Skip Navigation

Cardiovascular Research 1999 41(3):746-753; doi:10.1016/S0008-6363(98)00246-6
© 1999 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Rice, G. I.
Right arrow Articles by Grant, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rice, G. I.
Right arrow Articles by Grant, P. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 1999, European Society of Cardiology

Angiotensin converting enzyme and angiotensin II type 1-receptor gene polymorphisms and risk of ischaemic heart disease

Gillian I. Rice*, Carole A. Foy and Peter J. Grant

Unit of Molecular Vascular Medicine, Division of Medicine, School of Medicine, University of Leeds, Leeds LS1 3EX, UK

* Corresponding author. Tel.: +44-113-392-3470; Fax: +44-113-242-3811; E-mail: medgr@medphysics.leeds.ac.uk

Received 20 April 1998; accepted 16 July 1998


    Abstract
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 5 Conclusion
 References
 
Objective: Polymorphisms in several genes of the renin–angiotensin system have been implicated as risk factors for myocardial infarction and ischaemic heart disease. In particular, it has been suggested that the angiotensin converting enzyme insertion/deletion (I/D) polymorphism and the angiotensin II type 1 receptor A1166C polymorphisms might act synergistically to increase the risk of myocardial infarction. The aim of this study was to investigate associations between the angiotensin converting enzyme I/D polymorphism and angiotensin II type 1 receptor polymorphisms and ischaemic heart disease. Methods: We screened 331 white European patients who were recruited for routine angiographic investigation of chest pain, and 287 healthy white European controls for the angiotensin converting enzyme I/D and angiotensin II type 1 receptor A1166C polymorphisms, and related the genotype frequencies to angiotensin converting enzyme levels and the clinical phenotypes of atheroma and history of myocardial infarction. Results: Angiotensin converting enzyme levels were related to I/D polymorphism but not to angiotensin II type 1 receptor polymorphism genotypes. I/D polymorphism and angiotensin II type 1 receptor genotypes did not relate individually to risk of myocardial infarction or atheroma in univariate or multivariate analysis. However, evidence of a synergistic relationship between the AC/II and CC/DD genotypes and coronary stenosis in the major arteries was found. No evidence of any relationship between these polymorphisms and history of myocardial infarction by World Health organisation (WHO) criteria was detected. Conclusion: These findings suggest that there is a weak relationship between the angiotensin converting enzyme I/D and angiotensin II type 1 receptor A1166C polymorphisms and coronary atheroma, but no evidence of a relationship with history of myocardial infarction.

KEYWORDS Renin–angiotensin system; Angiotensin; Coronary disease; Atherosclerosis; Angiography


    1 Introduction
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 5 Conclusion
 References
 
The renin–angiotensin system is one of the major regulators of blood pressure, and fluid and electrolyte homeostasis. Angiotensin converting enzyme (ACE) is a zinc metalloprotease that generates angiotensin II, a powerful vasopressor octapeptide, by cleaving the carboxy-terminal dipeptide from angiotensin I [1, 2]. It also inactivates bradykinin, a vasoactive nonapeptide that inhibits smooth muscle cell proliferation and is a stimulus for t-PA secretion, by breaking it down to form kinin degradation products [3]. It is the binding of angiotensin II to its receptor, the angiotensin II type 1 receptor (AT1R) that mediates regulation of regional blood flow, hyperplastic and hypertrophic vascular smooth muscle cell proliferation and migration [4], activation of monocytes [5], synthesis of PAI-1 [3, 6], increased collagen matrix production by fibroblasts [7], and regulation of local sympathetic activity, pressor and tachycardic responses [8]. It may also be involved in platelet activation and aggregation [5]and the maintenance of cardiovascular structure and repair [9, 10](for review, see [11]). The prominent role of the renin–angiotensin system in cardiovascular regulation suggests that component gene abnormalities could modulate cardiovascular disease processes, and polymorphisms in several genes within the renin–angiotensin system have been linked with cardiovascular disorders [12].

A 287 base-pair insertion/deletion (I/D) polymorphism in intron 16 of the ACE gene has been identified, which accounts for between 26 and 47% of variation in plasma ACE levels [13–15]. Subjects that are homozygous for the insertion allele have the lowest plasma ACE levels, heterozygotes have intermediate and homozygotes for the deletion allele have the highest ACE levels [14]. Numerous studies have suggested an association between the D allele and myocardial infarction (MI) [16–21], including two recent meta-analyses [22, 23], although several studies have failed to show any association [24, 25], including a recent study by our group [26]. The evidence for an association between the DD genotype of ACE and coronary artery disease (CAD) is less strong, with several negative studies [27, 28], including our own [26]. However, significant associations were found in other studies [19, 20], including the Caerphilly Heart Study [29]and, in particular, with coronary heart disease (CHD) in subjects with NIDDM [30]. As the I/D polymorphism lies within an intron, it is unlikely to be the functional variant itself, but rather in linkage disequilibrium with a functional variant either within the ACE gene or in a neighbouring region of the chromosome [18, 26, 31, 32].

The human AT1R is present predominantly in vascular smooth muscle cells. An A1166C substitution in the 3' untranslated region of the AT1R has been identified, which does not alter a potential mRNA polyadenylation or destabilisation signal and is therefore unlikely to be functional [33]. However, it may be in linkage disequilibrium with a functional variant that could affect stability of the mRNA or the regulation of expression of the gene [7, 34]. Thus, both the I/D polymorphism and the AT1R polymorphisms are believed to be markers for functional polymorphisms that have yet to be defined.

Several groups have studied the relationship between the AT1R A1166C polymorphism and disease. The AT1R polymorphism has been found to relate to aortic stiffness in Caucasian hypertensive subjects [7]. In two studies, the ECTIM study [25]and a study of Japanese CAD subjects by Nakauchi et al. [35], associations between the ACE I/D polymorphism and AT1R polymorphisms and MI, and between the AT1R polymorphism and CAD, respectively, have been found. However, a recent study of Caucasian subjects by Jeunemaitre et al. [36]failed to confirm these results.

We previously screened 258 white European patients who were recruited with suspected CAD for several ACE polymorphisms including the I/D polymorphism, and found no relationship with MI or atheroma [26]. We have now extended this study group to include an additional 73 patients, and a set of 287 healthy white European controls. The aim of this study was therefore to investigate associations between the ACE I/D polymorphism and AT1R polymorphisms and ischaemic heart disease (IHD) in 331 white European patients and 287 healthy controls.


    2 Methods
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 5 Conclusion
 References
 
White European patients (331) were recruited from Leeds General Infirmary as reported previously [26]and Pinderfields Hospital in Wakefield, where routine angiography for investigation of chest pain or suspected CAD was performed. Healthy white European control subjects (287) were recruited from local Family Health Services Authority general practice registers. Each subject gave informed consent according to a protocol approved by the United Leeds Teaching Hospitals NHS Trust and the Pinderfields Health Trust Ethics Committees. The investigation conforms with the principles outlined in the Declaration of Helsinki. The presence of CAD was defined as stenosis of at least 50% in a major coronary artery, or one of their branches, as determined by angiography. The extent of disease was classified as the number of arteries with stenosis ≥50% as zero, one, two or three-vessel disease. Diagnosis of MI was ascertained from patients’ hospital records using the WHO criteria [37]of two out of three of the following: ST elevation of 1 mm in two or more successive leads, typical chest pain lasting for longer than 20 min duration, and a creatine kinase rise of more than twice the baseline value.

Free-flowing blood samples were taken after an overnight fast of at least 10 h and abstention from smoking between 8 and 9.30 a.m. A 10-ml volume of whole blood was collected into EDTA, for DNA extraction, and lithium heparin, for plasma lipid analysis. Hypertension was defined as being present in controls if the mean blood pressure was greater than 160 mmHg systolic or 90 mmHg diastolic, and in patients if the subject was described previously as being hypertensive and was receiving treatment. The body mass index (BMI) was calculated from weight in kilograms divided by the square of height in metres. A note was taken of current drug therapy, and smoking history was recorded. Smokers were defined as subjects who currently smoked or who had ceased to smoke within the last ten years. All other subjects were classified as non-smokers.

Measurements of cholesterol and triglycerides were made using a Hitachi 747 auto-analyser (Boehringer Mannheim, Mannheim, Germany). Genomic DNA was extracted using a detergent and salt-exchange method [38]. Plasma ACE activity for each sample was determined using standard methodologies based on the hydrolysis of furanacrylol-1-phenylalanyl-glycylglycine (FAPGG) by ACE with the subsequent decrease in absorbance at 340 nm being a measurement of ACE activity. The coefficient of variation at 80 IU/l was 6% and at 250 IU/l, it was 3.5–4%.

The I/D polymorphism was genotyped as previously described (Rigat et al. 1992) [26, 39]and the possibility of mistyping I/D heterozygotes as DD homozygotes due to preferential amplification of the smaller D allele was addressed by a further amplification using the original antisense primer together with a primer that was specific for the insertion in DD samples, as previously described [40]. Subjects with one 490 bp band on an agarose gel were classified as II (insertion), subjects with both 490 and 190 bp bands were classified as ID, and subjects with only a 190 bp band were classified as DD (deletion). One patient and 14 controls were identified who had been mistyped as DD homozygotes. The I/D genotype could not be determined for one patient and eight controls due to the poor quality of DNA samples.

Amplification of DNA for genotyping the angiotensin II type 1 receptor (AT1R) polymorphism was carried out by polymerase chain reaction (PCR) in a final volume of 25 µl containing 100 ng of genomic DNA, 20 pmol of each primer, 20 mmol/l Tris–HCl (pH 8.4), 50 mmol/l KCl, 0.2 mmol/l of each dNTP, 2 mmol/l MgCl2 and 1.5 U of Taq polymerase (GIBCO, BRL, Gaithersburg, MD, USA). Samples were overlaid with oil. Primers for amplification of a 166 bp sequence, as described by Hingorani and Brown [41]were:

5'ATAATGTAAGCTCATCCACCAAGAAG3' and

5'TCTCCTTCAATTCTGAAAAGTACTTAA3'.

The reaction involved 32 temperature cycles using a PTC-100 thermal cycler (M.J. Research, Watertown, MA, USA), each with a denaturation step of 1 min at 94°C, annealing for 1 min at 54°C, and extension for 1 min at 72°C. The final extension step was of 5 min duration. The PCR product was digested with 2 U of Afl II enzyme, 1% bovine serum albumin (BSA) and 10% NEbuffer (New England Biolabs, Beverly, MA, USA), at 37°C overnight. DNA fragments were separated on 3% NuSieve agarose, and photographed over a UV transilluminator after staining with ethidium bromide. Two independent assessors’, who were blind to the clinical characteristics of the patients, analysed the results. Afl II digestion yielded two bands of 139 and 27 bp in the presence of the restriction site (C allele), and only one band of 166 bp in the absence of the restriction site (A allele). Heterozygotes (AC) showed all three bands.

2.1 Statistics
Age was treated as a non-parametric variable. Values for triglyceride, cholesterol and BMI exhibited a log-normal distribution and these values were log-transformed to permit the use of parametric methods. Patients and controls on ACE inhibitor therapy (n=59 and n=10, respectively) were excluded from analyses of ACE genotype/level interactions.

Independent t-tests were used to compare clinical characteristics between patients and controls. Clinical characteristics of patients and controls with AA, AC or CC genotype were compared by one-way ANOVA. Chi-squared tests were used to compare AT1R genotype in patients with and without atheroma. Sex, smoking and hypertension were compared between patients and controls, and between AT1R genotype groups, by chi-squared tests. Age was compared between groups by Kruskal-Wallis tests. Hardy-Weinberg’s equilibrium was tested by the chi-squared test.

Linear regression models, including age, sex, BMI, smoking, cholesterol, triglycerides, hypertension, I/D polymorphism genotype and AT1R genotype were used to determine which of these factors would have a significant influence on ACE levels. A general factorial ANOVA model was used to determine whether, after adjusting for the covariates thus identified, the relationship between ACE levels of patients and controls would be altered.

Age, sex, BMI, smoking, cholesterol, triglycerides, hypertension, ACE levels, I/D polymorphism genotype and AT1R genotype were entered into logistic regression models to determine which variables would remain as significant predictors of atheroma and MI. An interaction term was created between the I/D polymorphism and AT1R genotypes and this was also entered into the model.

All computations were carried out using the SPSS for Windows Version 6.1 statistical package.


    3 Results
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 5 Conclusion
 References
 
3.1 ACE, AT1R and cardiovascular risk factors
The clinical characteristics of the 331 patients and 287 controls are shown in Table 1. Due to incomplete medical histories, 69 control subjects had no data on smoking habit or hypertension. Samples were not available for determination of ACE levels for 47 patients and 12 controls. The control group was significantly younger than the patients, and had lower BMI, cholesterol levels and triglyceride levels than the patients. The patients were predominantly male (69.2%), whereas the controls were predominantly female (54.0%). The patient group had a higher prevalence of hypertension and smoking compared with the controls. There was no difference in ACE levels between the patients and controls.


View this table:
[in this window]
[in a new window]

 
Table 1 Clinical characteristics of the 331 patients and 287 controls

 
All genotypes were in Hardy-Weinberg equilibrium. There were no differences in any of the clinical characteristics of the patient group when sub-divided by AT1R genotype (data not shown). ACE levels were not associated with AT1R genotype (Table 2), and did not differ between AA, AC or CC patients and controls. As reported previously [26], ACE levels were very strongly associated with I/D polymorphism genotype in both patients and controls (Table 2), with the lowest levels being found in II homozygotes, intermediate levels in ID heterozygotes, and highest levels in DD homozygotes (p<0.0005 for patients and controls). II homozygote patients had significantly higher ACE levels than II homozygote controls (p=0.004), but ACE levels did not differ between ID and DD patients and controls.


View this table:
[in this window]
[in a new window]

 
Table 2 ACE levels in patients and controls by AT1R and I/D polymorphism genotype

 
In linear regression analysis to determine the factors that influence ACE levels (removing patients and controls on ACE inhibitors prior to analysis), in patients, the I/D polymorphism genotype accounted for 10.5% of variation in levels (p<0.00005) and triglycerides accounted for a further 2.7% (p=0.01), leaving 86.8% of variation in ACE levels unaccounted for. In controls, the I/D polymorphism accounted for 22.5% of variation in ACE levels (p<0.00005), age for a further 7.6% (p=0.0002) and sex for a further 3.1% (p=0.01), leaving 66.8% of variation in ACE levels unaccounted for. Using a general factorial ANOVA model and adjusting for I/D polymorphism genotype, age, sex and triglyceride levels, only I/D polymorphism genotype (p<0.0005), age (p=0.02) and triglycerides (p=0.001) remained as significant independent predictors of ACE levels, and the adjusted mean ACE levels did not differ between patients and controls (adjusted means: patients, 77.6; controls, 77.7 IU/l).

3.2 ACE, AT1R and history of MI
One-hundred and twenty two of the patients had a positive history of MI, 235 of the patients had stenosis >50% in one, two or three vessels, as defined by coronary angiography, and ten patients with no atheroma and 112 patients with atheroma had a positive history of MI (p<0.0005). No differences were found between the AT1R genotypes or ACE I/D genotypes of the patients and controls (Table 3), or the allele frequencies of either polymorphism. There was no association between ACE levels and history of MI, or within the subgroup of patients with angiographic evidence of atheroma, compared with controls. Neither the AT1R genotype nor the I/D polymorphism genotype was found to be related to history of MI, or within the subgroup of patients with atheroma, confirming our previous findings [26]. In addition, no differences were found when comparing patients with a positive history of MI to patients with no history of MI and controls for AT1R genotype when subjects were already subdivided by their I/D polymorphism genotype (data not shown).


View this table:
[in this window]
[in a new window]

 
Table 3 AT1R genotypes for patients and controls

 
In logistic regression analysis, I/D polymorphism genotype, AT1R genotype, an interaction term between the two, and ACE levels were not significant independent predictors of MI. However, as expected, age, male sex, smoking and triglyceride levels were found to be significant independent predictors of MI. Odds ratios [95% confidence interval (CI)]: age 1.05 (1.03–1.07) (p<0.00005), smoking 1.55 (1.17–2.06) (p=0.003), triglycerides 1.64 (1.06–2.55) (p=0.03) and male sex 1.39 (1.07–1.81) (p=0.01).

3.3 ACE, AT1R and atheroma
There was no association between ACE levels, angiographic evidence of atheroma, or the number of diseased vessels, compared with controls and no association was found between AT1R genotype or I/D polymorphism genotype and the presence of atheroma, or with the number of diseased vessels (data not shown), confirming our previous findings [26].

When I/D polymorphism genotyped patients and controls were sub-divided by their AT1R genotype (Table 4), within the ACE II genotype group, no differences were found between genotype distributions of patients with atheroma and controls. However, when patients with no atheroma were compared with patients with atheroma, a large number of AC heterozygotes were found in the group with no atheroma (p=0.009). Comparing the group without atheroma with the controls, again there was an excess of A/C heterozygotes in the group without atheroma (p=0.02).


View this table:
[in this window]
[in a new window]

 
Table 4 AT1R genotype within patients with and without ≥50% stenosis and controls, and within subgroups of I/D polymorphism genotype

 
There were no differences in AT1R genotype distributions within the ACE ID genotype groups of patients and controls. However, within the ACE DD genotype group, the AT1R CC genotype was associated with the presence of atheroma, compared with the group with no atheroma (p=0.047), and the control group (p=0.05). However, there was no significant difference between the genotype distributions of the group with no atheroma and the control group.

In order to test the strength of these results, a chi-squared test was used to look for heterogeneity in gene frequencies of patients with atheroma compared with patients with no angiographic evidence of atheroma and controls. When the patients with atheroma, no atheroma and controls were sub-divided by AT1R polymorphism genotype (Table 5), there were no significant differences in the I/D polymorphism genotype distributions.


View this table:
[in this window]
[in a new window]

 
Table 5 Distribution of AT1R genotypes in patients with >50% stenosis and controls according to ACE genotype

 
In logistic regression models, I/D polymorphism genotype, AT1R genotype, an interaction term between the two, and ACE levels were not significant independent predictors of the presence of atheroma, as detected by coronary angiography. However, as expected, age, smoking, hypertension, triglycerides and male sex were significant independent predictors of atheroma. Odds ratios (95% CI): age 1.08 (1.06–1.11) (p<0.00005), smoking 1.61 (1.21–2.14) (p=0.001), hypertension 1.72 (1.23–2.40) (p=0.001), triglycerides 3.71 (2.19–6.29) (p<0.00005) and male sex 2.03 (1.52–2.72) (p<0.00005).


    4 Discussion
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 5 Conclusion
 References
 
The prominent role of the renin–angiotensin system in cardiovascular regulation suggests that component gene abnormalities could modulate cardiovascular disease processes [12]. The ACE I/D polymorphism is thought to be in linkage disequilibrium with a functional variant that controls ACE levels in plasma, and also possibly at a cellular level [18, 26, 31, 32]. No information is available regarding AT1R genotype–phenotype relations. However, the AT1R A1166C polymorphism (located in the 3'UTR of the AT1R gene) might be in linkage disequilibrium with a functional variant that controls angiotensin II levels in plasma or at a cellular level, by altering the number or expression of angiotensin II type 1 receptors, or by altering the down-regulation of the AT1R in response to angiotensin II [7, 34].

4.1 ACE levels, polymorphism genotypes and cardiovascular risk
In this study, there were no differences in ACE levels after adjusting for I/D polymorphism genotype, age, sex and triglyceride levels between the patient and control groups, or ACE levels between AT1R genotypes of patients and controls. As reported previously [14, 15, 31, 32, 42], ACE levels were very strongly associated with I/D polymorphism genotype in both patients and controls and, in addition, II homozygote patients were found to have significantly higher ACE levels than II homozygote controls. No association was found between ACE levels and hypertension, MI, angiographic evidence of atheroma or the number of diseased vessels. These results support previous findings that ACE levels were not related to hypertension [43, 44]or MI [20], but are at variance with two other studies [18, 42]

4.2 ACE, AT1R and history of MI
In this study, no evidence of an association was found between ACE I/D polymorphism genotype, AT1R polymorphism genotype and history of MI in the whole patient group, or within the subgroup of patients with atheroma. No evidence of an interaction was found between the I/D polymorphism genotype and AT1R genotype on risk of MI.

To date, many positive studies have been published demonstrating an association between the ACE I/D polymorphism, MI and CAD [16–21, 30]. In 1994, the ECTIM study [25]found a significant interaction between the ACE I/D and AT1R A1166C polymorphisms on the risk of MI in 613 MI and 723 age-matched controls in four European populations. This association was restricted to the DD/CC genotype group, which was found in 18% of cases, but also in 13% of controls. In a study of Japanese CHD patients [35], the ACE DD genotype was found to be related to MI, and the C allele of the AT1R gene was found to be associated with increased severity of CAD. However, no relationship was found between the frequencies of the ACE and AT1R genotypes. In 1997, 463 Caucasian patients undergoing coronary angiography were studied in the CORGENE study [36]. Of these, 156 had a history of MI. No association was found between the ACE I/D or AT1R A1166C polymorphisms and the number of vessels with >75% stenosis, or with history of MI.

4.3 ACE, AT1R and atheroma
In this study, no association was found between the I/D polymorphism genotype and the presence of >50% stenosis, as detected by coronary angiography, or with the number of diseased vessels. The present study also failed to demonstrate an association between the A1166C polymorphism of the AT1R gene and atheroma.

When patients and controls were sub-divided by both I/D polymorphism and AT1R genotype, as was performed in the ECTIM study [25], within the ACE DD group, the AT1R CC genotype was found to be associated with the presence of atheroma, compared with the group with no atheroma (p=0.047) and when compared with the control group (p=0.05). There was no significant difference between the genotype distributions of the group with no atheroma and the control group. This suggests that it was the atheroma group that had an unusual genotype distribution, with an excess of AC/DD and CC/DD genotype groups. This provides evidence that there is a positive association between the AC/DD and CC/DD genotypes and evidence of large vessel disease.

Within the ACE II group, no differences were found between genotype distributions of patients with atheroma and controls. However, unexpectedly large numbers of AC heterozygotes were found in the no atheroma group, when compared with the atheroma group and the controls. This suggests that it was the gene frequencies of the no atheroma group that were unusual. The patient group consisted of subjects undergoing coronary angiography for routine investigation of chest pain. Patients with no angiographic evidence of atheroma thus had chest pain for another reason, for example, stenosis of smaller vessels. It is thus possible that patients with small vessel disease as opposed to large vessel disease might have an excess of the AC/II genotype, which might be protective against development of large vessel disease.

In order to test the validity of these findings, a chi-squared test was used to look for heterogeneity in gene frequencies of patients with atheroma compared with patients with no atheroma and controls (as exemplified by Chowdhury et al. [45]). If synergy between the CC and DD genotypes, and between the AC and II genotypes, is valid, significant heterogeneity is expected in cases, but not in controls. In fact, no heterogeneity of genotypes was seen in any of the three groups in this study. This suggests that these results could be a chance finding, especially because the p values for the CC/DD interaction were only just significant. However, a p value of 0.009 for the AC/II interaction suggests that this finding is more likely to be valid.


    5 Conclusion
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 5 Conclusion
 References
 
In logistic regression models, ACE I/D polymorphism, AT1R genotypes and ACE levels were not found to be significant independent predictors of either atheroma, or a positive history of MI. One possible explanation for the apparent relationship between ACE genotype and CAD could be publication bias, with only a handful of large negative studies having been published [24, 25, 27], including our study [26]. In 1996, a meta-analysis of 14 studies of MI and the ACE I/D polymorphism [22]found an association of the DD genotype with MI [odds ratio 1.26 (1.15–1.39) (p<0.0001)] but with evidence of possible publication bias, with few small negative studies being published. In 1997, a second meta-analysis of a total of 145 studies of cardiovascular–renal disorders and the ACE I/D polymorphism [23]found an association of the D allele with increased risk of CHD and MI, but again found evidence of possible publication bias. This phenomenon might mask a true lack of association of the ACE I/D polymorphism with MI, and further large population studies would be required to resolve this issue.

Alternatively, clinical evaluation and definition of phenotype varied between studies, with Nakauchi et al. [35]and Jeunemaitre et al. [36]employing >75% stenosis as indicative of disease whilst we used >50%. It is possible that the D allele of ACE would be associated with more advanced disease, but the lack of association in the study by Jeunemaitre et al. [36]suggests that this is not the case.

All of the studies published to date regarding the possible synergy between the ACE I/D polymorphism and AT1R genotypes, and the current study, suffer from the problem of the small numbers of patients involved in subgroup analyses. However, this problem could only be resolved by performing meta-analysis of the published data, or by performing a large prospective study.

A major strength of the present study is the inclusion of a control group of healthy white European subjects from the same locality as the patient group. Despite the fact that the controls were not age- or sex-matched for the patient group, the genotype frequencies for patients and controls were very similar. This strengthens the results of the present study, those by Jeunemaitre et al. [36]and our previous study [26], which failed to show any association of the ACE I/D polymorphism with MI.

In conclusion, the present study demonstrated a weak association between the ACE I/D polymorphism, AT1R A1166C polymorphism and angiographic evidence of IHD. Further analysis of the data failed to confirm these findings, which suggests that they are chance observations in a study group that has undergone multiple measurements. Evidence for a role for the genetics of the renin–angiotensin system in CAD remains unconvincing and, in either case, it is doubtful that screening for the DD/CC genotype in the general population would have any clinical relevance because of their limited discriminatory value.

Time for primary review 29 days.


    Acknowledgements
 
This work was supported by grants from the Northern and Regional Health Authority, the National Heart Research Fund and the British Heart Foundation.


    References
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 5 Conclusion
 References
 

  1. Ehlers M.R.W., Riordan J.F. Angiotensin-converting enzyme: New concepts concerning its biological role. Biochemistry (1989) 28:5311–5318.[CrossRef][Web of Science][Medline]
  2. Soubrier F., Hubert C., Testut P., et al. Molecular biology of the angiotensin I converting enzyme: I. Biochemistry and structure of the gene. J Hypertens (1993) 11:471–476.[Web of Science][Medline]
  3. Brown N.J., Vaughan D.E. The renin–angiotensin and fibrinolytic systems. Co-conspirators in the pathogenesis of ischemic cardiovascular disease. Trends Cardiovasc Med (1996) 6:239–243.[CrossRef][Web of Science]
  4. Griendling K.K., Lassègue B., Alexander R.W. The vascular angiotensin (AT1) receptor. Thromb Haemost (1993) 70:188–192.[Web of Science][Medline]
  5. Dzau V.J. Cell biology and genetics of angiotensin in cardiovascular disease. J Hypertens (1994) 12:S3–S10.
  6. Kerins D.M., Hao Q., Vaughan D.E. Angiotensin induction of PAI-1 expression in endothelial cells is mediated by the hexapeptide angiotensin IV. J Clin Invest (1995) 96:2515–2520.[Web of Science][Medline]
  7. Benetos A., Topouchian J., Ricard S., et al. Influence of angiotensin II type 1 receptor polymorphism on aortic stiffness in never-treated hypertensive patients. Hypertension (1995) 26:44–47.[Abstract/Free Full Text]
  8. Dieguez-Lucena J.L., Aranda-Lara P., Ruiz-Galdón M. Angiotensin I-converting enzyme genotypes and angiotensin II receptors response to therapy. Hypertension (1996) 28:98–103.[Abstract/Free Full Text]
  9. Schieffer B., Wirger A., Meybrunn M., et al. Comparative effects of chronic angiotensin-converting enzyme inhibition and angiotensin II type 1 receptor blockade on cardiac remodeling after myocardial infarction in the rat. Circulation (1994) 89:2273–2282.[Abstract/Free Full Text]
  10. Oddie C.J., Dilley R.J., Kanellakis P., Bobik A. Chronic angiotensin II type 1 receptor antagonism in genetic hypertension: effects on vascular structure and reactivity. J Hypertens (1993) 11:717–724.[Web of Science][Medline]
  11. Fluharty SJ, Reagan LP, Yee DK. The angiotensin type 1 and type 2 receptor families. Siblings or cousins? In: Mukhopadhyay AK, Raizada MK, editors. Tissue renin–angiotensin systems. New York: Plenum Press, 1995:193–211.
  12. Hunley T.E., Julian B.A., Phillips III J.A., et al. Angiotensin converting enzyme gene polymorphism: Potential silencer motif and impact on progression in IgA nephropathy. Kidney Int (1996) 49:571–577.[Web of Science][Medline]
  13. Alhenc-Gelas F., Richard J., Courbon D., Warnet J.M., Corvol P. Distribution of plasma angiotensin I-converting enzyme levels in healthy man: Relationship to environmental and hormonal parameters. J Lab Clin Med (1991) 117:33–39.[Web of Science][Medline]
  14. Rigat B., Hubert C., Alhenc-Gelas F., et al. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest (1990) 86:1343–1346.[Web of Science][Medline]
  15. Tiret L., Rigat B., Visvikis S., et al. Evidence, from combined segregation and linkage analysis, that a variant of the angiotensin I-converting enzyme (ACE) gene controls plasma ACE levels. Am J Hum Genet (1992) 51:197–205.[Web of Science][Medline]
  16. Cambien F., Poirier O., Lecerf L., et al. Deletion polymorphism in the gene for angiotensin-converting enzyme is a potent risk factor for myocardial infarction. Nature (1992) 359:641–644.[CrossRef][Medline]
  17. Bohn M., Berge K.E., Bakken A., Erikssen J., Berg K. Insertion/deletion (I/D) polymorphism at the locus for angiotensin I-converting enzyme and parental history of myocardial infarction. Clin Genet (1993) 44:298–301.[Web of Science][Medline]
  18. Cambien F., Costerousse O., Tiret L., et al. Plasma level and gene polymorphism of angiotensin-converting enzyme in relation to myocardial infarction. Circulation (1994) 90:669–676.[Abstract/Free Full Text]
  19. Arbustini E., Grasso M., Fasani R., et al. Angiotensin converting enzyme gene deletion allele is independently and strongly associated with coronary atherosclerosis and myocardial infarction. Br Heart J (1995) 74:584–591.[Abstract/Free Full Text]
  20. Gardemann A., Weiss T., Schwartz O., et al. Gene polymorphism but not catalytic activity of angiotensin I-converting enzyme is associated with coronary artery disease and myocardial infarction in low-risk patients. Circulation (1995) 92:2796–2799.[Abstract/Free Full Text]
  21. Ludwig E., Corneli P.S., Anderson J.L., et al. Angiotensin-converting enzyme gene polymorphism is associated with myocardial infarction but not with development of coronary stenosis. Circulation (1995) 91:2120–2124.[Abstract/Free Full Text]
  22. Samani N.J., Thompson J.R., O’Toole L., Channer K., Woods K.L. A meta-analysis of the association of the deletion allele of the angiotensin-converting enzyme gene with myocardial infarction. Circulation (1996) 94:708–712.[Abstract/Free Full Text]
  23. Staessen J.A., Wang J.G., Ginocchio G., et al. The deletion/insertion polymorphism of the angiotensin converting enzyme gene and cardiovascular–renal risk. J Hypertens (1997) 15:1579–1592.[CrossRef][Web of Science][Medline]
  24. Lindpaintner K., Pfeffer M.A., Kreutz R., et al. A prospective evaluation of an angiotensin-converting-enzyme gene polymorphism and the risk of ischaemic heart disease. N Engl J Med (1995) 332:706–711.[Abstract/Free Full Text]
  25. Tiret L., Bonnardeaux A., Poirier O., et al. Synergistic effects of angiotensin-converting enzyme and angiotensin-II type 1 receptor gene polymorphisms on risk of myocardial infarction. Lancet (1994) 344:910–913.[CrossRef][Web of Science][Medline]
  26. Foy C.A., Rice G.I., Ossei-Gerning N., Mansfield M.W., Grant P.J. Angiotensin-converting enzyme (ACE) gene polymorphisms in patients characterised by coronary angiography. Hum Genet (1997) 100:420–425.[CrossRef][Web of Science][Medline]
  27. Friedl W., Krempler F., Paulweber B., Pichler M., Sandhofer F. A deletion polymorphism in the angiotensin converting enzyme gene is not associated with coronary heart disease in an Austrian population. Atherosclerosis (1995) 112:137–143.[CrossRef][Web of Science][Medline]
  28. Dessì-Fulgheri P., Catalini R., Sarzani R., et al. Angiotensin converting enzyme gene polymorphism and carotid atherosclerosis in a low-risk population. J Hypertens (1995) 13:1593–1596.[Web of Science][Medline]
  29. Mattu R.K., Needham E.W.A., Galton D.J., et al. A DNA variant at the angiotensin-converting enzyme gene locus associates with coronary artery disease in the Caerphilly Heart Study. Circulation (1995) 91:270–274.[Abstract/Free Full Text]
  30. Ruiz J., Blanché H., Cohen N., et al. Insertion/deletion polymorphism of the angiotensin-converting enzyme gene is strongly associated with coronary heart disease in non-insulin-dependent diabetes mellitus. Proc Natl Acad Sci USA (1994) 91:3662–3665.[Abstract/Free Full Text]
  31. McKenzie C.A., Julier C., Forrester T., et al. Segregation and linkage analysis of serum angiotensin I- converting enzyme levels: Evidence for two quantitative-trait loci. Am J Hum Genet (1995) 57:1426–1435.[Web of Science][Medline]
  32. Villard E., Tiret L., Visvikis S. Identification of new polymorphisms of the angiotensin I- converting enzyme (ACE) gene, and study of their relationship to plasma ACE levels by two-QTL segregation-linkage analysis. Am J Hum Genet (1996) 58:1268–1278.[Web of Science][Medline]
  33. Bonnardeaux A., Davies E., Jeunemaitre X., et al. Angiotensin II type 1 receptor gene polymorphisms in human essential hypertension. Hypertension (1994) 24:63–69.[Abstract/Free Full Text]
  34. Lassègue B., Alexander R.W., Nickenig G., et al. Angiotensin II down-regulates the vascular smooth muscle AT1 receptor by transcriptional and post-transcriptional mechanisms: Evidence for homologous and heterologous regulation. Mol Pharmacol (1995) 48:601–609.[Abstract]
  35. Nakauchi Y., Suehiro T., Yamamoto M., et al. Significance of angiotensin I-converting enzyme and angiotensin II type 1 receptor gene polymorphisms as risk factors for coronary heart disease. Atherosclerosis (1996) 125:161–169.[CrossRef][Web of Science][Medline]
  36. Jeunemaitre X., Ledru F., Battaglia S., et al. Genetic polymorphisms of the renin–angiotensin system and angiographic extent and severity of coronary artery disease: the CORGENE study. Hum Genet (1997) 99:66–73.[CrossRef][Web of Science][Medline]
  37. Report of the Joint International Society and Federation of Cardiology/World Health Organization Task Force on Standardization of Clinical Nomenclature. Nomenclature and Criteria for Diagnosis of Ischemic Heart Disease. Circulation 1979;59:607–608.
  38. Mansfield M.W., Stickland M.H., Carter A.M., Grant P.J. Polymorphisms of the plasminogen activator inhibitor-1 gene in type 1 and type 2 diabetes, and in patients with diabetic retinopathy. Thromb Haemost (1994) 71:731–736.[Web of Science][Medline]
  39. Rigat B., Hubert C., Corvol P., Soubrier F. PCR detection of the insertion/deletion polymorphism of the human angiotensin converting enzyme gene (DCP1) (dipeptidyl carboxypeptidase 1). Nucleic Acids Res (1992) 20:1433.[Free Full Text]
  40. Shanmugam V., Sell K.W., Saha B.K. Mistyping ACE heterozygotes. PCR Methods Appl (1993) 3:120–121.[Web of Science][Medline]
  41. Hingorani A.D., Brown M.J. A simple molecular assay for the C1166 variant of the angiotensin II type 1 receptor gene. Biochem Biophys Res Commun (1995) 213:725–729.[CrossRef][Web of Science][Medline]
  42. Busjahn A., Knoblauch M., Bohlender J., et al. Angiotensin-converting enzyme and angiotensinogen gene polymorphisms, plasma levels cardiac dimensions. A twin study. Hypertension (1997) 29:165–170.[Abstract/Free Full Text]
  43. Schmidt S., van Hooft I.M.S., Grobbee D.E., Ganten D., Ritz E. Polymorphism of the angiotensin I converting enzyme gene is apparently not related to high blood pressure: Dutch Hypertension and Offspring Study. J Hypertens (1993) 11:345–348.[Web of Science][Medline]
  44. Jeunemaitre X., Lifton R.P., Hunt S.C., Williams R.R., Lalouel J.M. Absence of linkage between the angiotensin converting enzyme locus and human essential hypertension. Nat Genet (1992) 1:72–75.[CrossRef][Web of Science][Medline]
  45. Chowdhury T.A., Dronsfield M.J., Jones A.F., Bain S.C. Angiotensin II receptor gene polymorphisms and risk of myocardial infarction. Lancet (1994) 344:1502–1503.[Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Arch Intern MedHome page
E. Zintzaras, G. Raman, G. Kitsios, and J. Lau
Angiotensin-Converting Enzyme Insertion/Deletion Gene Polymorphic Variant as a Marker of Coronary Artery Disease: A Meta-analysis
Arch Intern Med, May 26, 2008; 168(10): 1077 - 1089.
[Abstract] [Full Text] [PDF]


Home page
Am J EpidemiolHome page
K. D. Marciante, J. C. Bis, M. J. Rieder, A. P. Reiner, T. Lumley, S. A. Monks, C. Kooperberg, C. Carlson, S. R. Heckbert, and B. M. Psaty
Renin-Angiotensin System Haplotypes and the Risk of Myocardial Infarction and Stroke in Pharmacologically Treated Hypertensive Patients
Am. J. Epidemiol., July 1, 2007; 166(1): 19 - 27.
[Abstract] [Full Text] [PDF]


Home page
Journal of Renin-Angiotensin-Aldosterone SystemHome page
Chunlan Yan, Jinbiao Zhan, and Weihong Feng
Gene Polymorphisms of Angiotensin II Type 1 Receptor and Angiotensin-Converting Enzyme in Two Ethnic Groups Living in Zhejiang Province, China
Journal of Renin-Angiotensin-Aldosterone System, September 1, 2005; 6(3): 132 - 137.
[Abstract] [PDF]


Home page
HypertensionHome page
A. Jones, S. S. Dhamrait, J. R. Payne, E. Hawe, P. Li, I. S. Toor, L. Luong, P. T.E. Wootton, G. J. Miller, S. E. Humphries, et al.
Genetic Variants of Angiotensin II Receptors and Cardiovascular Risk in Hypertension
Hypertension, October 1, 2003; 42(4): 500 - 506.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Rice, G. I.
Right arrow Articles by Grant, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rice, G. I.
Right arrow Articles by Grant, P. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?