Skip Navigation

Cardiovascular Research 1998 38(2):301-315; doi:10.1016/S0008-6363(98)00026-1
© 1998 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Doevendans, P. A.
Right arrow Articles by van Bilsen, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Doevendans, P. A.
Right arrow Articles by van Bilsen, M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 1998, European Society of Cardiology

Hunting down nucleic acid binding factors in the cardiovascular system

Pieter A. Doevendansa,*, Pilar Ruiz-Lozanoc and Marc van Bilsenb

aDept. of Cardiology, Cardiovascular Research Institute Maastricht, Maastricht, Netherlands
bDept. of Physiology, Cardiovascular Research Institute Maastricht, Maastricht, Netherlands
cDept. of Medicine, Center for Molecular Genetics, UCSD, La Jolla, CA, USA

* Corresponding author. Tel.: +31 (43) 387 5095; Fax: +31 (43) 387 5104; E-mail: pieter.doevendans@cardio.azm.nl

Received 19 August 1997; accepted 12 January 1998


   Abstract
Top
 Abstract
1 Introduction
 2 Conclusions
 References
 
Transcription regulation of genes active in the cardiovascular system is a complex process, involving DNA and RNA binding proteins. Nucleic acid binding proteins bind to the regulatory DNA and interact with other proteins, including RNA polymerase to initiate and control the level of transcription. The RNA binding proteins have a function in spliceosome formation and in stabilising mRNA. In this review the currently available molecular approaches to analyse regulatory DNA in relation to DNA binding proteins are discussed. Similar techniques that have been developed for RNA binding protein studies are included. In addition to an explanation of the various methods, examples are provided from DNA-protein interactions on genes active in the cardiovascular system, together with strategies for identification and characterisation of new nucleic acid binding proteins active in cardiac or vascular cell types.

KEYWORDS Transcription factors; DNA-protein binding; RNA binding proteins; Transient transfection; Transgenesis; Mouse; Transcription initiation


   1 Introduction
Top
 Abstract
 1 Introduction
2 Conclusions
 References
 
The basic principles of modern molecular biology have been introduced in this Journal by Swynghedauw and co-workers in two instructive reviews [1, 2]. These papers were complemented with overviews by van Bilsen and Chien and by Robbins on the mechanisms of cardiac transcription regulation during cardiac development and hypertrophy [3, 4]. Key players both on the DNA and protein level in muscle formation and cardiomyocyte differentiation were addressed, illustrating the complexity of transcription regulation. In this paper we will implement terminology explained in the previous reviews, while discussing the currently available molecular techniques to identify and characterise novel genes involved in the process of cardiovascular gene transcription and post transcriptional regulation.

The general concept of gene structure distinguishes regulatory DNA and transcribed DNA regions. The transcribed DNA can be separated in exons (coding DNA) and introns. The regulatory DNA is composed of the 5' flanking region containing the so called essential or core promoter and enhancers\silencers positioned before the first exon. The regulatory DNA can also involve the first intron and the 3' flanking region located behind the coding region or enhancers located in distant DNA regions [2, 5, 6]. To initiate transcription the localisation and orientation of the essential promoter is fixed. In contrast the position of enhancer\silencer sequences is less critical which is illustrated experimentally by the fact that these sequences can be moved throughout the gene and the orientation can be reversed, without loosing function. The rate of transcription of a particular gene is determined by a complex of transcription (trans-acting) factors binding to short DNA sites (4–12 bases) with a conserved core nucleotide sequence (cis-elements) located in promoter and enhancer\silencer regions. An enhancer\silencer region can encompass one or several cis-elements. The muscle specific enhancer of the creatine kinase gene, active in both skeletal and cardiac muscle, contains several DNA binding core sequences, each interacting with specific transcription factors. Both DNA-protein and protein–protein interaction of various transcription factors, play an important role in transcription regulation.

Processing of the primary transcript is a second regulatory mechanism of gene expression. Splicing of the primary transcript and the formation of mRNA requires the co operation of a set of nucleic acid binding proteins (NABP) in the spliceosomes. The formation of a spliceosome requires RNA-protein interaction, and conserved RNA recognition sites at the intron–exon boundaries. Two groups of protein complexes are involved in spliceosome formation, i.e. the conserved small nuclear ribonucleoprotein and the heterogeneous ribonucleoprotein complexes. Both play a role in the preservation of single stranded RNA and the active process of splicing. The processing of RNA, involves capping of the 5' end, addition of a poly-adenine nucleotide tail at the 3' end and splicing. The final mRNA product is exported from the nucleus and forms the template for ribosomal protein synthesis.

The study of the mechanisms that regulate cardiac specific expression has been difficult due to the lack of stable cell lines expressing differentiated cardiac markers. However the study of the expression of contractile proteins has long been a paradigm in cardiac gene regulation. In the developing embryo several cardiac proteins change from foetal to adult isoforms [7, 8]. The transition from the beating heart tube to the mature cardiac system involves the expression of different myofibrillar, membrane and cytosolic protein isoforms. This developmental switch from foetal to adult is mediated both by differential splicing of single primary transcripts and transcriptional induction of the adult isoforms [9–11].

In the past decade different methods have been developed to study nucleic acid-protein interaction, both in vivo and in vitro. Molecular techniques enable us to study the exact DNA sequence required for transcription factor binding and the importance of single base mutations in a DNA cis-element [12]. Similar experiments can be performed to study RNA-protein interaction in spliceosomes [13]. The NABP are classified according to the protein domain directly interacting with either DNA or RNA. NABP interact either with single stranded (RNA and DNA), or double stranded nucleic acid molecules (DNA), or both [14–17]. In this chapter we will outline different methods that can be used to study nucleic acid-protein interaction and illustrative examples will be provided. As the starting point it is assumed that a genomic clone of interest is available, and that the main aim of the investigator is the characterisation of the regulatory, 5' flanking region of the gene [2]. The methodology that is used to identify new NABP and to unravel mechanisms involved in transcription regulation of the selected gene is discussed. When available, genes active in the cardiovascular system will be used to clarify the various methods.

1.1 Identification of the transcription start site
The transcription start site marks the physical separation between the essential promoter and the transcribed gene. The transcription start site provides the first base of the RNA molecule. Although similar patterns of transcription initiation are found in various genes, there are no rigid biological laws. Many genes have a conserved cis-element, with the consensus sequence TATA(A/T)A(A/T) (TATA-box). This is the binding site for the TATA-box binding protein, part of the transcription initiation protein complex, needed for RNA polymerase II binding. Transcription starts approximately 30 bp downstream (3') of the TATA box [2]. Other genes have a different conserved element surrounding the transcription start site. This element was named Initiator (Inr) and its consensus sequence is CTCANTCT [12]. Inr sequences were initially described in housekeeping genes, but recently it has been shown that highly regulated tissue specific genes also contain Inr sequences in the absence of a TATA box. For example the murine atrial isoform of the regulatory myosin light chain (MLC-2a) gene is completely silenced after partial or complete deletion of the Inr element [18]. The identification of the transcription initiation site of a cloned gene is an important step in the analysis of a new gene. Several methods can be applied to determine the start site.

1.1.1 RNase protection
The complementary RNA strand is synthesised from a genomic DNA containing plasmid and allowed to interact with the mRNAs. The part of the partially hybridised molecule that remains single stranded can be digested by RNase treatment and the size of the protected (double stranded) fragment determined by gel electrophoresis (Fig. 1a). This method can also be applied to determine intron–exon boundaries and to establish the localisation, size, and number of distinctive exons. This method requires the availability of genomic DNA, cloned downstream of a bacteriophage promoter, which involves previous cloning steps. The method has proven to be very sensitive and can detect quantities in the femtogram range. The most frequently encountered problems are related to incomplete probe length and high background following hybridisation. These problems are usually solved by selecting a relatively small probe of about 100 to 300 nucleotides long.


Figure 1
View larger version (43K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1 a: RNase protection and primer extension: Schematic representation of experiments to identify the transcription start site. On the left side (A) the principle of the RNA protection method is shown schematically. For the experiment tissue derived mRNA, and a plasmid containing the genomic clone of interest are needed. From the genomic clone a RNA probe can be synthesised by using RNA polymerase (SP6 or T7), which is homogeneously labelled by adding an isotope labelled nucleotide. The synthesised RNA molecule should be long enough to encompass the expected transcription start sites. Following hybridisation of probe with mRNA, the molecule is digested by RNase, leaving the double strand molecule intact. The size of the protected RNA–RNA hybrid regions, determined by electrophoresis in the presence of a DNA ladder, indicates the size of the mRNA and thus the transcription start site. ProF: protected fragment. The right panel (B) outlines the method of primer extension. An antisense primer is end labelled and hybridised to a specific mRNA molecule and in the presence of Klenow enzyme fragment and nucleotides the gap is filled in the direction of the 5' flanking region. The extension reaction product is run simultaneously with a regular sequencing reaction using the same primer on genomic DNA. In this example transcription starts at a thymidine nucleotide, indicated by black arrow. (*) indicates radioactive label. PExt: primer extension product. b: Example of primer extension method. The transcription start site was identified for the rat phosphoglycerate mutase enzyme. A synthetic oligo corresponding to a sequence from bp 68 to 90 within the rat phosphoglycerate mutase subunit M cDNA was end-labelled with T4 kinase. The primer was annealed to 12 µg of RNA isolated from skeletal muscle. A dideoxy sequencing reaction was performed by using the same oligo primer and the cloned region of the phosphoglycerate mutase subunit M as template and samples were electrophoresed on a 7 M urea-6% polyacrylamide sequencing gel. Numbers of basepairs on the left side of the figure refer to the size of the extended fragments (3' from the primer). (reproduced with permission: Pilar Ruiz-Lozano. Gene 1994;147:243-248).

 
1.1.2 Primer extension
This method is based on hybridisation of a DNA oligonucleotide to the mRNA and subsequent filling of the proximal mRNA tail (5'). The oligonucleotide used is designed in the antisense orientation and specifically recognises the mRNA of interest. The oligonucleotide is end labelled and used as a primer to synthesise a complementary DNA strand by adding the enzyme reverse transcriptase, a RNA-dependent DNA polymerase. The size of the extended fragment can be analysed by running the primer extension reaction product in parallel to a sequencing reaction of the genomic clone. The base that matches the primer extended product indicates the start site (a thymidine residue in Fig. 1b). In some genes several extended bands can be detected, indicating the presence of various transcription start sites and variation in the mRNA length. For instance primer extension studies of the Shaker-like potassium channel gene (Kv1.5) revealed three products, differing 118 and 164 bp in size [7].

Similar to the RNase protection method, primer extension can be used to determine intron–exon boundaries. Both methods can be used to quantitate mRNA levels in a specific cell, tissue or condition. Primer extension does not require the cloning of a genomic DNA fragment. The reverse transcription reaction can be stopped by GC-rich sequences and through secondary RNA structures. This method has been modified and optimised and is now available in a specially designed kit. This 5' rapid amplification of cDNA ends kit requires, in addition to primer extension, the modification of the extended product by a poly-C tail, recognised by a special anchor primer. The first strand reverse transcriptase product can be amplified by polymerase chain reaction (PCR) and the product can be cloned and sequenced or sequenced directly (Fig. 2).


Figure 2
View larger version (62K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2 RACE rt-PCR: Picture of a sequencing reaction of polymerase chain reaction product generated by the rapid amplification of cDNA ends method (5' RACE, Gibco BRL, Gaithersburg MD). This method to identify the transcription start site was used on a genomic murine atrial myosin light chain 2 clone. The method briefly: for first strand cDNA synthesis a gene specific primer is used approximately 300 bp from the cDNA end (ATGAGAAGCTGCTTGAACTC). An anchor sequence is then added to the 3' end of the first strand DNA (complementary to the 5' end of the mRNA) using homopolymeric tailing with dC. The dC tail is recognised by a specially designed anchor primer and this primer is used in a PCR employing a second gene specific (nested) antisense primer (GAATAGGTCTCCTTCAGGTC) and the Taq DNA polymerase. The PCR product was cloned into the TA cloning vector (Stratagene, San Diego, CA), and sequenced according to the method of Sanger [92]. The picture shows the first bases of the cDNA corresponding to the 5' end of the mRNA (TCTGCAC) preceded by the poly C anchor.

 
If the cDNA clone is available and the sequence of the exons is known, it can be used to design oligonucleotides for PCR and Southern blotting. Both techniques can be used to estimate the localisation and size of introns. For an exact determination of the intron–exon boundaries double strand (both DNA strands) sequencing is required. Introns have conserved 5' (GU) and 3' (AG) sequences and often a pyrimidine (CU) rich region close to the 3' end [13], however the limited length of the consensus sequences does not unambiguously indicate the presence of introns. Up to now sequence comparison between genomic DNA and cDNA, is the only tool to solve this issue.

1.2 Identification of cis-acting-elements
1.2.1 Sequence comparison
After determination of the transcription start site, the putative regulatory region can be sequenced using both DNA strands. Sequence comparison of selected genes from one or different species usually reveals large variations in the regulatory 5' flanking region, whereas the coding region is often highly conserved. However in the 5' flanking sequence some short DNA sequences appear to be conserved regarding both orientation and position relative to the transcription start site. Evolutionary conservation of such DNA sequences points to their functional importance. This type of analysis has frequently been used to identify DNA regions of potential importance in transcriptional regulation. The conserved sequences often correspond to consensus binding sites for transcription factors or other regulatory proteins. This method of sequence comparison (Table 1) was used successfully to identify important sites in the ventricular myosin light chain 2 promoter (MLC-2v) [19, 20]. The sequence of chick MLC-2v was compared to the sequence of the rat clone and conserved sites were recognised and named HF1, HF2 and HF3. These DNA elements were further explored and appeared to be important for ventricular cardiac myocyte specific expression. The regulatory sequences of different genes within one species can also be used for sequence comparison to identify potentially interesting cis-elements. Comparison of rat Kv1.5 regulatory sequence with the somatostatin regulatory DNA revealed the presence of a consensus cAMP responsive element (CRE, sequence: TGACGTCA) [21]. If no related sequences are available for comparison, specialised computer software has been developed to scan a sequence for conserved cis-elements i.e. Sigscan (MBCC, St Paul MN, available via internet).


View this table:
[in this window]
[in a new window]

  		Table 1 Strategies to study cis-acting nucleic acid elements and trans-acting nucleic acid binding proteins

 
1.2.2 Transient transfections assays
The functional relevance of a regulatory DNA sequence can be determined by using reporter genes in transfections of mammalian cells (Table 1). The common feature of reporter genes is the availability of a reliable and sensitive method to measure the protein product of the gene. By subcloning (parts of) a promoter sequence upstream of the reporter gene, the expression of the reporter gene will be under control of this promoter fragment and, hence, provide a measure of the activity of the promoter fragment. Reporter genes commonly used are chloramphenicol acetyl transferase (CAT) [22] and luciferase [19, 23] which can be assayed quantitatively. The β-galactosidase reporter gene can be used for both qualitative and quantitative assays [19, 24]. The level of expression can be compared to well characterised viral promoters from the human cytomegalovirus (CMV) and the Rous–Sarcoma virus (RSV), and thus provide a relative measure. Not seldomly transfections of cultured cells show considerable variability in consecutive experiments. Therefore it is common use to co-transfect cells with a luciferase vector, containing the promoter fragment of interest, together with a β-galactosidase vector driven by the CMV promoter, that can be used to correct for differences in transfection efficiency [25]. The green fluorescent protein originally detected in jellyfish, Aequorea victoria, can be used as an in vivo reporter gene in mammalian cells [26–28]. This reporter gene can be used to identify living transfected cells, and the tools for quantification of the level of expression in vital cells are being developed. Mutations in the green fluorescent protein have been made and appeared to generate a stronger fluorescent signal [26, 28]. In addition through further manipulation of the gene, other colour producing fluorescent proteins have been developed [29]. These reporter genes are commercially available in plasmids with convenient multiple cloning sites 5' of the reporter cDNA.

After subcloning the regulatory sequence upstream of the reporter gene, large quantities of recombinant plasmid DNA can be harvested from bacterial cultures. The plasmid DNA is then purified and transfected into the desired cell type. This approach has also been used to study regulatory sequences of ion channel genes. Constructs of the Kv1.5 regulatory DNA driving the CAT reporter gene, were used to study the change in transcription level after cAMP treatment in the presence of a conserved CRE and mutated CRE site in skeletal myocytes [7]. Functionally important cis-elements can be identified by studying deletion fragments of the regulatory sequence. For these experiments the deletion fragments are cloned upstream of a reporter gene and variations in the level of reporter gene activity are measured and indicative for either repressive or stimulating cis-elements in the deleted fragments. In general as the deleted fragments are large (several hundred bp in length) this method is used primarily to define DNA regions containing potentially interesting regulatory sites [30]. The choice of reporter gene and cell type will depend on the gene under investigation. Neonatal rat cardiomyocytes have been used extensively as a model system to study transcription regulation in the cardiac context. Isolated cardiomyocytes can be transiently transfected by direct intracellular DNA injection or by using either calcium phosphate precipitation, liposomes, electroporation or adenovirus mediated transfection [31, 32]. The transfection method will have to be adjusted to the strength of the regulatory sequence in inducing reporter gene expression. The calcium phosphate precipitation method is relatively easy, but the efficiency of transfection is low (<5%). Up to 40% transfection efficiency has been shown for cardiac fibroblasts and smooth muscle cells using liposomes. Electroporation is an often used efficient method of DNA transfer, however it requires high cell numbers which are often not available for cardiomyocyte studies. In contrast by using replication deficient adenovirus near 100% transfection can be obtained, but the generation of adenoviral constructs is time consuming and viral DNA may influence reporter gene expression levels. A distinct advantage of adenovirus as a vehicle to introduce foreign DNA is that it also allows transfection of adult myocytes isolated and in tissue [33]. The application of adenovirus in tissues adds an additional level of complexity, but the results may be more physiological [34]. To identify cell type specific promoter fragments, plasmid DNA can be injected into various tissues, a procedure that usually requires surgery [35].

1.2.3 In vitro spliceosome assays
The formation of mRNA, capable of crossing the nuclear membrane, is dependent on the correct function of RNA-protein complexes. Proteins recognise the boundaries between introns and exons (localisation of splice sites), cut the precursor RNA molecule, and paste the individual exons in a fixed order (splicing). The function of the introns remains obscure for most genes. In some cases the introns were shown to contain tissue specific enhancers [5]. Whether this enhancer function is mediated by DNA-protein interaction prior to, or by RNA-protein interactions following transcription is unclear. A defect in the splicing process forms the molecular bases for the expression of a defective Ca2+ channel β-subunit, resulting in ataxia and seizures in the lethargic mice [36]. During the aberrant splicing events exon III of the β-subunit is lost, and not included in the final mRNA. The resulting mutated splice variant has a frame shift, which leads in this particular example to stop codon formation and results in a truncated protein. In the human ether a-go-go related gene (hERG), a similar splice donor mutation (G to C mutation at the splice site of intron III) [37] leads to protein changes in the hERG ion channel and modification of the IKr current that can cause the long QT syndrome.

By mixing precursor RNA with nuclear extracts or with purified protein mixtures containing the spliceosome forming proteins the formation of mRNA can be assessed by studying the length and structure of the various RNA molecules, using primer extension (Fig. 1a, b). Through this method the functional significance of mutations surrounding the splice sites can be determined. This method has been used extensively to show the role of competing splice factors in gender determination in Drosophila [38]. A similar approach was used by Mullen et al. [13] to study the mechanism of exon selection of the {alpha}-Tropomyosin gene. The mRNA formed in smooth muscle cells includes exon 2 and skips exon 3, where other cell types skip exon 2 and paste exon 1 to 3. These investigators showed that these splicing events can be reproduced in vitro, by using Hela cell nuclear extracts. In this study an important role for the polypyrimidine tract adjacent to the splice sites in exon selection was found.

1.3 Characterisation of cis-elements
For the characterisation of cis-elements various methods can be applied, some of which are complementary. The first approach is using nucleic acid-protein binding assays to determine the exact DNA sequence that forms a nucleo–protein complex, and the strength of the interaction in vitro. DNA footprinting, gel mobility shift assay and methylation interference can be applied to address these questions. The effect of mutations in a conserved element can be compared with the normal (wildtype) sequence in transient transfections (in vitro) and through the generation of transgenic mouse lines (in vivo, Table 1).

1.3.1 DNA footprinting
Schmitz et al. [39] described a technique to show which bases were protected of endonuclease enzyme DNase I digestion. Nuclear extract of interest is incubated with a regulatory DNA fragment, labelled at one end, in a binding reaction buffer. DNA stretches that are coupled to proteins will be non-accessible to DNase I and therefore, will be protected. Simultaneously labelled DNA free of protein is digested as a control. The unbound free DNA will yield a characteristic pattern of bands on electrophoresis on a standard sequencing gels. The NABP generate a so-called footprint when the DNase I digested DNA bands are analysed, as the bands resulting from free DNA digestion will be missing at those DNA sequences, that were protected from DNase I digestion through their occupancy by proteins (Fig. 3a, b). By DNase I footprinting DNA fragments up to 250 bp can be studied. The general region of DNA to which a protein binds is revealed by footprinting. The method is rapid and sensitive and it is not limited to the number of sites or to the number of proteins interacting to the DNA sequence of interest. In general, several experiments are required to find the correct conditions and time frame to obtain an interpretable result. This technique does not distinguish different protein complexes that bind to the same DNA region. In addition, proteins with rapid dissociation kinetics may not remain bound long enough to protect the probe from digestion. For some NABP, DNase I footprinting can be optimised as a method for protein purification.


Figure 3
View larger version (47K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3 a: DNase I footprinting: Scheme showing the basics of DNA footprinting. The transparent oval indicates a nucleic acid binding protein interacting with the region TCACGTCA (cis element). One DNA strand is end labelled with T4 polynucleotide kinase and {gamma}32P-ATP, and the DNA-protein complex is subjected to brief DNase I digestion. The resulting fragments are analysed by gel electrophoresis. The control experiment is performed in the absence of nuclear extract. b: In vivo footprinting: Identification of DNA-protein interaction by guanine or adenine in vivo footprinting method based on methylation interference. The genomic DNA is subjected to methylation with dimethyl sulfate in vivo. The DNA is then treated with piperidine cleaving DNA directly after a methylated (guanine or adenine) site. In this experiment the DNA fragments were amplified and labelled using PCR. If the protein binding in vivo prevented DNA methylation, bands are missing in the in vivo methylated DNA compared to the free probe after size fractionation on a denaturing gel (method from Strauss et al. [96]). Positions of nucleotides, which are methylation protected following binding to the nuclear factors ({circ}) and hypersensitive site (bullet). Lanes: N, in vitro-methylated protein-free cardiac myocyte DNA; C, in vivo-methylated cardiac myocyte DNA. (reproduced from Navankasattusas et al., Mol Cell Biol, 1994: 14: 7336, with permission).

 
1.3.2 Gel mobility shift assay
The DNA nucleotides involved in protein interaction and the strength of binding can be determined by the gel mobility shift assay (GMSA), also referred to as electrophoretic mobility shift assay. This technique is based on electrophoresis, where a free unbound labelled DNA probe will move through a gel faster compared to a protein bound DNA molecule. The delay in electrophoretic mobility helps to identify the presence of factors binding to the DNA site of interest. The source of proteins can be either a crude total cell extract, an isolated nuclear extract, a mammalian protein produced by bacteria, or a protein produced through in vitro transcription and translation. To reduce the background in the DNA-protein interaction, unlabeled non-specific competitor is often added (Fig. 4a, b). The DNA-protein interactions are dependent on the quality of the protein extract. As the proteins are sensitive to heat, oxidation, degradation and mechanical shearing, extensive precautions should be taken to preserve protein function. Furthermore the interaction can require specific salt concentrations and co-factors of the binding buffer [40]. To further demonstrate specificity of the interaction, unlabeled DNA identical to the probe can be added. Increasing concentration of the competitor will show a gradual decrease in the binding to the labelled probe. Conversely the presence of increasing concentrations of random DNA fragments, should not influence the binding of the probe. In addition, the influence of mutations in the DNA site can be assessed again by establishing binding affinity and by showing the effects on specific competition (Fig. 4a, b). If antibodies are available against a NABP, they can be used to show an additional slowing of mobility as the labelled DNA-protein complex is becoming larger after binding of the antibodies. This phenomena is referred to as a supershift [41]. From the GMSA information can be derived regarding the size of the factor, its tissue distribution, binding affinity and structural requirements. A positive supershift may provide conclusive information as to the identity of the binding protein (Fig. 4a, b).


Figure 4
View larger version (45K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 4 a: Gel mobility shift assay: Scheme to illustrate the method for gel mobility shift assays. In the first lane the labelled unbound probe is visualised. The second lane shows the shift in mobility of the probe after incubation with nuclear extract. By adding increasing amounts of unlabeled DNA identical to the probe, competition results in diminished intensity of the shifted band (lane 3, 4). No competition is seen in lane 5 where non-related or mutated DNA was added. In the last lane specific antibodies are added to the DNA-protein incubation reaction. The antibody recognises and binds the transcription factor, which is still able to interact with the DNA probe. The resulting DNA-protein complex is larger and therefore electrophoretic mobility of the complex is further retarded. b: Gel mobility shift assay: Gel mobility shift comparing various cis elements (MLE-1, HF1A and PRE B) and protein binding in ventricular cardiomyocyte nuclear extract. The normal band indicating protein-DNA interaction is the lower band. In the presence of the serum containing USF-2 antibodies (USF-2-ab) the band is supershifted (more retarded). In this experiment binding characteristics of USF to different E-box containing sites (MLE-1, HF1A, PRE-B) was studied. Please note that the in vitro transcribed USF protein although capable of DNA binding is not recognised by the rabbit serum. (reproduced from Navankasattusas et al., Mol Cell Biol, 1994: 14: 7336, with permission).

 
1.3.3 Methylation interference
For additional fine mapping of the DNA protein interactions diethyl pyrocarbonate (DEPC) interference (methylation interference) can be used to identify exactly the adenosine and guanine nucleotides involved in protein binding. This chemical variant of DNase I footprinting is based on the DEPC reaction with purines bound to protein generating an alkali-labile abasic site. For this assay DNA is end-labelled, and incubated with either a nuclear extract or purified protein. The DNA-protein complex is treated with DEPC and thereafter the DNA is cut by piperidine at the modified purine nucleotides. The nucleotides bound to protein are recognised by a strong signal after autoradiography of the gel. A sequencing reaction of the same DNA molecule serves as a size marker of this reaction [42]. Fig. 5 shows a picture of such an experiment depicting the protected bases of the HF3 silencing element of the MLC-2v promoter [43].


Figure 5
View larger version (57K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 5 DEPC interference: A NABP was identified (by Southwestern screening), using a conserved HF3 cis element as a probe and referred to as cardiac negative regulator (CNR). For this experiment an oligonucleotide containing the HF3 element was end-labelled, either the sense or the antisense strand, and partially modified by DEPC treatment. The DNA-protein complexes formed between the HF3 element and the bacterially expressed GST-CNR fusion protein were resolved and isolated from a preparative 5% acrylamide non-denaturing gel by electro-elution. After removal of the protein by phenol:chloroform extraction, the DNA samples were cleaved with piperidine and resolved on 8 M urea 12% acrylamide gels. A+G DNA sequencing reactions were carried out with the HF3 probe, and the resulting ladder (lane A+G) was used as the molecular size standard. The diagram at the bottom shows the specific locations of contact points for the bacterially expressed GST-CNR fusion protein in the HF3 site.

 
In the DNA-protein binding assays presented so far the DNA and protein are allowed to interact in vitro conditions. The binding of protein to DNA can depend on conditions like temperature, pH and salt concentrations. These circumstances are potentially different for each DNA-protein interaction. To identify DNA-protein interactions in vivo, the method of methylation interference was modified in order to conserve and recognise the DNA-protein complexes formed in living cells (in vivo footprinting). Genomic DNA in cultured cells can be treated by dimethylsulfate, isolated and again the cleavage sites of the methylated DNA can be assessed. For instance a conserved cis-element (E-box referred to as MLE) on the MLC-2v promoter was studied this way to determine exactly which bases are crucial for the actual DNA-protein interaction. The protein binding to this specific site was later identified as the upstream stimulating factor (USF) [41]. The USF is a member of the helix–loop–helix family of transcription factors. USF was initially identified as a regulator of the tumour suppressor gene p53 promoter [44]. Further analysis demonstrated that USF can also be involved in the regulation of expression markers of differentiated muscular cells [41].

1.3.4 In vitro RNA assays
Tools to study splice events in vitro are available as well. As mentioned already the function of spliceosomes can be determined by primer extension. In addition the RNA-protein interaction can be determined in gel mobility shift assays as described for DNA. The affinity of the interaction between protein and RNA can be determined by cross-linking protein to labelled RNA prior to gel electrophoresis in the presence or absence of competing unlabeled RNA [38, 45]. The influence of nucleic acid sequence, as well as the importance of various protein fractions for RNA-protein interaction can be studied [46].

1.3.5 Mutation analysis
In addition to the in vitro and in vivo binding studies, functional studies will help to determine the importance of individual cis-elements. To analyse one specific cis-element constructs with the normal sequence can be compared to constructs with mutated cis-element. The inserted mutations vary from one single base, to a complete replacement or deletion of the cis-element. Oligonucleotides synthesis is used to produce normal and mutated cis-element containing DNA fragments. These oligonucleotides can be used for GMSA, to study protein-DNA binding, or can be used to generate new constructs harbouring mutations by PCR. A regular PCR procedure can be used to mutate the ends of DNA fragment. By site-directed mutagenesis any position can be altered. For site-directed mutagenesis two PCR fragments are generated with identical mutations and overlapping sequences. The PCR products are mixed, denatured and allowed to reanneal. The overlapping segments of the complementary strands will anneal. The open single strand ends can be filled, and the newly formed DNA template harbouring a mutation can be amplified [47]. After cloning the final PCR product in a reporter vector, the effect of the mutation on the level of transcription can be determined through transient transfections using both the normal and mutated sequence. This approach was followed, to study the importance of the HF sites of the rat MLC-2v regulatory sequence [20] and the CRE site on the Kv1.5 regulatory sequence [46].

1.3.6 Transgenic assays
Data derived from transient transfections form the bases for the construction of transgenic mice to further establish the role of identified DNA-sites in the intact organism [4, 20, 48, 49]. To this end linearised DNA (the promoter–reporter fragment) is injected directly into the pronucleus of a fertilised oocyte. The oocyte can be implanted into the uterus of a pseudo pregnant mouse. If the injected construct is integrated in the genome of the offspring, transgenic lines have been generated. The transgenic experiments outlined here focus on the importance of the modification of cis-elements in the regulatory sequence of the target gene (Table 1). As a reporter gene is part of the transgenic construct, the expression pattern can either be determined histochemically (β-galactosidase: X-gal staining) [24] or by measuring reporter activity biochemically (luciferase: light emission) [20]. The transgenics will provide information on tissue specificity of the expression pattern as well as the developmental time frame of transgene expression. Furthermore the effect of pathologic conditions on transgene expression levels can be studied as well. Most often the mouse is used for transgenesis as this model is fast in reproduction, relatively cheap and easy to handle. Surgical techniques can be applied to mimic cardiac disease like for instance aortic banding to induce cardiac hypertrophy [49]. The limitations of the transgenic technique are due to variable transgene copy number and genomic insertion site. Therefore it is essential to study more than one transgenic mouse line harbouring the same construct, to check for a reproducible phenotype.

1.4 Cloning of nucleic acid binding factors
Transcription factors are classified either by their trans-acting, protein–protein binding or DNA binding domain. The importance of structural motifs has been shown in helix–loop–helix proteins, leucine zipper, helix–turn–helix (homeodomain) and zinc fingers. These domains are conserved throughout evolution [50, 51]. Several different approaches can be taken to identify novel transcription factors.

1.4.1 Degenerate primer PCR
The first strategy is based on knowledge of the DNA sequence of previously cloned NABP. By applying the polymerase chain reaction (PCR) [1] using degenerate primers with homology to NABP coding sequences, new proteins with a conserved domain, similar to the known factor can be identified. Degenerate primers are constructed by making limited changes in the described DNA sequence. These primers will anneal to DNA with sequence homology in a PCR reaction, when the annealing temperature chosen is lower then the melting temperature. The amplified fragment can be subcloned, sequenced and used as a probe to screen a copy DNA (cDNA) library [52]. With the degenerate primer method different proteins, with a conserved protein domain have been cloned. For example using the homeobox domain cardiac specific homeobox genes were identified in Xenopus [53]. Similarly by using a zinc-finger domain from the GATA transcription factor family, the chick GATA 6 was cloned [54]. These transcription factors play an important role in contractile protein expression during cardiogenesis. Degenerate primer PCR can also be used to look for cell type or species specific transcription factors. A related method uses low stringency DNA hybridisation to identify related nucleotide sequences. This approach has been used by several groups to search for cardiac dominant factors, with homology to the family of myogenic genes. The myogenic transcription factors were first identified in skeletal muscle cells. These factors are considered dominant as they are capable to activate the skeletal gene program in non-muscle cells [55, 56]. The introduction of these myogenic factors in cardiac fibroblasts results in skeletal myocyte formation [57, 58]. Cardiac NABP with homology to the myogenic factors have been found, and are probably involved in early growth and looping of the heart [59]. However there is no proof yet for a dominant role of these factors in cardiomyocyte differentiation comparable to the skeletal muscle cell [60]. In contrast the myogenic factors in cardiomyocytes appear to be recessive [35].

1.4.2 Affinity chromatography
This approach exploits the DNA-binding capacity of these proteins to purify the protein or its DNA-binding domain. To purify NABP a method was developed using DNA affinity chromatography. A single or concatenated consensus DNA sequence can be chemically linked to an activated sepharose support column. Nuclear extract harvested from selected tissue or a particular cell line can be applied to the column and the purified proteins can be washed from the sepharose by increasing the salt concentration [61]. The amino acid sequence of part of the purified protein can be determined and used to predict the corresponding DNA sequences. Taking into account the degeneracy of the genetic code a degenerate oligonucleotide can be synthesised for the screening of a cDNA library or for use as a primer for PCR [62].

1.4.3 Southwestern screening
An alternative method implementing nucleic acid-protein interaction can be used to screen a cDNA expression library for nucleic acid binding domains. To perform this experiment, an expression library may be constructed in which cDNA is inserted into the coding region of the bacteriophage lambda β-galactosidase gene. The phage library can infect a bacterial culture and clones where the DNA binding domain of interest is correctly translated will bind to a labelled nucleic acid probe. For this purpose a concatenated DNA molecule containing a repeat of the DNA-site involved in the DNA-protein interaction, is synthesised. This method is referred to as Southwestern screening, as it involves the interaction between filter-based protein with DNA in the solution [63]. This method has been applied to identify transcription factors interacting with the regulatory sequence the MLC-2v gene like HF3 and HF1B binding proteins [43, 64]. Southwestern screening is not easy to perform as several rounds of screening maybe necessary to find the optimal temperature, pH and salt conditions, to reduce the background and to optimize the DNA protein interaction.

A modification of the Southwestern screening technique involves the use of the purified protein from the DNA-affinity chromatography to generate specific antibodies. Binding of these antibodies to clones of a cDNA expression library can be used to identify bacteriophage clones encoding specific nucleic acid binding domains [42, 65].

1.5 Characterisation of nucleic acid binding proteins
The cloning of a NABP is one step, the characterisation and determination of function will be the next. In general this is the real challenge as function of the NABP is the key issue. The method used to clone the gene may provide some clues as to the anticipated function.

1.5.1 Sequence comparison
Many of the transcription factors identified using the methods described above will be known, or contain domains with high homology to related factors of the same family [66]. This homology can be found in either the DNA-binding, protein–protein interaction or the trans-activation domain. The trans-activation domain of a NABP indicates the domain responsible for the modification of the level of transcription. In addition to sequence comparison, the in vitro DNA-protein binding assays like GMSA, will demonstrate the actual DNA binding capacity of the new clone. For these experiments the protein can be produced by in vitro transcription translation using a reticulocyte lysate, or by a bacterial expression system. For various reasons it may be worthwhile to generate a bacterial fusion protein. The NABP can be linked for instance to the glutathione S-transferase protein or a poly histidine tag [67, 68]. The peptide fused to the NABP allows purification of the bacterial protein. The bacterial fusion protein is useful for GMSA and for the generation of polyclonal antibodies. The antibodies will help to characterise the NABP, as antibody with nuclear extract incubation will give rise to a supershift band in GMSA. Furthermore the antibodies can be used for immunohistochemistry or immunoprecipitation [69].

Although the knowledge about the regulation of transcription and splicing is accumulating fast, the mechanisms of tissue specific gene expression and cell type specific splicing are still unknown. An intriguing example is the myocyte enhancer factor 2 (MEF2) gene. This NABP plays an important role in skeletal and cardiac muscle specific gene expression. The four genes of MEF2 are expressed in many tissues, however the protein is found predominantly in brain and muscle. The four different genes have numerous splice variants some of which are cell type specific. It is likely that the balance in protein formation of the various splice variants is important for the differentiation pathway of myocytes [70, 71].

Up to now most of the knowledge on transcription regulation is obtained from studies involving contractile protein genes. The ongoing integration of cellular electrophysiology with molecular biology will result in ion channel promoter analysis in the years to come. Comparing the sequence of newly identified NABP can help to identify the protein domain responsible for protein–protein interaction, in addition to the domain involved in nucleic acid binding. The information on the structure of the NABP can be helpful to assess the nucleic acid binding mechanism. For instance a group of NABP, including HF1B, use zinc ion containing domains for the DNA interaction (zinc finger motif) [64]. Another group of NABP, the RNA binding proteins often contain a conserved domain: the RNA recognition motif [72].

1.5.2 Protein structure analysis
Additional structural information can be obtained from crystallised protein analysis and nuclear magnetic resonance spectroscopy. Crystallised protein analysis will further support the characterisation of a new NABP and can be helpful in understanding the mechanism of transcription regulation. Advanced computer models allow the reconstruction, using data form structural studies, of three dimensional models indicating the folding and tertiary structure of protein and DNA [73, 74].

1.5.3 Expression pattern
In addition to structural analysis, the expression pattern of the gene can be determined. The expression level in various tissues can be shown by Northern blotting in a semi quantitative manner. The result will permit the identification of tissues with high versus low expression levels. Furthermore by comparing one tissue at different developmental stages, it is possible to judge the onset of expression of a specific NABP for instance in the heart. The analysis of gene expression is a valuable tool to inventorise the potential biological roles of the gene. To acquire information, about which cells contribute to the expression of the gene the mRNA localisation within the tissue can be studied by in situ hybridisation or in situ PCR. These methods will show on the cellular level where the gene is expressed (for instance left versus right ventricle) and again by comparing different developmental stages a time course of expression can be determined [72]. These methods to characterise the NABP were applied to study the dynamic expression pattern of the splice factor mSAP49. This protein is expressed at a high level in the heart during a short episode in embryonic development. Its maximal expression coincides with a change in expression of contractile protein isoforms [8, 72, 75, 76].

1.6 Functional assays of nucleic acid binding protein
The structural analysis of the NABP can already provide important clues as to the mechanism of DNA-protein binding. Some proteins bind DNA as monomers, for instance homeodomain containing NABP, whereas others require the binding of a protein partner. For instance the leucine zipper domain is responsible for protein–protein interaction, and transcription factors containing such a domain can only bind to DNA as homo- or heterodimers. Dimerisation to activate DNA binding is also reported for NABP belonging to nuclear receptor superfamily. These NABPs bind either as monomer, homodimer or heterodimer [51, 77–79]. The fine tuning of transcription often requires post translational modifications of NABP by conformational changes induced either through phosphorylation, or the selective binding of diverse cofactors, like for instance thyroid hormone or retinoic acid [79–81]. These modifications can be overlooked during the structural analysis. Therefore the role of the various NABP will have to come from functional studies both in vitro and in vivo.

1.6.1 Functional assays
For the in vitro analysis again transient transfection assays can be used. This requires one construct carrying the regulatory element linked to a reporter gene and a second construct containing the NABP cDNA driven by a strong viral promoter, like the RSV or CMV promoter. Through co-transfection of both constructs the effect of transient NABP overexpression on the target regulatory DNA can be determined. As a control experiment a known NABP with stimulating effects on the regulatory DNA is used, and as a negative control the new NABP cDNA is omitted. An example of this approach is the study on the effect of MEF-2 overexpression on the activity of a homeobox gene promoter (GAX) [82]. To study the role of p21 overexpression on an E2F sites containing promoter–reporter gene construct similar experiments were performed. p21 is believed to be a mediator of p53, a tumour suppressor gene. E2F-1 plays an important role in tumour growth and neointima formation after arterial injury [83]. The outcome of these studies suggest interference of p21 with E2F-1 binding to the DNA element.

1.6.2 Gene targeting
To assess the physiological role of a NABP in vivo, the preferred technology would use transgenic or gene targeting strategies to study the effect of over expression (transgenic), diminished expression (heterozygous knock out: ±) or no expression (homozygous knock out: –/–) on development and organ (tissue) function (Table 1). For these experiments the focus is on the coding region of the NABP, in contrast to the previous application of transgenic technology to study the regulatory DNA sequences. For overexpression studies, a transgene has to be constructed encompassing a selected promoter, which can be either ubiquitously active (viral promoter: RSV, CMV) or tissue specific (flk-1, {alpha}MHC, MLC-2v promoter [84–86]). To reduce the level of the NABP, the gene can be destroyed by homologous recombination leading to a reduction of the expression level. By back crossing a heterozygous knock out line (–/+), homozygous or double knock-out (–/–) spring off can be generated. Embryonic lethality can present an important drawback of the knock-out approach. Lethality, however, indicates an important role for NABP destroyed through gene targeting. In some experiments the embryonic phenotype can still be evaluated either through in situ hybridisation and immunohistochemistry and in rare cases even by functional assays [87]. A variation on these techniques has been developed where the transcribed part of one gene is replaced by another functional gene. In this experiment one copy of gene A is removed and replaced through homologous recombination by gene B. Through this cloning strategy the additional copy of B is placed under the regulatory control of gene A. This knock in strategy was successfully applied by London et al. [88], to replace one of the two alleles of the potassium channel Kv1.5 with Kv1.1.

Recent developments in gene targeting technology make ventricular specific knock out of NABP feasible, albeit complex. In order to achieve tissue specific underexpression the target gene named X, has to be isolated and subcloned. In the next step part of the gene for instance exon 2, is placed between two loxP sites. After manipulation of exon 2 the gene X is re-introduced into the mouse genome through homologous recombination in embryonic stem cells. These loxP sites are restriction sites recognised by the enzyme Cre recombinase, and whenever Cre is present it will cut 5' and 3' of exon 2 and ligate the ends of the gene together thereby removing exon 2 on one allele. This will result in the absence of levels of the active X protein. In the absence of Cre however the transcript of X is normal and the protein level will be normal. Simultaneously a transgenic mouse line is generated expressing the Cre recombinase gene in a tissue specific manner, for instance limited to ventricular myocytes [89]. Crossing of the mouse lines will result in reduced levels of protein X, after the tissue specific promoter ({alpha}-MHC) driving Cre expression has been activated [90]. The knowledge of NABP and their nucleic acid interactions has triggered the development of new therapeutic strategies, like for example the transfection of myogenic factors (like MyoD) into cardiac fibroblasts. Although no improvement of cardiac function has been shown yet, the induction of myocyte formation was successful [58]. Another strategy used the nucleic acid element as a decoy to bind functional transcription factors. A repetitive DNA element was made encompassing several binding sites for the E2F protein. The constructed DNA competed with endogenous cis-elements for NABP binding and was shown to prevent neointima formation after arterial injury in rat [91].


   2 Conclusions
Top
 Abstract
 1 Introduction
 2 Conclusions
References
 
In this paper an outline is given of the most current strategies to study transcription regulation and the proteins that are involved in this complex process. Each gene, including NABP coding genes themselves, are dependent on transcription activation by binding of NABP to its regulatory DNA. Modern molecular technology permits detailed analysis of DNA-protein interaction. The role of individual bases can be determined together with the essential characteristics of protein domains. Several DNA elements important for cardiac specific gene expression have been identified. Using these cis-elements, a number of NABP expressed exclusively in the heart, have been isolated and characterised. Through the development of murine gene targeting techniques and by miniaturising technology, functional studies of NABP genes are feasible. The quest for early tissue specific NABP and dominant cardiac transcription factors will continue. The elucidation of RNA-protein interaction and the mechanism of splicing events is a matter of intensive ongoing research. The ultimate goal of these studies is to understand the mechanism of control of protein production in mammalian cells for research and possibly for therapeutic applications in the near future.

Time for primary review 21 days.


   References
Top
 Abstract
 1 Introduction
 2 Conclusions
 References
 

  1. Swynghedauw B, Barrieux A. An introduction to the jargon of molecular biology: Part I. Cardiovasc Res (1993) 27:1414–1420.[Free Full Text]
  2. Swynghedauw B, Moalic JM, Bourgeois F, Barrieux A. An introduction to the jargon of molecular biology. Part II. Cardiovasc Res (1993) 27:1566–1575.[Free Full Text]
  3. van Bilsen M, Chien KR. Growth and hypertrophy of the heart: towards an understanding of cardiac specific and inducible gene expression. Cardiovasc Res (1993) 27:1140–1149.[Web of Science][Medline]
  4. Robbins J. Regulation of cardiac gene expression during development. Cardiovasc Res 1996; 31 Spec No:E2-16.
  5. Vincent CK, Gualberto A, Patel CV, Walsh K. Different regulatory sequences control creatine kinase-M gene expression in directly injected skeletal and cardiac muscle. Mol Cell Biol (1993) 13:1264–1272.[Abstract/Free Full Text]
  6. Kelly R, Alono S, Tajbakhsh S, Cossu G, Buckingham M. Myosin light chain 3F regulatory sequences confer regionalized cardiac and skeletal muscle specific expression in transgenic mice. J Cell Biol (1995) 129:383–396.[Abstract/Free Full Text]
  7. Mori Y, Matsubara H, Folco E, Siegel A, Koren G. The transcription of a mammalian voltage-gated potassium channel is regulated by cAMP in a cell-specific manner. J Biol Chem (1993) 268:26482–26493.[Abstract/Free Full Text]
  8. Lyons GE, Muhlebach S, Moser A, et al. Developmental regulation of creatine kinase gene expression by myogenic factors in mouse and chick embryos. Development (1991) 113:1017–1029.[Abstract]
  9. Cooper TA, Ordahl CP. A single cardiac Troponin T gene generates embryonic and adult isoforms via developmentally regulated alternative splicing. J Biol Chem 1985; 11140-11148.
  10. Jin JP, Lin JJC. Isolation and characterization of cDNA clones encoding embryonic and adult isoforms of rat cardiac Troponin T. J Biol Chem (1989) 264:14471–14477.[Abstract/Free Full Text]
  11. Nakamura K, Iijima T. Postnatal changes in mRNA expression of the K+ channel in rat cardiac ventricles. Jpn J Pharmacol (1994) 66:489–492.[Medline]
  12. Smale ST, Schmidt MC, Berk AJ, Baltimore D. Transcriptional activation by Sp1 as directed through TATA or initiator: specific requirement for mammalian transcription factor IID. Proc Natl Acad Sci USA (1990) 87:4509–4513.[Abstract/Free Full Text]
  13. Mullen MP, Smith WJ, Patton JG, Nadal-Ginard B. a-Tropomyosin mutually exclusive exon selection: competition between branchpoint/polypyrimidine tracts determines the default exon choice. Genes Dev (1991) 5:642–655.[Abstract/Free Full Text]
  14. DeAngelo DJ, DeFalco J, Rybacki L, Childs G. The embryonic enhancer-binding protein SSAP contains a novel DNA-binding domain which has homology to several RNA-binding proteins. Mol Cell Biol (1995) 15:1254–1264.[Abstract]
  15. Kamada S, Miwa T. A protein binding to CArG box motifs and to single-stranded DNA functions as a transcriptional repressor. Gene (1992) 119:229–236.[CrossRef][Web of Science][Medline]
  16. Severson WE, Mascolo PL, White MW. Lymphocyte p56L32 is a RNA/DNA-binding protein which interacts with conserved elements of the murine L32 ribosomal protein mRNA. Eur J Biochem (1995) 229:426–432.[Web of Science][Medline]
  17. Rivera-Pomar R, Niessing D, Schmidt-Ott R, Gehring WJ, Jackle H. RNA binding and translational suppression by bicoid. Nature (1996) 379:746–749.[CrossRef][Medline]
  18. Doevendans PA, Ruiz-Lozano P, Bronsaer R, Chien KR, Bilsen van M. Initiation of transcription by the atrial myosin light chain 2 promoter requires the presence of the INR cis-element. J Am Coll Cardiol (1997) 29:87, A.
  19. Zhu H, Garcia AV, Ross RS, Evans SM, Chien KR. A conserved 28-base-pair element (HF-1) in the rat cardiac myosin light-chain-2 gene confers cardiac-specific and alpha-adrenergic-inducible expression in cultured neonatal rat myocardial cells. Mol Cell Biol (1991) 11:2273–2281.[Abstract/Free Full Text]
  20. Lee KJ, Hickey R, Zhu H, Chien KR. Positive regulatory elements (HF-1a and HF-1b) and a novel negative regulatory element (HF-3) mediate ventricular muscle-specific expression of myosin light-chain 2-luciferase fusion genes in transgenic mice. Mol Cell Biol (1994) 14:1220–1229.[Abstract/Free Full Text]
  21. Gonzalez GA, Montminy MR. Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133. Cell (1989) 59:675–680.[CrossRef][Web of Science][Medline]
  22. Ruiz-Lozano P, de Lecea L, Buesa C, et al. The gene encoding rat phosphoglycerate mutase subunit M: cloning and promoter analysis in skeletal muscle cells. Gene (1994) 147:243–248.[CrossRef][Web of Science][Medline]
  23. Yu W, Dahl G, Werner R. The connexin43 gene is responsive to oestrogen. Proc R Soc Lond B Biol Sci (1994) 255:125–132.[Medline]
  24. Ross RS, Navankasattusas S, Harvey RP, Chien KR. An HF-1a/HF-1b/MEF-2 combinatorial element confers cardiac ventricular specificity and established an anterior-posterior gradient of expression. Development (1996) 122:1799–1809.[Abstract]
  25. Bergeron D, Barbeau B, Leger C, Rassart E. Experimental bias in the evaluation of the cellular transient expression in DNA co-transfection experiments. Cell Mol Biol Res (1995) 41:155–159.[Web of Science][Medline]
  26. Heim R, Cubitt A, Tsien R. Improved green fluorescence. Nature (1995) 373:663–664.[Medline]
  27. Chalfie M, Tu Y, Euskirchen G, Ward WW, Prasher DC. Green fluorescent protein as a marker for gene expression. Science (1994) 263:802–805.[Abstract/Free Full Text]
  28. Doevendans PA, Becker DA, An R, Kass RS. The utility of fluorescent in vivo reporter genes in molecular cardiology. Biochem Biophys Res Comm (1996) 222:352–358.[CrossRef][Web of Science][Medline]
  29. Heim R, Prasher DC, Tsien RY. Wavelength mutations and posttranslational autoxidation of green fluorescent protein. Proc Natl Acad Sci USA (1994) 91:12501–12504.[Abstract/Free Full Text]
  30. Henderson SA, Spencer M, Sen A, Kumar C, Siddiqui MA, Chien KR. Structure, organization, and expression of the rat cardiac myosin light chain-2 gene. J Biol Chem (1989) 264:18142–18148.[Abstract/Free Full Text]
  31. Simpson P, Shoshana S. Differentiation of rat myocytes in single cell cultures with and without proliferating nonmyocardial cells. Circ Res (1982) 50:101–116.[Free Full Text]
  32. Fuller SJ, Chien KR. Genetic engineering of cardiac muscle cells: in vitro and in vivo. Genet Eng NY (1994) 16:17–31.[Medline]
  33. Kirshenbaum LA, Schneider MD. Adenovirus E1A represses cardiac gene transcription and reactivates DNA synthesis in ventricular myocytes, via alternative pocket protein- and p300-binding domains. J Biol Chem (1995) 270:7791–7794.[Abstract/Free Full Text]
  34. Forsayeth JR, Garcia PD. Adenovirus-mediated transfection of cultured cells. Biotechniques (1994) 17:354–358.[Web of Science][Medline]
  35. Guzman R, Lemarchand P, Crystal R, Epstein S, Finkel T. Efficient gene transfer into the myocardium by direct injection of adenovirus vectors. Circ Res (1993) 73:1202–1207.[Abstract/Free Full Text]
  36. Burgess DL, Jones JM, Meisler MH, Noebels JL. Mutation of the Ca2+ channel beta subunit gene Cchb4 is associated with ataxia and seizures in the lethargic (lh) mouse. Cell (1997) 88:385–392.[CrossRef][Web of Science][Medline]
  37. Curran ME, Splawski I, Timothy KW, Vincent GM, Green ED, Keating MT. A molecular basis for cardiac arrhythmia: HERG mutations cause long QT syndrome. Cell (1995) 80:795–803.[CrossRef][Web of Science][Medline]
  38. Valcarcel J, Singh R, Zamore PD, Green MR. The protein Sex-lethal antagonizes the splicing factor U2AF to regulate alternative splicing of transformer pre-mRNA. Nature (1993) 362:171–175.[CrossRef][Medline]
  39. Schmitz A, Galas DJ. DNase I footprinting: a simple method for the detection of protein-DNA binding specificity. Nucleic Acids Res (1978) 5:3157–3170.[Abstract/Free Full Text]
  40. Wang G, Semenza G. Identification and characterization of transcription factors from mammalian cells. In: Adolph KW, editor. Human molecular genetics. Orlando: Academic press, 1996:298-320.
  41. Navankasattusas S, Sawadogo M, van Bilsen M, Dang CV, Chien KR. The basic helix-loop-helix protein upstream stimulating factor regulates the cardiac ventricular myosin light-chain 2 gene via independent cis regulatory elements. Mol Cell Biol (1994) 14:7331–7339.[Abstract/Free Full Text]
  42. Sturm RA, Das G, Herr W. The ubiquitous octamer-binding protein Oct-1 contains a POU domain with a homeo box subdomain. Genes Dev (1988) 2:1582–1599.[Abstract/Free Full Text]
  43. Ruiz-Lozano P, Doevendans PA, Brown A, Chien KR. A sex-lethal related factor (CNR) is a negative regulator of MLC-2v expression. Circulation (1995) 92:755A.
  44. Reisman D, Rotter V. The helix-loop-helix containing transcription factor USF binds to and transactivates the promoter of the p53 tumor suppressor gene. Nucleic Acids Res (1993) 21:345–350.[Abstract/Free Full Text]
  45. Siomi H, Siomi MC, Nussbaum RL, Dreyfuss G. The protein product of the fragile X gene, FMR1, has characteristics of an RNA-binding protein. Cell (1993) 74:291–298.[CrossRef][Web of Science][Medline]
  46. Patton JG, Porro EB, Galceran J, Tempst P, Nadal-Ginard B. Cloning and characterization of PSF, a novel pre-mRNA splicing factor. Genes Dev (1993) 7:393–406.[Abstract/Free Full Text]
  47. Higuchi R. Using PCR to engineer DNA. In: Erlich HA, editor. PCR technology. New York: W.H. Freeman, 1992:61-70.
  48. Doevendans PA, Hunter JJ, Lembo G, Wollert KC, Chien KR. Strategies for studying cardiovascular diseases in transgenic mice and gene-targeted mice. In: Monastersky GM, Robl JM, editors. Strategies in transgenic animal science. Washington: American Society For Microbiology, 1995:107-144.
  49. Kubalak S, Doevendans PA, Rockman H, et al. Molecular analysis of cardiac muscle diseases based on mouse genetics. In: Adolph KW, editor. Human molecular genetics. Orlando: Academic Press, 1996:470-487.
  50. Doevendans PA, van Bilsen M. Transcription factors and the cardiac gene programme. Int J Biochem Cell Biol (1996) 28:387–403.[CrossRef][Web of Science][Medline]
  51. Papavassiliou A. Molecular medicine: transcription factors. N Eng J Med (1995) 322:45–47.
  52. Compton T. Degenerate primers for DNA amplification. In: Innes MA, editor. PCR protocols: A guide to methods and applications. 1990:39-45.
  53. Evans SM, Yan W, Murillo MP, Ponce J, Papalopulu N. Tinman, a Drosophila homeobox gene required for heart and visceral mesoderm specification, may be represented by a family of genes in vertebrates: XNkx-2.3, a second vertebrate homologue of tinman. Development (1995) 121:3889–3899.[Abstract]
  54. Laverriere AC, MacNeill C, Mueller C, Poelmann RE, Burch JB, Evans T. GATA-4/5/6, a subfamily of three transcription factors transcribed in developing heart and gut. J Biol Chem (1994) 269:23177–23184.[Abstract/Free Full Text]
  55. Weintraub H, Davis R, Tapscott S, et al. The MyoD family: nodal point during specification of the muscle cell lineage. Science (1989) 251:761–766.[CrossRef]
  56. Lossar A, Paterson BM, Weintraub H. Transfection of a cDNA locus that mediates the conversion of 10T1/2 fibroblasts to myoblasts. Cell (1986) 47:649–655.[CrossRef][Web of Science][Medline]
  57. Murry CE, Kay MA, Bartosek T, Hauschka SD, Schwartz SM. Muscle differentiation during repair of myocardial necrosis in rats via gene transfer with MyoD. J Clin Invest (1996) 98:2209–2217.[Web of Science][Medline]
  58. Tam SK, Gu W, Nadal-Ginard B. Molecular cardiomyoplasty: potential cardiac gene therapy for chronic heart failure. J Thorac Cardiovasc Surg (1995) 109:918–923.[Abstract]
  59. Srivastava D, Cserjesi P, Olson EN. A subclass of bHLH proteins required for cardiac morphogenesis. Science (1995) 270:1995–1999.[Abstract/Free Full Text]
  60. Olson EN, Srivastava D. Molecular pathways controlling heart development. Science (1996) 272:671–676.[Abstract]
  61. Kadonga JT, Tjian R. Affinity purification of sequence-specific DNA binding proteins. Proc Natl Acad Sci USA (1986) 83:5889–5893.[Abstract/Free Full Text]
  62. Norman C, Runswick M, Pollock R. Isolation and properties of cDNA clones encoding SRF, a transcription factor that binds to the c-fos serum response element. Cell (1988) 55:989–1003.[CrossRef][Web of Science][Medline]
  63. Vinson CR, LeMarco K, Johnson P, Landschulz WH, McKnight SL. In situ detection of sequence-specific DNA binding activity specified by a recombinant bacteriophage. Genes Dev (1988) 2:801–806.[Abstract/Free Full Text]
  64. Zhu H, Nguyen VT, Brown AB, et al. A novel, tissue-restricted zinc finger protein (HF-1b) binds to the cardiac regulatory element (HF-1b/MEF-2) in the rat myosin light-chain 2 gene. Mol Cell Biol (1993) 13:4432–4444.[Abstract/Free Full Text]
  65. DeAngelo DJ, DeFalco J, Childs G. Purification and characterization of the stage-specific embryonic enhancer-binding protein SSAP-1. Mol Cell Biol (1993) 13:1746–1758.[Abstract/Free Full Text]
  66. Yu YT, Breitbart RE, Smoot LB, Lee Y, Mahdavi V, Nadal-Ginard B. Human myocyte-specific enhancer factor 2 comprises a group of tissue-restricted MADS box transcription factors. Genes Dev (1992) 6:1783–1798.[Abstract/Free Full Text]
  67. Van Dyke MW, Sirito M, Sawadogo M. Single-step purification of bacterially expressed polypeptides containing an oligo-histidine domain. Gene (1992) 111:99–104.[CrossRef][Web of Science][Medline]
  68. Hakes DJ, Dixon JE. New vectors for high level expression of recombinant proteins in bacteria. Anal Biochem (1992) 202:293–298.[CrossRef][Web of Science][Medline]
  69. Sawadogo M, Van Dyke MW. Indirect use of immobilized metal affinity chromatography for isolation and characterization of protein partners. Genet Eng NY (1995) 17:53–65.[Medline]
  70. Kaushal S, Schneider JW, Nadal-Ginard B, Mahdavi V. Activation of the myogenic lineage by MEF2A, a factor that induces and cooperates with MyoD. Science (1994) 266:1236–1240.[Abstract/Free Full Text]
  71. Martin JF, Miano JM, Hustad CM, Copeland NG, Jenkins NA, Olson EN. A Mef2 gene that generates a muscle-specific isoform via alternative mRNA splicing. Mol Cell Biol (1994) 14:1647–1656.[Abstract/Free Full Text]
  72. Ruiz-Lozano P, Doevendans PA, Brown A, Gruber PJ, Chien KR. Developmental and tissue restricted expression of a murine spliceosome related protein mSAP49 during cardiogenesis. Dev Dyn (1997) 208:482–490.[CrossRef][Web of Science][Medline]
  73. Geiger JH, Hahn S, Lee S, Sigler PB. Crystal structure of the yeast TFIIA/TBP/DNA complex. Science (1996) 272:830–836.[Abstract]
  74. Arnold R, Burcin M, Kaiser B, Muller M, Renkawitz R. DNA bending by the silencer protein NeP1 is modulated by TR and RXR. Nucleic Acids Res (1996) 24:2640–2647.[Abstract/Free Full Text]
  75. Gorza L, Ausoni S, Merciai N, Hastings KE, Schiaffino S. Regional differences in troponin I isoform switching during rat heart development. Dev Biol (1993) 156:253–264.[CrossRef][Web of Science][Medline]
  76. Lyons GE, Schiaffino S, Sassoon D, Barton P, Buckingham ME. Developmental regulation of myosin gene expression in mouse cardiac cells. J Cell Biol (1990) 111:2427–2436.[Abstract/Free Full Text]
  77. Neyses L, Vetter H. Molecular biology of oncogenes and cardiovascular hypertrophy. J Hypertens (1992) 10:1447–1452.[Web of Science][Medline]
  78. Kliewer SA, Umesono K, Mangelsdorf DJ, Evans RM. Retinoid X receptor interacts with nuclear receptors in retinoic acid, thyroid hormone and vitamin D3 signalling. Nature (1992) 355:446–449.[CrossRef][Medline]
  79. Mangelsdorf DJ, Thummel C, Beato M, et al. The nuclear receptor superfamily: the second decade. Cell (1995) 83:835–839.[CrossRef][Web of Science][Medline]
  80. Morkin E. Regulation of myosin heavy chain genes in the heart. Circulation (1993) 87:1451–1460.[Abstract/Free Full Text]
  81. Sorger PK, Lewis MJ, Pelham HR. Heat shock factor is regulated differently in yeast and Hela cells. Nature (1987) 329:81–84.[CrossRef][Medline]
  82. Andres V, Fisher S, Wearsch P, Walsh K. Regulation of Gax homeobox gene transcription by a combination of positive factors including myocyte-specific enhancer factor 2. Mol Cell Biol (1995) 15:4272–4281.[Abstract]
  83. Shiyanov P, Bagchi S, Adami G, et al. p21 Disrupts the interaction between cdk2 and the E2F-p130 complex. Mol Cell Biol (1996) 16:737–744.[Abstract]
  84. Hunter JJ, Tanaka N, Rockman HA, Ross J Jr., Chien KR. Ventricular expression of a MLC-2v-ras fusion gene induces cardiac hypertrophy and selective diastolic dysfunction in transgenic mice. J Biol Chem (1995) 270:23173–23178.[Abstract/Free Full Text]
  85. Ronicke V, Risau W, Breier G. Characterization of the murine FLK-1 promoter. Circ Res (1996) 79:277–285.[Abstract/Free Full Text]
  86. LI L, Miano JM, Mercer B, Olson EN. Expression of the SM22alpha promoter in transgenic mice provides evidence for distinct transcriptional regulatory programs in vascular and visceral smooth muscle cells. J Cell Biol (1996) 132:849–859.[Abstract/Free Full Text]
  87. Dyson E, Sucov HM, Kubalak SW, et al. Atrial-like phenotype is associated with embryonic ventricular failure in retinoid X receptor alpha –/– mice. Proc Natl Acad Sci USA (1995) 92:7386–7390.[Abstract/Free Full Text]
  88. London B, Hill J, Nguyen H, Schieferl S, Nadal-Ginard B. In vivo mutagenesis of the mouse heart: targeted replacement of the murine delayed rectifier potassium channel mKv1.5 with the rat brain delayed rectifier channel rKv1.1. Circulation (1995) 92:I, 195A.
  89. Gu H, Marth JD, Orban PC, Mossmann H, Rajewsky K. Deletion of a DNA polymerase beta gene segment in T cells using cell type-specific gene targeting. Science (1994) 265:103–106.[Abstract/Free Full Text]
  90. Agah R, Frenkel BA, French BA, Michael LH, Overbeek PA, Schneider MD. Gene recombination in postmitotic cells. Targeted expression of Cre recombinase provokes cardiac-restricted, site-specific rearrangement in adult ventricular muscle in vivo. J Clin Invest (1997) 100:169–179.[Web of Science][Medline]
  91. Morishita R, Gibbons GH, Horiuchi M, et al. A gene therapy strategy using a transcription factor decoy of the E2F binding site inhibits smooth muscle proliferation in vivo. Proc Natl Acad Sci USA (1995) 92:5855–5859.[Abstract/Free Full Text]
  92. Sanger F, Coulson AR. A rapid method for determining sequences in DNA by primed synthesis and DNA polymerase. J Mol Biol (1975) 94:444–448.
  93. Pollock R, Treisman R. Human SRF-related proteins: DNA-binding properties and potential regulatory targets. Genes Dev (1991) 5:2327–2341.[Abstract/Free Full Text]
  94. Lyons I, Parsons LM, Hartley L, et al. Myogenic and morphogenetic defects in the heart tubes of murine embryos lacking the homeo box gene Nkx2-5. Genes Dev (1995) 9:1654–1666.[Abstract/Free Full Text]
  95. Hasty P, Bradley A, Morris JH, et al. Muscle deficiency and neonatal death in mice with a targeted mutation in the myogenin gene. Nature (1993) 364:501–506.[CrossRef][Medline]
  96. Strauss EC, Andrews NC, Higgs DR, Orkin SH. In vivo footprinting of the human alpha-globin locus upstream regulatory element by guanine and adenine ligation-mediated polymerase chain reaction. Mol Cell Biol (1992) 12:2135–2142.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Doevendans, P. A.
Right arrow Articles by van Bilsen, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Doevendans, P. A.
Right arrow Articles by van Bilsen, M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?