Skip Navigation

Cardiovascular Research 1998 37(3):772-779; doi:10.1016/S0008-6363(97)00250-2
© 1998 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Bauersachs, J.
Right arrow Articles by Busse, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bauersachs, J.
Right arrow Articles by Busse, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 1998, European Society of Cardiology

Vasodilator dysfunction in aged spontaneously hypertensive rats: changes in NO synthase III and soluble guanylyl cyclase expression, and in superoxide anion production

Johann Bauersachsa,1, Anne Bouloumiéa, Alexander Mülscha, Gabriele Wiemerb, Ingrid Fleminga and Rudi Bussea,*

aInstitut für Kardiovaskuläre Physiologie, Zentrum der Physiologie, Klinikum der J.W. Goethe-Universität, Theodor-Stern-Kai 7, 60590 Frankfurt/Main, Germany
bPGU Cardiovascular agents, Hoechst Marion Roussel, Frankfurt/Main, Germany

* Corresponding author. Tel. (+49-69) 6301 6052; Fax (+49-69) 6301 7668; E-mail: r.busse@em.uni-frankfurt.de

Received 19 June 1997; accepted 25 September 1997


    Abstract
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
Objective/Methods: Genetic hypertension is associated with an apparent endothelial dysfunction and impaired endothelium-dependent vasodilatation in response to increased flow and receptor-dependent agonists. However, the link between impaired vasodilatation and nitric oxide (NO) synthase expression is still unclear. In the present study, dilator responses were determined in the aorta and coronary circulation of 16 month old spontaneously hypertensive (SHR) and Wistar Kyoto rats (WKY). Changes in vascular reactivity were compared with alterations in superoxide anion production as well as endothelial NO synthase (NOS III) and soluble guanylyl cyclase expression. Results: In the isolated perfused heart both the bradykinin- and sodium nitroprusside-induced vasodilator responses were attenuated in SHR compared to WKY. Western blot analysis revealed a parallel reduction in NOS III expression in coronary microvascular endothelial cells from SHR. Superoxide anion production in aortae from SHR was markedly elevated over that of aortae from WKY, and was almost completely abolished by pretreatment with superoxide dismutase. Superoxide dismutase induced similar relaxations in phenylephrine-preconstricted aortic rings from both SHR and WKY, but failed to restore the attenuated acetylcholine- and sodium nitroprusside-induced relaxations in SHR. No difference in NOS III expression was detected in the aortae from either strain whereas soluble guanylyl cyclase expression was markedly decreased in SHR. Conclusions: These results demonstrate that NOS III expression in different tissues is differentially affected by hypertension. Moreover, althoug an elevated superoxide anion production is apparent in the aorta, a reduced soluble guanylyl cyclase expression appears to account for the observed vasodilator dysfunction in SHR.

KEYWORDS Hypertension; Endothelium; Smooth muscle; NO synthase; Superoxide anion; Soluble guanylyl cyclase; Spontaneously hypertensive rats


    1 Introduction
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
Endothelium-derived nitric oxide (NO), synthesised by the constitutive NO synthase (NOS III) under basal and stimulated conditions, contributes to the control of vascular tone (for review see [1]). The pathophysiological significance of a decrease in endothelium-derived NO in the development and/or maintenance of arterial hypertension (for review see [2]) has been inferred from the findings that systemic administration of NOS inhibitors markedly increases arterial blood pressure [3]and that knocking out the gene encoding NOS III in mice results in significant and maintained hypertension [4].

Endothelial function is heterogeneously affected in genetic hypertension in rats and humans [5]. Impaired endothelium-dependent vasodilatation in certain vascular beds has been described and attributed to the generation of an endothelium-derived constrictor prostanoid (PGH2) as well as an apparent decrease in the production of bioactive NO [6–8]. In other vascular beds endothelium-dependent relaxation is normal and there is no evidence of an alteration in the production of vasoactive factors [8]. However, contradictory results have been reported in different animal models as well as in animals of different ages [9–11].

The cellular mechanisms underlying endothelial dysfunction in hypertension remain to be fully elucidated but an alteration in endothelial superoxide anion (O2) production does appear to be implicated in this process. Indeed, in vessels from rats with either genetic [12]or angiotensin II-induced hypertension [13], an enhanced formation of O2 has been demonstrated. Since an increase in O2 production essentially scavenges NO, an elevated vascular O2 production has been proposed to account for the blunted vasodilator response, i.e. the apparent decrease in bioactive NO, observed in various forms of hypertension. Such observations may account for the finding that despite the clear evidence of a reduction in bioactive NO, the actual generation of NO may even be increased in vessels from hypertensive animals exhibiting endothelial dysfunction [14–16].

In the present study, dilator responses in the aorta and coronary circulation of 16 month old spontaneously hypertensive rats (SHR) and Wistar Kyoto rats (WKY) were compared. Vascular reactivity was correlated with O2 production, NOS III expression in native macrovascular and cultured microvascular endothelial cells, and expression of the soluble guanylyl cyclase in vascular smooth muscle cells.


    2 Methods
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
Experiments were performed using aortae and hearts obtained from 16 month old spontaneously hypertensive (SHR) and Wistar Kyoto rats (WKY). The investigation conforms with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1985).

2.1 Isolation and culture of rat coronary microvascular endothelial cells
Rat coronary microvascular endothelial cells (RCMEC) were isolated as described [17]and were cultured in medium containing a 1:1 formulation of Dulbecco's modified Eagle's (DME) and HAM's F12 medium supplemented with penicillin (50 IU/ml), streptomycin (50 µg/ml), L-glutamine (1 mmol/l), glutathione and L-(+)-ascorbic acid (5 µg/ml each, Biotect protection medium), heparin (8.8 IU/ml), endothelial cell growth supplement (ECGS, 50 µg/ml) and heat-inactivated calf serum (20%). RCMEC were seeded on 6-wells plates (Nunc Intermed, Wiesbaden, Germany) precoated with collagen A and were maintained in a 95% O2–5% CO2 humidified incubator at 37°C. The culture medium was changed 1 h and 24 h after seeding. For protein and mRNA extraction, RCMEC were frozen at –80°C in guanidinium thiocyanate solution [18].

2.2 Isolated perfused rat heart
Rats were anaesthetised with sodium pentobarbitone (60 mg/kg, i.p.). After heparinization (500 units i.v.), the thorax was opened and the heart rapidly perfused in situ through a cannula inserted into the aortic stump (Langendorff preparation). After ligation of the superior and inferior vena cava close to the right atrium, the heart was excised and perfused at constant flow (20 ml/min). Modified Krebs–Henseleit buffer (pH 7.4, 37°C, continuously gassed with 95% O2 and 5% CO2) containing the cyclo-oxygenase inhibitor, diclofenac (1 µmol/l), was used as perfusate. Coronary perfusion pressure was monitored with a pressure transducer (Gould P2310, Oxnard, CA, USA) connected to a side-arm of the aortic perfusion cannula. Isovolumetric left ventricular pressure was measured with a fluid-filled latex balloon inserted into the left ventricle via the left atrium and connected to a second pressure transducer (Gould CP-01). Balloon volume was adjusted to obtain a diastolic pressure of about 10 mmHg and the heart rate was derived from the left ventricular pressure signal by a cardiotachometer [19]. The heart was allowed to equilibrate for at least 20 min in order to obtain a stable coronary perfusion pressure. Vasodilator agents, bradykinin (10 to 300 pmol) or sodium nitroprusside (1 and 10 nmol) were administered to the coronary vascular bed as bolus injections (10 µl). Dilator responses were calculated as percentage decrease in coronary perfusion pressure. At the end of the experiment, the heart was removed from the perfusion cannula, and wet weight was determined after gentle blotting of the endocardial and epicardial surfaces with filter paper.

2.3 Vascular reactivity studies
The descending thoracic aorta was removed from anaesthetised (60 mg/kg sodium pentobarbitone i.p.) rats, cleaned of connective tissue and dissected into three sections. The upper section (15 mm) was immediately frozen in liquid nitrogen for RT-PCR and Western blot analysis. The lower section (10 mm) was used for measurement of O2 production, while the remainder was cut into 4 rings (3 mm in length) which were mounted in an organ bath (Schuler-Organbad; Hugo Sachs Electronic) for isometric force measurement. The rings were equilibrated for 30 min under a resting tension of 2 g in carbogenated (95% O2; 5% CO2) Krebs–Henseleit solution (pH 7.4, 37°C) in the presence of the cyclo-oxygenase inhibitor diclofenac (1 µmol/l). Rings were repeatedly contracted by phenylephrine (1 µmol/l) until reproducible responses were obtained. Thereafter, the rings were preconstricted with phenylephrine (0.3–1 µmol/l) to comparable constriction levels and the relaxant response to acetylcholine was assessed in the presence or absence of superoxide dismutase (SOD, 100 nmol/l). After a washout period, rings were contracted by phenylephrine in the presence of the NOS inhibitor, NGnitro-L-arginine (L-NNA, 100 µmol/l) and the relaxant response to sodium nitroprusside was assessed in the presence or absence of superoxide dismutase (SOD, 100 nmol/l).

2.4 Analysis of the NOS III expression by RT-PCR
Total RNA was extracted according to the method of Chomczynski and Sacchi [18]. For the reverse transcription (RT), 2 mg total RNA were incubated with 200 U reverse transcriptase (GIBCO), dNTP (125 µmol/l), oligo(dT) (200 ng) and reaction buffer in a final volume of 20 µl at 37°C for 60 min. In some reaction mixtures, either the reverse transcriptase or total RNA was omitted to determine the amplification of contaminating genomic DNA or cDNA. After a final denaturation at 94°C for 7 min, 6 µl cDNA was subjected to polymerase chain reaction (PCR) consisting of a denaturation at 94°C for 1 min, followed by 90 s annealing at 52°C and 90 s elongation at 72°C for 30 cycles. The last cycle ended with 7 min elongation at 72°C. In each PCR, the cDNA for NOS III and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) were co-amplified. The primers used to amplify NOS III were derived from the sequence of the partially cloned rat NOS III cDNA (Genbank accession number: U02534 [GenBank] ) (sense primer: 5'CGTGCGCCAGGCTCTCACTTAC3') and from the sequence of the cloned human NOS III cDNA [20, 21](antisense primer: 5'GGCTGCAGCCCTTTGCTCTCA3') allowing the amplification of a 550 bp fragment. The primers used to amplify GAPDH were derived from the cloned rat GAPDH cDNA [22](sense primer: 5'TATGACAACTCCCTCAAGAT3', antisense primer: 5'AGATCCACAACGGATACATT3'), allowing the amplification of a 320 bp fragment. The PCR contained 0.4 µmol/l of each primer, dNTP (200 µmol/l), MgCl2 (1 mmol/l) reaction buffer and 2.5 U Taq polymerase (PROMEGA) in a final volume of 50 µl. The amplified cDNAs were size fractionated by agarose gel electrophoresis, visualised under UV using an ethidium bromide staining, transferred to nylon membrane (Hybond-N, Amersham) and hybridised with a Formula -labelled NOS III fragment obtained from the cloned bovine NOS III cDNA and with a Formula -labelled GAPDH fragment isolated from PCR. The NOS III cDNA and the GAPDH cDNA were quantified after autoradiography by scanning densitometry. The NOS III cDNA was normalised by comparison with GAPDH cDNA. Preliminary experiments revealed that identical results were obtained with the various cell isolation procedures used.

2.5 Western blot analysis
Crude protein extracts were obtained after alcoholic precipitation of the phenol phase obtained during the total RNA extraction. The extracts were subjected to polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes (BioRad) as previously described [23]. Prestained molecular weight marker proteins (BioRad) were used as standards for the SDS-PAGE. A Ponceau staining was performed to verify the quality of the transfer and the equal amount of protein in each lane. Proteins were detected using their respective antibodies as described in the results section and were visualised by enhanced chemiluminescence using a commercially available kit (Amersham, Germany). The autoradiographs were analysed by scanning densitometry.

2.6 Measurement of reactive oxygen species
The O2 generation of the rings was assessed by lucigenin-enhanced chemiluminescence as described previously [24].

2.7 Materials
Bradykinin was purchased from Bachem (Heidelberg, Germany), NGnitro-L-arginine from Serva (Heidelberg, Germany), diclofenac (Voltaren injection solution) from Ciba-Geigy (Wehr, Germany). Bovine recombinant superoxide dismutase (Peroxinorm) was provided by Grünenthal (Aachen, Germany). All other chemicals were obtained in the highest purity available from Sigma (Deisenhofen, Germany) or Merck (Darmstadt, Germany). The [{alpha}P32]dCTP was purchased from Hartmann analytic (Braunschweig, Germany). The cloned bovine NOS III cDNA was a gift from D.G. Harrison, Emory University, Atlanta. The monoclonal NOS III antibody was purchased from Transduction Laboratories (Affiniti, Exeter, England) and the antibody against the β1-subunit of the soluble guanylyl cyclase was kindly provided by Dr. Peter Yuen, Memphis, Tennessee, USA.

2.8 Statistics
Data are expressed as mean±SEM. Statistical analysis was performed by one-way analysis of variance (ANOVA) followed by a Bonferroni t test or the two-tailed Student's t test for unpaired data where appropriate. Values of P<0.05 were considered statistically significant.


    3 Results
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
Global parameters of WKY or SHR and data from subsequently isolated hearts are shown in Table 1. The mean arterial blood pressure measured by tail plethysmography and the heart/body weight ratio were significantly higher in aged SHR compared with age-matched WKY. In addition, basal coronary perfusion pressure in hearts from SHR was significantly elevated above that in WKY. No difference in heart rate was observed.


View this table:
[in this window]
[in a new window]

 
Table 1 Global parameters and data from isolated perfused hearts

 
3.1 Vasodilator responses in the isolated perfused heart
Bolus injections of the endothelium-dependent vasodilator, bradykinin (10–300 pmol), induced a dose-dependent decrease in coronary perfusion pressure in the hearts from WKY and SHR (Fig. 1). The maximal dilator response observed in hearts from SHR was however only 30% of that in hearts from WKY.


Figure 1
View larger version (24K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Decrease in coronary perfusion pressure (CPP) induced by bolus injections of bradykinin (Bk) and sodium nitroprusside (SNP) in isolated hearts (Langendorff preparation) from WKY (open columns) and SHR (shaded columns). Data are expressed as the percentage change in CPP and are presented as the mean±SEM from 6 separate experiments. **, P<0.01 vs. WKY.

 
The endothelium-independent vasodilator, sodium nitroprusside elicited a dose-dependent decrease in coronary perfusion pressure without affecting left ventricular pressure or heart rate. In hearts from 16 month old SHR, the dilator response to sodium nitroprusside was markedly attenuated compared with that observed in age-matched WKY (Fig. 1).

3.2 Vasodilator responses in aortic rings
In aortic rings preconstricted with phenylephrine, acetylcholine induced a concentration-dependent relaxation which was blunted in aortae from SHR (Fig. 2A). The concentration-response curve to sodium nitroprusside in aortae from SHR was significantly shifted to the right, however no difference in the maximum relaxant response was observed in aortic rings from SHR and WKY (Fig. 2B).


Figure 2
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Acetylcholine- (A) and sodium nitroprusside (SNP, B)- induced relaxations of phenylephrine-preconstricted aortic rings from WKY ({circ},bullet) and SHR ({triangledown},{blacktriangledown}) in the absence ({circ},{triangledown}) or presence (bullet,{blacktriangledown}) of superoxide dismutase (100 nmol/l). Results are expressed as the mean±SEM from 6 separate experiments. *, P<0.05 vs. WKY.

 
To determine whether an enhanced production of O2 accounts for the attenuated vasodilator responses observed in the heart and in the aorta of SHR, the acetylcholine- and the sodium nitroprusside-induced relaxation in aortic rings were studied in the presence of SOD. Addition of SOD (100 nmol/l) to phenylephrine-constricted aortic rings resulted in a small but stable relaxation which was comparable in aortic rings from WKY (26±4%) and SHR (24±3%). However, SOD failed to affect the relaxant responses observed in rings from either SHR or WKY (Fig. 2).

3.3 Production of superoxide anions
Superoxide anions generated by aortic rings from SHR and WKY was assessed by lucigenin-enhanced chemiluminescence. O2 release was greater in aortae from SHR than WKY, with the endothelium being the main source of this radical production (Fig. 3). Pretreatment of aortic segments from SHR and WKY with L-NNA (0.1 mmol/l; data not shown) had no effect on the production of O2, which was practically abolished in the presence of SOD (Fig. 3).


Figure 3
View larger version (30K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Superoxide anion production in aortae from WKY (open columns) and SHR (shaded columns) in the presence (E+) or absence (E) of the endothelium and in the absence and presence of superoxide dismutase (SOD; 100 nmol/l). Results are expressed as the mean±SEM from 5 separate experiments. **, P<0.01.

 
3.4 NOS III expression in the heart and the aorta
NOS III protein and mRNA levels were determined in aortic segments and in RCMEC from SHR and WKY. No difference in NOS III protein level could be detected in aortic segments from the two strains (Fig. 4A). In contrast, compared to cells from WKY, a marked decrease in NOS III expression was detected in RCMEC from SHR (Fig. 5A) and also in sub-confluent RCMEC maintained in culture for 24 h (data not shown). This observation on NOS III expression was also reflected in the steady-state level of NOS III mRNA, as revealed in RT-PCR experiments, performed using the same cell extracts (Fig. 4B and Fig. 5B).


Figure 4
View larger version (48K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Comparison of NOS III expression in aortae from WKY (W) and SHR (S). (A) A representative Western blot is shown. Proteins were separated by SDS-PAGE and NOS III protein was detected using a specific anti-NOS III antibody as described in Methods. (B) A representative Southern-blot analysis is shown. mRNA was detected using reverse transcriptase followed by a polymerase chain reaction (RT-PCR) and Southern blotting. The RT-PCR experiments were performed as described in Methods and resulted in the co-amplification of NOS III and GAPDH cDNA. Densitometric analyses were performed and the results are expressed as the mean±SEM from 4 separate experiments.

 

Figure 5
View larger version (40K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Comparison of NOS III expression in confluent primary cultures of rat coronary microvascular endothelial cells (RCMEC) from WKY and SHR. (A) A representative Western blot is shown. Proteins were separated by SDS-PAGE and NOS III protein was detected using a specific anti-NOS III antibody as described in Methods. (B) A representative Southern-blot analysis is shown. mRNA was detected using reverse transcriptase followed by a polymerase chain reaction (RT-PCR) and Southern blotting. The RT-PCR experiments were performed as described in Methods and resulted in the co-amplification of NOS III and GAPDH cDNA. Densitometric analyses were performed and the results are expressed as the mean±SEM using RCMEC cultured from 8–12 separate hearts. *, P<0.05.

 
3.5 Expression of soluble guanylyl cyclase in rat aorta
In order to investigate the possible mechanisms responsible for the reduction of the vasodilator capacity in aged SHR, soluble guanylyl cyclase (β-subunit) expression in aortic segments was determined. As illustrated in Fig. 6, soluble guanylyl cyclase expression was markedly reduced in 16 month old SHR compared with age-matched WKY (Fig. 6).


Figure 6
View larger version (49K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 Western blots and densitometric analysis showing soluble guanylyl cyclase (sGC) protein levels in the aorta from WKY and SHR. Proteins were separated by SDS-PAGE and sGC protein was detected using a specific antibody against the β1-subunit as described in Methods. Values are means±SEM (n=4 per group).*, P<0.05.

 

    4 Discussion
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
In the present study, we have demonstrated that genetic hypertension in aged rats is associated with a marked decrease in endothelial NOS III expression in the coronary vasculature but not in the aorta, despite an apparent vasodilator dysfunction in both tissues. Although vascular O2 production was elevated in aortae from SHR, and SOD abrogated this increased O2 production in SHR, vasodilator responsiveness was not markedly improved by SOD. Thus manifest endothelial dysfunction is not necessarily attributable to one mechanism or cellular lesion in all vascular beds. In SHR, impaired endothelium-dependent relaxation to acetylcholine has been attributed to the release of endothelium-derived, vasoconstrictor prostanoids, such as prostaglandin H2 [7, 25, 26]. However, such factors are unable to account for the dilator dysfunction reported here since all the experiments were performed in the presence of the cyclo-oxygenase inhibitor diclofenac. Moreover it should be noted that the formation of a constricting factor can only be evidenced following application of relatively high concentrations of acetylcholine (1–10 µmol/l) [7, 25], whereas in the present study impaired endothelium-dependent relaxations in SHR were already apparent at 100-fold lower agonist concentrations.

Our observation that both bradykinin-induced dilations in the coronary circulation and NOS III expression in the coronary endothelium were attenuated in SHR is at odds with recently published studies in which an increase in calcium-dependent NOS activity was described in cardiac homogenates from SHR [14]as well as an enhanced NO release [15]. It should however be stressed that the rats used in the present study were significantly older than those used in other studies (16 vs. 4–5 months) where changes in vascular NO/O2 production were correlated with the degree of endothelial dysfunction. Moreover, since it has been established that NOS III is also expressed in the endo- and myocardium [27], we focused on NOS III expression in microvascular coronary endothelial cells. This approach facilitated the comparison of the effects of normotension and genetic hypertension on a cell type thought to be one of the main cellular targets in the pathophysiology of hypertension. Since the vasodilator responsiveness to both bradykinin and SNP were attenuated in hearts from SHR our results suggest that the attenuated vasodilator responsiveness to bradykinin probably reflects the combined effects of a decrease in both the NO producing (NOS III) and effector (soluble guanylyl cyclase) enzymes.

In contrast to our observation that the expression of NOS III was decreased in the coronary endothelium, we failed to detect any differences in NOS III mRNA or protein expression in the aortae from aged SHR and WKY. This finding is consistent with results obtained by other groups using adult SHR, where the release of NO was apparently normal [28, 29]. Assuming that the cellular signalling pathways leading to NOS III activation are not altered in SHR, our results suggest that agonist-induced NO synthesis is not reduced as a consequence of chronic hypertension. Mechanisms which may possibly contribute to the dilator dysfunction in aortae from aged SHR include an increased inactivation of NO as a result of an enhanced O2 production, which has been linked to several forms of hypertension [13, 30], or an alteration in the NO-mediated activation of soluble guanylyl cyclase and subsequent cyclic GMP formation in vascular smooth muscle cells.

While O2 generation in aortae from SHR was greater than that in aortae from WKY the removal of the endothelium abrogated this difference. These observations indicate that the excess vascular O2 formation in SHR is derived mainly from endothelial cells, whereas in WKY vascular O2 originates mainly from smooth muscle cells and are in line with the reported upregulation of O2 production in cultured endothelial cells from the aortae of stroke-prone SHR [12]. It is not clear whether the elevation of O2 levels reflects the upregulation of O2 generating enzymes or a reduction in SOD activity since data on SOD activity in hypertension are conflicting [31, 32]. While acute scavenging of O2 in young SHR restores the depressed endothelial NO production [12], vasodilator responsiveness was not improved in 16 month old animals. Although SOD almost completely scavenged O2 and induced a distinct relaxation of rat aortic rings from SHR, it did not restore the impaired acetylcholine- or sodium nitroprusside-induced relaxations in SHR. An inability of our SOD preparation to exert its extracellular action appears to be unlikely since in contrast to the present results, SOD restored acetylcholine-induced relaxations in experimental hypertension following aortic banding [16]. Thus mechanisms other than an increase in O2 production appear to underlie the attenuation of agonist-induced relaxations in 16 month old SHR.

It is conceivable that during the course of hypertension changes in NOS III expression and O2 production occur and/or that the endothelial cell adapts to upregulation of autacoid and free radical production by down-regulating effector pathways. Indeed, NO may affect the expression of its main intracellular receptor — the soluble guanylyl cyclase — as demonstrated by a decrease in its expression following induction of NOS II [33]and in nitrate tolerance [34]. Changes in the NO-induced activation of soluble guanylyl cyclase and cyclic GMP accumulation in vascular smooth muscle cells have been described in genetic hypertension. For example, in the carotid artery from SHR basal cyclic GMP levels were significantly higher than those in WKY [35]whereas decreased basal and acetylcholine-stimulated cyclic GMP levels have been reported in the aorta from SHR [36]. These differences were however attributed to differences in endothelial NO formation between WKY and SHR, since removal of the endothelium or treatment with methylene blue reduced cyclic GMP accumulation. The present study is, to our knowledge, the first study to demonstrate the reduced expression of soluble guanylyl cyclase expression in native aortic smooth muscle cells from SHR which accounts for the observed attenuation of the dilator response to sodium nitroprusside. In addition, the reduction in smooth muscle cell responsiveness to NO donors, as a result of a deficiency in soluble guanylyl cyclase, is likely to account for the observed attenuation of the acetylcholine-induced relaxations in aged SHR. An elevated expression of soluble guanylyl cyclase in cells cultured from the aorta of SHR has been described [37]and may be related to the high passage number and/or the age of the rats used (3–4 months).

Taken together our results demonstrate that endothelial NOS III expression is differentially regulated in the heart and the aorta from 16 month old SHR. Moreover, although an elevated O2 production is apparent in the aortic endothelium from SHR a reduction in the expression of the soluble guanylyl cyclase in vascular smooth muscle cells appears to account for the observed vasodilator dysfunction.

Time for primary review 27 days.


    Acknowledgements
 
The expert technical assistance of Michaela Stächele, Isabel Winter and Andreas Schäfer is gratefully acknowledged. Anne Bouloumié is a recipient of a fellowship from Association Française pour la Recherche Thérapeutique. This study was supported in part by the Deutsche Forschungsgemeinschaft (Bu 436/6-1) and the Commission of European Communities (BMH4-CT96-0979).


    Notes
 
1 Present address: Klinikum Mannheim der Universität Heidelberg, Theodor-Kutzer-Ufer, D-68135 Mannheim, Germany. Back


    References
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 

  1. Busse R, Fleming I. Regulation and functional consequences of endothelial nitric oxide formation. Ann Med (1995) 27:331–340.[Web of Science][Medline]
  2. Dominiczak A.F, Bohr D.F. Nitric oxide and its putative role in hypertension. Hypertens (1995) 25:1202–1211.[Free Full Text]
  3. Rees D.D, Palmer R.M.J, Moncada S. Role of endothelium-derived nitric oxide in the regulation of blood pressure. Proc Natl Acad Sci USA (1989) 86:3375–3378.[Abstract/Free Full Text]
  4. Huang P.L, Huang Z, Mashimo H, Bloch K.D, Moskowitz M.A, Bevan J.A, Fishman M.C. Hypertension in mice lacking the gene for endothelial nitric oxide synthase. Nature (1995) 377:239–242.[CrossRef][Medline]
  5. Vanhoutte P.M, Boulanger C.M. Endothelium-dependent responses in hypertension. Hypertens Res (1995) 18:87–98.[Medline]
  6. Panza J.A, Quyyumi A.A, Brush J.E, Epstein S.E. Abnormal endothelium-dependent vascular relaxation in patients with essential hypertension. N Engl J Med (1990) 323:22–27.[Abstract]
  7. Lüscher T.F, Vanhoutte P.M. Endothelium-dependent contractions to acetylcholine in the aorta of the spontaneously hypertensive rat. Hypertens (1986) 8:344–348.[Abstract/Free Full Text]
  8. Lüscher T.F, Diederich D, Weber E, Vanhoutte P.M, Bühler F.R. Endothelium-dependent responses in carotid and renal arteries of normotensive and hypertensive rats. Hypertens (1988) 11:573–578.[Abstract/Free Full Text]
  9. Mantelli L, Amerini S, Ledda F. Roles of nitric oxide and endothelium-derived hyperpolarizing factor in vasorelaxant effect of acetylcholine as influenced by aging and hypertension. J Cardiovasc Pharmacol (1995) 25:595–602.[Web of Science][Medline]
  10. Tschudi M, Criscione L, Lüscher T.F. Effect of aging and hypertension on endothelial function of rat coronary arteries. J Hypertens (1991) 9:164–165.[CrossRef]
  11. Crabos M, Coste P, Paccalin M, Tariosse L, Daret D, Besse P, Bonoron-Adèle S. Reduced basal NO-mediated dilation and decreased endothelial NO synthase expression in coronary vessels of spontaneously hypertensive rats. J Mol Cell Cardiol (1997) 29:55–65.[CrossRef][Web of Science][Medline]
  12. Grunfeld S, Hamilton C.A, Mesaros S, McClain S.W, Dominiczak A.F, Bohr D.F, Malinski T. Role of superoxide in the depressed nitric oxide production by the endothelium of genetically hypertensive rats. Hypertens (1995) 26:854–857.[Abstract/Free Full Text]
  13. Rajagopalan S, Kurz S, Münzel T, Tarpey M, Freeman B.A, Griendling K.K, Harrison D.G. Angiotensin II-mediated hypertension in the rat increases vascular superoxide production via membrane NADH/NADPH oxidase activation. J Clin Invest (1996) 97:1916–1923.[Web of Science][Medline]
  14. Nava E, Noll G, Lüscher T.F. Increased activity of constitutive nitric oxide synthase in cardiac endothelium in spontaneous hypertension. Circulation (1995) 91:2310–2313.[Abstract/Free Full Text]
  15. Kelm M, Feelisch M, Krebber T, Deussen A, Motz W, Strauer B.E. Role of nitric oxide in the regulation of coronary vascular tone in hearts from hypertensive rats: maintenance of nitric oxide-forming capacity and increased basal production of nitric oxide. Hypertens (1995) 25:186–193.[Abstract/Free Full Text]
  16. Bouloumié A, Bauersachs J, Linz W, Schölkens BA, Wiemer G, Fleming I, Busse R. Endothelial dysfunction coincides with an enhanced NO synthase expression and superoxide anion production. Hypertension 1997;30:934–941.
  17. Piper HM, Spahr R, Mertens S, Krüzfeld A, Watanabe H. Microvascular endothelial cells from the heart. In: Piper HM, editor. Cell culture techniques in heart and vessel research. Heidelberg:Springer 1990:159–177.
  18. Chomczynski P, Sacchi N. Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem (1987) 162:156–159.[Web of Science][Medline]
  19. Bauersachs J, Hecker M, Busse R. Display of the characteristics of endothelium-derived hyperpolarizing factor by a cytochrome P450-derived arachidonic acid metabolite in the coronary microcirculation. Br J Pharmacol (1994) 113:1548–1553.[Web of Science][Medline]
  20. Marsden P.A, Schappert K.T, Chen H.S, Flowers M, Sundell C.L, Wilcox J.N, Lamas S, Michel T. Molecular cloning and characterization of human endothelial nitric oxide synthase. FEBS Lett (1992) 307:287–293.[CrossRef][Web of Science][Medline]
  21. Janssens S.P, Shimouchi A, Quertermous T, Bloch D.B, Bloch K.D. Cloning and expression of a cDNA encoding human endothelium-derived relaxing factor/nitric oxide synthase. J Biol Chem (1992) 267:14519–14522.[Abstract/Free Full Text]
  22. Tso J.Y, Sun X.H, Kao T.H, Reece K.S, Wu R. Isolation and characterization of rat and human glyceraldehyde-3-phosphate dehydrogenase cDNAs: genomic complexity and molecular evaluation of the gene. Nucleic Acids Res (1985) 13:2485–2502.[Abstract/Free Full Text]
  23. Fleming I, Fisslthaler B, Busse R. Calcium-signalling in endothelial cells involves activation of tyrosine kinases and leads to the activation of mitogen-activated protein kinases. Circ Res (1995) 76:522–529.[Abstract/Free Full Text]
  24. Hecker M, Preiss C, Schini-Kerth V.B, Busse R. Antioxidants differentially affect nuclear factor kappaB-mediated nitric oxide synthase expression in vascular smooth muscle cells. FEBS Lett (1996) 380:224–228.[CrossRef][Web of Science][Medline]
  25. Auch-Schwelk W, Katusic Z.S, Vanhoutte P.M. Thromboxane A2 receptor antagonists inhibit endothelium-dependent contraction. Hypertens (1990) 15:699–703.[Abstract/Free Full Text]
  26. Kato T, Iwama Y, Okamura K, Hashimoto H, Ito T, Satake T. Prostaglandin H2 may be the endothelium-derived contracting factor released by acetylcholine in the aorta of the rat. Hypertens (1990) 15:475–481.[Abstract/Free Full Text]
  27. Kelly R.A, Balligand J.-L, Smith T.W. Nitric oxide and cardiac function. Circ Res (1996) 79:363–380.[Free Full Text]
  28. Lüscher T.F, Romero J.C, Vanhoutte P.M. Bioassay of endothelium-derived vasoactive substances in the aorta of normotensive and spontaneously hypertensive rats. J Hypertens (1986) 4:S81–S83.
  29. Sawada Y, Sakamaki T, Nakamura T, Sato K, Ono Z, Murata K. Release of nitric oxide in response to acetylcholine is unaltered in spontaneously hypertensive rats. J Hypertens (1994) 12:745–750.[Web of Science][Medline]
  30. Nakazono K, Watanabe N, Matsuno K, Sasaki J, Sato T, Inoue M. Does superoxide underlie the pathogenesis of hypertension? Proc Natl Acad Sci USA (1991) 88:10045–10048.[Abstract/Free Full Text]
  31. Ito H, Torii M, Suzuki T. Decreased superoxide dismutase activity and increased superoxide anion production in cardiac hypertrophy of spontaneously hypertensive rats. Clin Exp Hypertens (1995) 17:803–816.[CrossRef][Web of Science][Medline]
  32. Sharma R.C, Crawford D.W, Kramsch D.M, Sevanian A, Jiao Q. Immunolocalization of native antioxidant scavenger enzymes in early hypertensive and atherosclerotic arteries: role of oxygen free radicals. Arterioscleros Thrombos (1992) 12:403–415.
  33. Papapetropoulos A, Abou-Mohamed G, Marczin N, Murad F, Caldwell R.W, Catravas J.D. Downregulation of nitrovasodilator-induced cyclic GMP accumulation in cells exposed to endotoxin or interleukin-1 b. Br J Pharmacol (1996) 118:1359–1366.[Web of Science][Medline]
  34. Papapetropoulos A, Go C, Murad F, Catravas J.D. Mechanisms of tolerance to sodium nitroprusside in rat cultured aortic smooth muscle cells. Br J Pharmacol (1996) 117:147–155.[Web of Science][Medline]
  35. Mourlon Legrand M.C, Benessiano J, Levy B.I. Endothelium. mechanical compliance, and cGMP content in the carotid artery from spontaneously hypertensive rats. J Cardiovasc Pharmacol (1993) 21:S26–S30.[CrossRef][Medline]
  36. Shirasaki Y, Kolm P, Nickols G.A, Lee T.J.F. Endothelial regulation of cyclic GMP and vascular responses in hypertension. J Pharmacol Exp Ther (1988) 245:53–58.[Abstract/Free Full Text]
  37. Papapetropoulos A, Marczin N, Snead M.D, Cheng C, Milici A, Catravas J.D. Smooth muscle cell responsiveness to nitrovasodilators in hypertensive and normotensive rats. Hypertens (1994) 23:476–484.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Cardiovasc ResHome page
K. Stangl and V. Stangl
The ubiquitin proteasome pathway and endothelial (dys)function
Cardiovasc Res, October 13, 2009; (2009) cvp315v2.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Meurer, S. Pioch, T. Pabst, N. Opitz, P. M. Schmidt, T. Beckhaus, K. Wagner, S. Matt, K. Gegenbauer, S. Geschka, et al.
Nitric Oxide-Independent Vasodilator Rescues Heme-Oxidized Soluble Guanylate Cyclase From Proteasomal Degradation
Circ. Res., July 2, 2009; 105(1): 33 - 41.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. A. Maron, Y.-Y. Zhang, D. E. Handy, A. Beuve, S.-S. Tang, J. Loscalzo, and J. A. Leopold
Aldosterone Increases Oxidant Stress to Impair Guanylyl Cyclase Activity by Cysteinyl Thiol Oxidation in Vascular Smooth Muscle Cells
J. Biol. Chem., March 20, 2009; 284(12): 7665 - 7672.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
R. T. Schermuly, J-P. Stasch, S. S. Pullamsetti, R. Middendorff, D. Muller, K-D. Schluter, A. Dingendorf, S. Hackemack, E. Kolosionek, C. Kaulen, et al.
Expression and function of soluble guanylate cyclase in pulmonary arterial hypertension
Eur. Respir. J., October 1, 2008; 32(4): 881 - 891.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. P. Kunert, M. R. Dwinell, I. Drenjancevic Peric, and J. H. Lombard
Sex-specific differences in chromosome-dependent regulation of vascular reactivity in female consomic rat strains from a SS x BN cross
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2008; 295(2): R516 - R527.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
T. Xia, C. Dimitropoulou, J. Zeng, G. N. Antonova, C. Snead, R. C. Venema, D. Fulton, S. Qian, C. Patterson, A. Papapetropoulos, et al.
Chaperone-dependent E3 ligase CHIP ubiquitinates and mediates proteasomal degradation of soluble guanylyl cyclase
Am J Physiol Heart Circ Physiol, November 1, 2007; 293(5): H3080 - H3087.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
A. Jacobson, C. Yan, Q. Gao, T. Rincon-Skinner, A. Rivera, J. Edwards, A. Huang, G. Kaley, and D. Sun
Aging enhances pressure-induced arterial superoxide formation
Am J Physiol Heart Circ Physiol, September 1, 2007; 293(3): H1344 - H1350.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
Y. Jiang and S. S Stojilkovic
Molecular cloning and characterization of {alpha}1-soluble guanylyl cyclase gene promoter in rat pituitary cells
J. Mol. Endocrinol., December 1, 2006; 37(3): 503 - 515.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
V. Franco and S. Oparil
Is There a New Treatment for Hypertensive Disease in the Horizon?: Role of Soluble Guanylate Cyclase
Hypertension, November 1, 2006; 48(5): 822 - 823.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Lehoux
Redox signalling in vascular responses to shear and stretch
Cardiovasc Res, July 15, 2006; 71(2): 269 - 279.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
R. Dumitrascu, N. Weissmann, H. A. Ghofrani, E. Dony, K. Beuerlein, H. Schmidt, J.-P. Stasch, M. J. Gnoth, W. Seeger, F. Grimminger, et al.
Activation of Soluble Guanylate Cyclase Reverses Experimental Pulmonary Hypertension and Vascular Remodeling
Circulation, January 17, 2006; 113(2): 286 - 295.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. S. Wolin
Loss of Vascular Regulation by Soluble Guanylate Cyclase Is Emerging as a Key Target of the Hypertensive Disease Process
Hypertension, June 1, 2005; 45(6): 1068 - 1069.
[Full Text] [PDF]


Home page
HypertensionHome page
S. Kloss, D. Rodenbach, R. Bordel, and A. Mulsch
Human-Antigen R (HuR) Expression in Hypertension: Downregulation of the mRNA Stabilizing Protein HuR in Genetic Hypertension
Hypertension, June 1, 2005; 45(6): 1200 - 1206.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
C. Zhang, T. W. Hein, W. Wang, M. W. Miller, T. W. Fossum, M. M. McDonald, J. D. Humphrey, and L. Kuo
Upregulation of Vascular Arginase in Hypertension Decreases Nitric Oxide-Mediated Dilation of Coronary Arterioles
Hypertension, December 1, 2004; 44(6): 935 - 943.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Meurer, S. Pioch, K. Wagner, W. Muller-Esterl, and S. Gross
AGAP1, a Novel Binding Partner of Nitric Oxide-sensitive Guanylyl Cyclase
J. Biol. Chem., November 19, 2004; 279(47): 49346 - 49354.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
D. A. Graham and J. W. E. Rush
Exercise training improves aortic endothelium-dependent vasorelaxation and determinants of nitric oxide bioavailability in spontaneously hypertensive rats
J Appl Physiol, June 1, 2004; 96(6): 2088 - 2096.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
A. Schafer, D. Fraccarollo, P. Tas, I. Schmidt, G. Ertl, and J. Bauersachs
Endothelial dysfunction in congestive heart failure: ACE inhibition vs. angiotensin II antagonism
Eur J Heart Fail, March 1, 2004; 6(2): 151 - 159.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
T. Munzel, R. Feil, A. Mulsch, S. M. Lohmann, F. Hofmann, and U. Walter
Physiology and Pathophysiology of Vascular Signaling Controlled by Cyclic Guanosine 3',5'-Cyclic Monophosphate-Dependent Protein Kinase
Circulation, November 4, 2003; 108(18): 2172 - 2183.
[Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. E. Safar and P. Laurent
Pulse pressure and arterial stiffness in rats: comparison with humans
Am J Physiol Heart Circ Physiol, October 1, 2003; 285(4): H1363 - H1369.
[Full Text] [PDF]


Home page
J Am Coll CardiolHome page
T. H. Schindler, E. U. Nitzsche, T. Munzel, M. Olschewski, I. Brink, M. Jeserich, M. Mix, P. T. Buser, M. Pfisterer, U. Solzbach, et al.
Coronary vasoregulation in patients with various risk factors in response to cold pressor testing: Contrasting myocardial blood flow responses to short- and long-term vitamin C administration
J. Am. Coll. Cardiol., September 3, 2003; 42(5): 814 - 822.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
F. W. Flitney and I. L Megson
Nitric Oxide and the Mechanism of Rat Vascular Smooth Muscle Photorelaxation
J. Physiol., August 1, 2003; 550(3): 819 - 828.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A. Friebe and D. Koesling
Regulation of Nitric Oxide-Sensitive Guanylyl Cyclase
Circ. Res., July 25, 2003; 93(2): 96 - 105.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. Schafer, D. Fraccarollo, S. K Hildemann, P. Tas, G. Ertl, and J. Bauersachs
Addition of the selective aldosterone receptor antagonist eplerenone to ACE inhibition in heart failure: effect on endothelial dysfunction
Cardiovasc Res, June 1, 2003; 58(3): 655 - 662.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. Ibrahim, J. K. Miyashiro, and B. C. Berk
Shear Stress Is Differentially Regulated Among Inbred Rat Strains
Circ. Res., May 16, 2003; 92(9): 1001 - 1009.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. Piech, C. Dessy, X. Havaux, O. Feron, and J.-L. Balligand
Differential regulation of nitric oxide synthases and their allosteric regulators in heart and vessels of hypertensive rats
Cardiovasc Res, February 1, 2003; 57(2): 456 - 467.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
V. Schachinger and A. M. Zeiher
Atherogenesis--recent insights into basic mechanisms and their clinical impact
Nephrol. Dial. Transplant., December 1, 2002; 17(12): 2055 - 2064.
[Full Text] [PDF]


Home page
J Am Coll CardiolHome page
J. Bauersachs, M. Heck, D. Fraccarollo, S. K. Hildemann, G. Ertl, M. Wehling, and M. Christ
Addition of spironolactone to angiotensin-converting enzyme inhibition in heart failure improves endothelial vasomotor dysfunction: Role of vascular superoxide anion formation and endothelial nitric oxide synthase expression
J. Am. Coll. Cardiol., January 16, 2002; 39(2): 351 - 358.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
M. Marques, I. Millas, A. Jimenez, E. Garcia-Colis, J. A. Rodriguez-Feo, S. Velasco, A. Barrientos, S. Casado, and A. Lopez-Farre
Alteration of the Soluble Guanylate Cyclase System in the Vascular Wall of Lead-Induced Hypertension in Rats
J. Am. Soc. Nephrol., December 1, 2001; 12(12): 2594 - 2600.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. Safar, P. Chamiot-Clerc, G. Dagher, and J. F. Renaud
Pulse Pressure, Endothelium Function, and Arterial Stiffness in Spontaneously Hypertensive Rats
Hypertension, December 1, 2001; 38(6): 1416 - 1421.
[Abstract] [Full Text] [PDF]


Home page
Ann. Thorac. Surg.Home page
G. Pompilio, G. Rossoni, F. Alamanni, P. Tartara, I. Barajon, C. Rumio, B. Manfredi, and P. Biglioli
Comparison of endothelium-dependent vasoactivity of internal mammary arteries from hypertensive, hypercholesterolemic, and diabetic patients
Ann. Thorac. Surg., October 1, 2001; 72(4): 1290 - 1297.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
P. Gilbert, J. Tremblay, and E. Thorin
Endothelium-Derived Endothelin-1 Reduces Cerebral Artery Sensitivity to Nitric Oxide by a Protein Kinase C-Independent Pathway
Stroke, October 1, 2001; 32(10): 2351 - 2355.
[Abstract] [Full Text] [PDF]


Home page
J Biomol ScreenHome page
B. Bader, E. Butt, A. Palmetshofer, U. Walter, T. Jarchau, and P. Drueckesl
A cGMP-Dependent Protein Kinase Assay for High Throughput Screening Based on Time-Resolved Fluorescence Resonance Energy Transfer
J Biomol Screen, August 1, 2001; 6(4): 255 - 264.
[Abstract] [PDF]


Home page
Cardiovasc ResHome page
J. Bauersachs, I. Fleming, D. Fraccarollo, R. Busse, and G. Ertl
Prevention of endothelial dysfunction in heart failure by vitamin E: Attenuation of vascular superoxide anion formation and increase in soluble guanylyl cyclase expression
Cardiovasc Res, August 1, 2001; 51(2): 344 - 350.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
P. Chamiot-Clerc, J. F. Renaud, and M. E. Safar
Pulse Pressure, Aortic Reactivity, and Endothelium Dysfunction in Old Hypertensive Rats
Hypertension, February 1, 2001; 37(2): 313 - 321.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
J. Bauersachs, D. Fraccarollo, P. Galuppo, J. Widder, and G. Ertl
Endothelin-receptor blockade improves endothelial vasomotor dysfunction in heart failure
Cardiovasc Res, July 1, 2000; 47(1): 142 - 149.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
T. J. Guzik, N. E. J. West, E. Black, D. McDonald, C. Ratnatunga, R. Pillai, and K. M. Channon
Vascular Superoxide Production by NAD(P)H Oxidase : Association With Endothelial Dysfunction and Clinical Risk Factors
Circ. Res., May 12, 2000; 86 (9): e85 - e90.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
G. Zalba, F. J. Beaumont, G. S. Jose, A. Fortuno, M. A. Fortuno, J. C. Etayo, and J. Diez
Vascular NADH/NADPH Oxidase Is Involved in Enhanced Superoxide Production in Spontaneously Hypertensive Rats
Hypertension, May 1, 2000; 35(5): 1055 - 1061.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
S. Klo{beta}, A. Bouloumie, and A. Mulsch
Aging and Chronic Hypertension Decrease Expression of Rat Aortic Soluble Guanylyl Cyclase
Hypertension, January 1, 2000; 35(1): 43 - 47.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. Busse and I. Fleming
A critical look at cardiovascular translational research
Am J Physiol Heart Circ Physiol, November 1, 1999; 277(5): H1655 - H1660.
[Full Text] [PDF]


Home page
Circ. Res.Home page
H. Ruetten, U. Zabel, W. Linz, and H. H. H. W. Schmidt
Downregulation of Soluble Guanylyl Cyclase in Young and Aging Spontaneously Hypertensive Rats
Circ. Res., September 17, 1999; 85(6): 534 - 541.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
W. Linz, P. Wohlfart, B. A Scholkens, T. Malinski, and G. Wiemer
Interactions among ACE, kinins and NO
Cardiovasc Res, August 15, 1999; 43(3): 549 - 561.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
W. J Paulus and A. M Shah
NO and cardiac diastolic function
Cardiovasc Res, August 15, 1999; 43(3): 595 - 606.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
G. Kojda and D. Harrison
Interactions between NO and reactive oxygen species: pathophysiological importance in atherosclerosis, hypertension, diabetes and heart failure
Cardiovasc Res, August 15, 1999; 43(3): 652 - 671.
[Full Text] [PDF]


Home page
CirculationHome page
J. Bauersachs, A. Bouloumie, D. Fraccarollo, K. Hu, R. Busse, and G. Ertl
Endothelial Dysfunction in Chronic Myocardial Infarction Despite Increased Vascular Endothelial Nitric Oxide Synthase and Soluble Guanylate Cyclase Expression : Role of Enhanced Vascular Superoxide Production
Circulation, July 20, 1999; 100(3): 292 - 298.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
S. Kerr, M. J. Brosnan, M. McIntyre, J. L. Reid, A. F. Dominiczak, and C. A. Hamilton
Superoxide Anion Production Is Increased in a Model of Genetic Hypertension : Role of the Endothelium
Hypertension, June 1, 1999; 33(6): 1353 - 1358.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
K. Kusterer, T. Pohl, H.-P. Fortmeyer, W. Marz, H. Scharnagl, A. Oldenburg, S. Angermuller, I. Fleming, K. H. Usadel, and R. Busse
Chronic selective hypertriglyceridemia impairs endothelium-dependent vasodilatation in rats
Cardiovasc Res, June 1, 1999; 42(3): 783 - 793.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
U. Laber, T. Kober, V. Schmitz, A. Schrammel, W. Meyer, B. Mayer, M. Weber, and G. Kojda
Effect of Hypercholesterolemia on Expression and Function of Vascular Soluble Guanylyl Cyclase
Circulation, February 19, 2002; 105(7): 855 - 860.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Bauersachs, J.
Right arrow Articles by Busse, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bauersachs, J.
Right arrow Articles by Busse, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?