 98.7 ±16.3 pA; Fig. 4; Table 1). It is of note that the typical inward rectification of the current to voltage relationship observed under basal conditions was clearly present in NTRP3 transfected cells (see insert of Fig. 4). Thus, expression of NTRP3 suppresses the oxidant-activated cation conductance without affecting the basal inwardly rectifying K+ conductance of ECAP. Consistently, the tBHP-induced membrane depolarization was reduced in NTRP3-transfected ECAP. tBHP reduced the membrane potential of NTRP3-transfected cells only to –16.6±3.9 mV (Table 1). Transfection of ECAP with CTRP3 failed to suppress the inward currents induced by tBHP (Fig. 4, Table 1), and did not reduce the depolarizing effect of tBHP (Table 1).


Figure 3
View larger version (10K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Domain structure of the hTrp3 protein. The protein consists of three large domains: The cytosolic amino terminal domain (1–338), a region with six putative transmembrane domains (339–673, hatched) and a cytosolic carboxy terminal domain (674–848). Localization of the expressed fragments (NTRP3, CTRP3) as parts of the complete protein are indicated in the lower panel.

 

Figure 4
View larger version (14K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Expression of NTRP3 but not CTRP3 suppresses tBHP-induced cation conductance. A. Mean values±S.E.M. of membrane currents at –80 mV in sham-transfected, NTRP3-transfected and CTRP3-transfected endothelial cells without (–tBHP) or with (+tBHP) pre-treatment. Number of experiments are given in Table 1. *Indicates significant differences versus control+tBHP. B. Current to voltage relationship derived by voltage ramp protocols are shown. The insert displays the current to voltage relationship in NTRP3 transfected cells with an adjusted y-axis scaling.

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
The results of the present study suggest that homologues of the Drosophila transient receptor potential (Trp) gene product contribute to the non-selective cation conductance activated by oxidative stress in endothelial cells.

Recently, the expression of various members of the Trp protein family has been demonstrated in vascular endothelium [4–6]. Our present knowledge on these proteins suggest an important role of specific members in hormone-regulated Ca2+ but also of monovalent cation conductances [3,15]. It has been demonstrated that heterologous expression of some Trp isoforms produces Ca2+ permeable channels which are regulated by the filling state of intracellular Ca2+ stores [16–18]. Expression of other members of the Trp protein family such as Trp1 and 3, however, gave rise to poorly selective cation conductances which allow for large Na+ currents similar to that observed in endothelial cells upon exposure to oxidative stress. Albeit non-selective Trp channels may, to some extent, contribute to physiologic Ca2+ homeostasis, excessive activation of these channels is expected to result in cellular Na+ loading and membrane depolarization.

The present RT–PCR experiments demonstrate that porcine aortic endothelial cells (ECAP) express indeed one Trp isoform (Trp3) which is capable of forming non-selective cation channels [19]. Our finding is in accordance with previous studies in bovine and human endothelial cells [4–6]. So far up to five Trp genes were detected in vascular endothelial cells [4,5]. A recent report suggests the existence of heteromultimeric Trp complexes [14]. Such multimerization may be the basis of functional diversity among the Trp channel family. Thus, it appears conceivable to speculate that Trp heteromultimers constitute more than one cation conductance in endothelial cells. One group may serve hormonal control of Ca2+ homeostasis while another group may play a role in pathophysiologic situations such as oxidative stress (Fig. 5).


Figure 5
View larger version (33K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Hypothetical functions of endothelial Trps. Trp proteins may be involved in multiple ion conductances of endothelial cells. These Trp-mediated conductances include the store-operated Ca2+ entry pathway and the redox-activated Na+ conductance. Abbreviations: ER: endoplasmatic reticulum; PLC: phospholipase C; PIP2: phosphatidylinositolbisphosphate; IP3: inositoltrisphosphate; GSH: glutathione; GSSG: oxidized glutathione.

 
To investigate whether Trp proteins are involved in the oxidant-induced cation conductance of ECAP, we tested whether expression of the N-terminal domain of Trp (hTrp3), which has been shown to exert a dominant negative effect on Trp channel function, is able to modify this redox activated cation conductance. We used the lipophilic oxidant tBHPr to introduce oxidative stress and to elicit large, redox-activated cation currents in ECAP. The membrane characteristics observed in tBHPr-treated ECAP were consistent with those reported for bovine aortic endothelial cells [7,8]. The oxidative stress-activated cation conductance was characterized by appreciable Na+ permeability, sensitivity to block by La3+, poor voltage dependence and relatively large current noise, features which closely resembled those previously reported for currents derived by expression of Trp 1 or 3 [16,19]. When ECAP were transiently transfected with NTRP3, the oxidant-induced Na+ current was significantly reduced. To confirm that the suppressive effect of NTRP3 expression was indeed specific, we performed control experiments in which the cells were transfected with CTRP3, another cytosolic fragment of hTrp3. Using the yeast two-hybrid approach, Xu and co-workers (1997) [14] demonstrated that the carboxy terminal domain of Trp does not bind to other Trp domains and is therefore not expected to hinder Trp channel assembly. Transient transfection of ECAP with CTRP3 did not affect the tBHP-induced cation conductance suggesting that the inhibitory effect of NTRP3 was indeed specific. Moreover, NTRP3 suppressed the oxidant-induced cation current without affecting the basal inwardly rectifying K+ conductance of these endothelial cells [20], indicating that the effect of NTRP3 is not due to a general, non-selective suppression of endothelial ion conductances. The observation that the redox-activated cation conductance of ECAP is suppressed by expression of NTRP3 strongly supports the concept of a contribution of Trp proteins or Trp-related proteins in this redox-activated membrane conductance. Trp3 appears as one possible candidate for a pathophysiologically relevant Trp species in ECAP. However, NTRP3 is likely to interact not only with the isoform of which it is derived from, but may bind with even higher affinity to other isoforms [14]. Therefore, the exact nature of the Trp species involved in endothelial redox sensitivity needs to be identified in future studies.

So far, activation of Trp channels has been suggested to involve hormone-induced activation of phospholipase C and depletion of intracellular Ca2+ stores. Oxidative stress by itself does not release Ca2+ from intracellular stores [21]. Thus, it appears unlikely that oxidative stress activates Trp channels by depletion of Ca2+ stores. On the other hand, redox sensitivity of Trp channels has, to our knowledge, not yet been studied. Nonetheless, a mechanism of activation independent of intracellular Ca2+ handling such as oxidation of critical sulfhydryl groups due to accumulation of oxidized glutathione [7,8] (Fig. 5) may well be considered for Trp channels.

In summary, the present study provides strong evidence for a central physiologic and/or pathophysiologic role of Trp channels in endothelial cells. The identification of Trp proteins as the molecular basis of redox sensitive cation channels makes future investigations on the physiologic or pathophysiologic role of TRP channels in the endothelium highly desirable. Endothelial Trp proteins may provide a redox sensitive cation conductance which serves control of cell functions via various redox signals and may play a crucial role in oxidant-induced endothelial injury since excessive activation of these channels results in severe membrane depolarization and Na+ loading. Thus, Trp proteins are suggested to determine endothelial redox sensitivity and to represent an attractive target for novel strategies aimed at the prevention of oxidative stress-related vascular dysfunction.

Time for primary review 29 days.


    Acknowledgements
 
This work was supported by the Fonds zur Förderung der Wissenschaftlichen Forschung: SFB Biomembranes (F708 and F715), P12667 [GenBank] and the Austrian National Bank (project 6073). We wish to thank Dr. Xi Zhu for providing the hTrp3 clone and Mrs. Renate Schmidt for excellent technical assistance.


    Notes
 
1 M. Balzer and B. Lintschinger contributed equally to this study. Back


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 

  1. Berridge M.J. Capacitative calcium entry. Biochem J (1995) 312:1–11.[Web of Science][Medline]
  2. Parekh A.B., Penner R. Store depletion and calcium influx. Physiol Rev (1997) 4:901–930.
  3. Birnbaumer L., Zhu X., Jiang M., et al. On the molecular basis and regulation of cellular capacitative Ca2+ entry: roles of TRP proteins. Proc Natl Acad Sci USA (1996) 93:15195–15202.[Abstract/Free Full Text]
  4. Garcia R.L., Schilling W.P. Differential expression of mammalian TRP homologues across tissues and cell lines. Biochem Biophys Res Comm (1997) 239:279–283.[CrossRef][Web of Science][Medline]
  5. Chang A.S., Chang S.M., Garcia R.L., Schilling W.P. Concomitant and hormonally regulated expression of trp genes in bovine aortic endothelial cells. FEBS Lett. (1997) 415:335–340.[CrossRef][Web of Science][Medline]
  6. Groschner K, Hingel S, Lintschinger B, et al. TRP proteins form store-operated cation channels in human vascular endothelial cells. FEBS Lett. 1998; in press.
  7. Koliwad S.K., Kunze D.L., Elliott S.J. Oxidant stress activates a non-selective cation channel responsible for membrane depolarization in calf vascular endothelial cells. J Physiol (1996) 491:1–12.[Abstract/Free Full Text]
  8. Koliwad S.K., Kunze D.L., Elliott S.J. Oxidized glutathione mediates cation channel activation in calf vascular endothelial cells during oxidant stress. J Physiol (1996) 495:37–49.[Abstract/Free Full Text]
  9. Encabo A., Romanin C., Birke F.W., Kukovetz W.R., Groschner K. Inhibition of a store-operated Ca2+ entry pathway in human endothelial cells by the isoquinoline derivative LOE 908. Br J Pharmacol (1996) 119:702–706.[Web of Science][Medline]
  10. Groschner K., Graier W.F., Kukovetz W.R. Histamine induces K+, Ca2+, and Cl currents in human vascular endothelial cells. Role of ionic currents in stimulation of nitric oxide biosynthesis. Circ Res (1994) 75:304–314.[Abstract/Free Full Text]
  11. Mayer B., Schrammel A., Klatt P., Koesling D., Schmidt K. Peroxynitrite-induced accumulation of cyclic GMP in endothelial cells and stimulation of purified soluble guanylyl cyclase. Dependence on glutathione and possible role of S-nitrosation. J Biol Chem (1995) 29:17355–17360.
  12. Vassault A. Methods in enzymatic analysis. Bergmayer H.U., ed. (1984) Weinheim: Verlag Chemie. 118–126.
  13. Zhu X., Peyton M., Birnbaumer L. TRP, a novel mammalian gene essential for agonist-activated capacitative Ca2+ entry. Cell (1996) 85:661–671.[CrossRef][Web of Science][Medline]
  14. Xu X.S., Li H., Guggino W.B., Montell C. Coassembly of TRP and TRPL produces a distinct store-operated conductance. Cell (1997) 89:1155–1164.[CrossRef][Web of Science][Medline]
  15. Sinkins W.G., Estacion M., Schilling P. Functional expression of TrpC1: a human homologue of Drosophila Trp channel. Biochem J (1998) 331:331–339.[Web of Science][Medline]
  16. Zitt C., Zobel A., Obukhov A.G., et al. Cloning and functional expression of a human Ca2+-permeable cation channel activated by calcium store depletion. Neuron (1996) 16:1189–1196.[CrossRef][Web of Science][Medline]
  17. Philipp S., Cavalié A., Freichel M., et al. A mammalian capacitative calcium entry channel homologous to Drosophila TRP and TRPL. EMBO J (1996) 15:6166–6171.[Web of Science][Medline]
  18. Montell C. New light on TRP and TRPL. Mol Pharmacol (1997) 52:755–763.[Abstract/Free Full Text]
  19. Hurst R.S., Zhu M., Boulay G., Birnbaumer L., Stefani E. Ionic currents underlying HTRP3 mediated agonist-dependent Ca2+ influx in stably transfected HEK293 cells. FEBS Lett (1998) 422:333–338.[CrossRef][Web of Science][Medline]
  20. Groschner K., Graier W.F., Kukovetz W.R. Activation of a small-conductance Ca2+-dependent K+ channel contributes to bradykinin-induced stimulation of nitric oxide synthesis in pig aortic endothelial cells. Biochim Biophys Acta (1992) 1137:162–170.[Medline]
  21. Wesson D.E., Elliott S.J. Xanthine oxidase inhibits transmembrane signal transduction in vascular endothelial cells. J Pharmacol Exp Ther (1994) 270:1197–1207.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
FASEB J.Home page
J. Abramowitz and L. Birnbaumer
Physiology and pathophysiology of canonical transient receptor potential channels
FASEB J, February 1, 2009; 23(2): 297 - 328.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
I. N. Bratz, G. M. Dick, J. D. Tune, J. M. Edwards, Z. P. Neeb, U. D. Dincer, and M. Sturek
Impaired capsaicin-induced relaxation of coronary arteries in a porcine model of the metabolic syndrome
Am J Physiol Heart Circ Physiol, June 1, 2008; 294(6): H2489 - H2496.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A. Dietrich and T. Gudermann
Another TRP to Endothelial Dysfunction: TRPM2 and Endothelial Permeability
Circ. Res., February 15, 2008; 102(3): 275 - 277.
[Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. Goel, W. G. Sinkins, C.-D. Zuo, U. Hopfer, and W. P. Schilling
Vasopressin-induced membrane trafficking of TRPC3 and AQP2 channels in cells of the rat renal collecting duct
Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1476 - F1488.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Poteser, A. Graziani, C. Rosker, P. Eder, I. Derler, H. Kahr, M. X. Zhu, C. Romanin, and K. Groschner
TRPC3 and TRPC4 Associate to Form a Redox-sensitive Cation Channel: EVIDENCE FOR EXPRESSION OF NATIVE TRPC3-TRPC4 HETEROMERIC CHANNELS IN ENDOTHELIAL CELLS
J. Biol. Chem., May 12, 2006; 281(19): 13588 - 13595.
[Abstract] [Full Text] [PDF]


Home page
Chem SensesHome page
S. Damak, M. Rong, K. Yasumatsu, Z. Kokrashvili, C. A. Perez, N. Shigemura, R. Yoshida, B. Mosinger Jr., J. I. Glendinning, Y. Ninomiya, et al.
Trpm5 Null Mice Respond to Bitter, Sweet, and Umami Compounds
Chem Senses, March 1, 2006; 31(3): 253 - 264.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Arniges, J. M. Fernandez-Fernandez, N. Albrecht, M. Schaefer, and M. A. Valverde
Human TRPV4 Channel Splice Variants Revealed a Key Role of Ankyrin Domains in Multimerization and Trafficking
J. Biol. Chem., January 20, 2006; 281(3): 1580 - 1586.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. Y. Kim, G. H. Seol, G. H. Liang, J. A. Kim, and S. H. Suh
Na+-K+ pump activation inhibits endothelium-dependent relaxation by activating the forward mode of Na+/Ca2+ exchanger in mouse aorta
Am J Physiol Heart Circ Physiol, November 1, 2005; 289(5): H2020 - H2029.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
X. Yao and C. J. Garland
Recent Developments in Vascular Endothelial Cell Transient Receptor Potential Channels
Circ. Res., October 28, 2005; 97(9): 853 - 863.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Y. Kim and D. Saffen
Activation of M1 Muscarinic Acetylcholine Receptors Stimulates the Formation of a Multiprotein Complex Centered on TRPC6 Channels
J. Biol. Chem., September 9, 2005; 280(36): 32035 - 32047.
[Abstract] [Full Text] [PDF]


Home page
NeuroscientistHome page
M. M. Aarts and M. Tymianski
TRPM7 and Ischemic CNS Injury
Neuroscientist, April 1, 2005; 11(2): 116 - 123.
[Abstract] [PDF]


Home page
Sci SignalHome page
C. Montell
The TRP Superfamily of Cation Channels
Sci. Signal., February 22, 2005; 2005(272): re3 - re3.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. P. Larsson, H. M. Peltonen, G. Bart, L. M. Louhivuori, A. Penttonen, M. Antikainen, J. P. Kukkonen, and K. E. O. Akerman
Orexin-A-induced Ca2+ Entry: EVIDENCE FOR INVOLVEMENT OF TRPC CHANNELS AND PROTEIN KINASE C REGULATION
J. Biol. Chem., January 21, 2005; 280(3): 1771 - 1781.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Rosker, A. Graziani, M. Lukas, P. Eder, M. X. Zhu, C. Romanin, and K. Groschner
Ca2+ Signaling by TRPC3 Involves Na+ Entry and Local Coupling to the Na+/Ca2+ Exchanger
J. Biol. Chem., April 2, 2004; 279(14): 13696 - 13704.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Chu, Q. Tong, J. Y. Cheung, J. Wozney, K. Conrad, V. Mazack, W. Zhang, R. Stahl, D. L. Barber, and B. A. Miller
Interaction of TRPC2 and TRPC6 in Erythropoietin Modulation of Calcium Influx
J. Biol. Chem., March 12, 2004; 279(11): 10514 - 10522.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Zsembery, J. A. Fortenberry, L. Liang, Z. Bebok, T. A. Tucker, A. T. Boyce, G. M. Braunstein, E. Welty, P. D. Bell, E. J. Sorscher, et al.
Extracellular Zinc and ATP Restore Chloride Secretion across Cystic Fibrosis Airway Epithelia by Triggering Calcium Entry
J. Biol. Chem., March 12, 2004; 279(11): 10720 - 10729.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Zhang, X. Chu, Q. Tong, J. Y. Cheung, K. Conrad, K. Masker, and B. A. Miller
A Novel TRPM2 Isoform Inhibits Calcium Influx and Susceptibility to Cell Death
J. Biol. Chem., April 25, 2003; 278(18): 16222 - 16229.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Zsembery, A. T. Boyce, L. Liang, J. Peti-Peterdi, P. D. Bell, and E. M. Schwiebert
Sustained Calcium Entry through P2X Nucleotide Receptor Channels in Human Airway Epithelial Cells
J. Biol. Chem., April 4, 2003; 278(15): 13398 - 13408.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
Y. M. Lee, B. J. Kim, H. J. Kim, D. K. Yang, M. H. Zhu, K. P. Lee, I. So, and K. W. Kim
TRPC5 as a candidate for the nonselective cation channel activated by muscarinic stimulation in murine stomach
Am J Physiol Gastrointest Liver Physiol, April 1, 2003; 284(4): G604 - G616.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
B. Minke and B. Cook
TRP Channel Proteins and Signal Transduction
Physiol Rev, April 1, 2002; 82(2): 429 - 472.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
B. Nilius and G. Droogmans
Ion Channels and Their Functional Role in Vascular Endothelium
Physiol Rev, October 1, 2001; 81(4): 1415 - 1459.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
R. M Leach, H. M Hill, V. A Snetkov, T. P Robertson, and J. P T Ward
Divergent roles of glycolysis and the mitochondrial electron transport chain in hypoxic pulmonary vasoconstriction of the rat: identity of the hypoxic sensor
J. Physiol., October 1, 2001; 536(1): 211 - 224.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. Inoue, T. Okada, H. Onoue, Y. Hara, S. Shimizu, S. Naitoh, Y. Ito, and Y. Mori
The Transient Receptor Potential Protein Homologue TRP6 Is the Essential Component of Vascular {{alpha}}1-Adrenoceptor-Activated Ca2+-Permeable Cation Channel
Circ. Res., February 16, 2001; 88(3): 325 - 332.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
K. Agam, M. von Campenhausen, S. Levy, H. C. Ben-Ami, B. Cook, K. Kirschfeld, and B. Minke
Metabolic Stress Reversibly Activates the Drosophila Light-Sensitive Channels TRP and TRPL In Vivo
J. Neurosci., August 1, 2000; 20(15): 5748 - 5755.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Teubl, K. Groschner, S. D. Kohlwein, B. Mayer, and K. Schmidt
Na+/Ca2+ Exchange Facilitates Ca2+-dependent Activation of Endothelial Nitric-oxide Synthase
J. Biol. Chem., October 8, 1999; 274(41): 29529 - 29535.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Nattel, D. M. Roden, and D. Escande
A spotlight on electrophysiological remodeling and the molecular biology of ion channels
Cardiovasc Res, May 1, 1999; 42(2): 267 - 269.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. R. Halaszovich, C. Zitt, E. Jungling, and A. Luckhoff
Inhibition of TRP3 Channels by Lanthanides. BLOCK FROM THE CYTOSOLIC SIDE OF THE PLASMA MEMBRANE
J. Biol. Chem., November 22, 2000; 275(48): 37423 - 37428.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. Jung, R. Strotmann, G. Schultz, and T. D. Plant
TRPC6 is a candidate channel involved in receptor-stimulated cation currents in A7r5 smooth muscle cells
Am J Physiol Cell Physiol, February 1, 2002; 282(2): C347 - C359.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Balzer, M.
Right arrow Articles by Groschner, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Balzer, M.
Right arrow Articles by Groschner, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?