© 1998 by European Society of Cardiology
Copyright © 1998, European Society of Cardiology
Expressional analysis of the cardiac Na–Ca exchanger in rat development and senescence
aICSM, National Heart and Lung Institute, Dovehouse Street, London SW3 6LY, UK
bDepartment of Anatomy and Embryology, University of Amsterdam, Amsterdam, Netherlands
cInstitute for Pathophysiology, Martin-Luther University, Halle, Germany
* Corresponding author. NIH/NIA/GRC/LCS, 4940 Eastern Avenue, Baltimore, MD 21224, USA. Tel. (+1-410) 558-8095; Fax (+1-410) 558-8150; E-mail: bohelerk@grc.nia.nih.gov
Received 22 July 1997; accepted 3 November 1997
| Abstract |
|---|
|
|
|---|
The cardiac Na–Ca exchanger (NCX) serves as the main calcium extrusion mechanism in heart muscle and is important in maintaining intracellular calcium homeostasis. The accumulations of NCX RNA and protein are known to be regulated in cardiac hypertrophy, by thyroid hormone and during postnatal development. In this study the temporal and spatial patterns of NCX mRNA and protein accumulations were examined, and nuclear run-on assays performed. NCX is highly expressed in late fetal and neonatal rat hearts, decreasing to adult levels by 20 days after birth for RNA (P<0.05, fetal and 1 neonatal day old (1 ND) versus 20 day old (20 ND)). Maximal protein expression is seen in 19 embryonic day (ED) old hearts, and reaches adult levels sometime after 20 neonatal days. (P<0.05, fetal versus adult). Spatially, NCX is homogenously expressed in early embryonic and fetal heart, followed by a decline after birth. The protein levels decline more slowly suggesting a long protein half-life. The lowest level of mRNA accumulation is seen in 6 and 18 month old animals (P<0.05 for all time points before 10 neonatal days). In the 24 month old senescent rat, NCX transcripts are increased by almost 50% above that seen at 6 and 18 months (P<0.05) but are not different from those at 15 neonatal days. Perinatal NCX expression is regulated transcriptionally: late fetal and neonatal hearts have high transcriptional activity but by 20 postnatal days, no detectable transcriptional activity can be demonstrated. Throughout development, at least five transcription start sites are used, and no significant difference in the 5' untranslated or 3' coding splice sites could be demonstrated, although several new cardiac splicing variants were identified. We also report the cloning of a 3.7 kb fragment containing the cardiac NCX1 promoter which is transcriptionally active in neonatal cardiomyocytes.
KEYWORDS Na–Ca exchanger; Heart development; Rat; RNA; Promoter; Splicing
| 1 Introduction |
|---|
|
|
|---|
Cardiac relaxation occurs when calcium is removed from the cytosol primarily through the actions of two proteins: the sarcoplasmic reticulum Ca-ATPase (SERCA) and the sarcolemmal Na–Ca exchanger (NCX). The exchanger serves as the main calcium extrusion mechanism and is important in maintaining intracellular calcium homeostasis [1]. The relative contribution of SR Ca-ATPase and exchanger to cytosolic calcium removal depends on the species, chamber, development stage and/or physiological state of the heart [2]. In the hypertrophied or fetal myocardium, the contribution of the exchanger to relaxation is known to be more important than its contribution in the young adult rat heart.
The exchanger uses the energy derived from the electrical potential and the concentration gradient of Na across the sarcolemma to function: for every three Na ions which enter the cell, one Ca ion is expelled (electrogenic transport) [1, 3]. The Na–Ca exchanger is encoded by three genes (NCX1, NCX2 and NCX3) [4–7]with a high degree of conservation at the nucleotide and protein levels between species, although it is the NCX1 gene which is primarily present in heart [8–15]. Hydropathy analysis shows that the protein generated from NCX1 derived transcripts has 11 membrane-spanning regions and, between the 5th and 6th regions, a large (519 residue) hydrophillic (cytoplasmic) loop domain has been proposed to contain sites involved in the regulation of exchanger activity, including those for Ca, Na and ATP [1, 14, 16]. Available evidence suggests that in heart the exchanger competes for Ca with the SR Ca-ATPase to bring about relaxation with about 10–30% of relaxation mediated by this route. This percentage varies with species and with developmental stage [2, 17–19]. Effectively, the exchanger provides a mechanism of extruding Ca which enters the cell via the sarcolemmal voltage-dependent Ca channel [20, 21]. At more positive membrane potentials, the exchanger contributes to the influx of Ca which may also bring about SR Ca release [22–24]. In heart, the NCX thus has two main roles: (1) control of the sarcoplasmic reticulum Ca content by regulating resting intracellular Ca levels; and (2) contribution to the entry calcium during the upstroke and plateau phases of the action potential [1].
NCX expression and activity with growth and cardiac hypertrophy have been reported altered depending on the experimental setting [25–27]. An increase in NCX mRNA expression in the myocardium of patients with dilated cardiomyopathy (DCM) (55% increase) or coronary artery disease (CAD) (41% increase), with a concurrent decrease in Ca-ATPase mRNA of 50% and 45%, respectively, has been demonstrated by Studer et al. [28]; however, Komuro et al. [14]were unable to demonstrate any change relative to controls in NCX mRNA expression in either patients with DCM or CAD. At the protein level, Studer et al. [28]showed an increase in NCX expression with a concomitant decrease in Ca-ATPase expression. These results suggest that increased exchanger expression compensates for a reduced SR Ca-ATPase expression and function during heart failure. Consistent with the Studer study are the data from both rat and cat that show an increase in NCX expression [29]in response to pressure overload. During development, Boerth et al. [30]show much higher expression (6–8-fold) of NCX mRNA and protein relative to adults in a few selected time points of embryonic and newborn (1 day postnatal) rat and rabbit hearts. The expression of exchanger mRNA peaks in both species near birth and declines postnatally, reciprocal to the mRNA/protein expression of the SR Ca-ATPase. These complementary temporal gradients in SERCA and NCX expression, as in failure, suggest a role for exchanger activity to compensate for lesser SR Ca-ATPase expression in the embryonic/early postnatal state of development [2, 31].
What controls NCX cardiac gene expression? Changes in NCX expression around birth might be affected by the increase in circulating thyroid hormone (TH) just before birth. In hypothyroid rats the decline in cardiac NCX mRNA after birth is attenuated in comparison to normal animals [32]. Magyar et al. [33]observed that when adult hypothyroid rats are treated with TH, there is a concomitant decrease in NCX protein level to 64% of that seen in controls. NCX expression thus may be at least partially under the control of TH, either directly or indirectly [34]and the regulation appears transcriptional. As NCX is also involved in diverse physiological processes in many different tissues [9, 12, 14], it might function and/or be regulated differentially in different tissues. For example, the cardiac NCX controls intracellular calcium homeostasis; whereas in kidney, it drives the reabsorption of calcium and is responsible for maintaining extracellular calcium homeostasis. Tissue-specific alternative splicing of the mRNA transcripts has been reported [5, 15, 35–37]and in the cytoplasmic loop, alternative splicing results in some structural diversity among NCX clones in different tissues [11, 36]. Functional comparisons between the cloned NCX cDNAs from heart and kidney, however, showed that the two molecules have essentially identical functional properties [38]. The mRNA variants of the 5'-untranslated region in rat and a very recent publication from Menicks group [39]suggest a tissue-restricted use of different promoter controlling elements, maybe comparable to the rodent proenkephalin genes, Duchenne muscular dystrophy gene, or the human lck-gene [40–42]. NCX transcription is driven by (at least) three different promoters that give rise to three major and perhaps two minor forms of NCX transcripts, each differing in their 5' untranslated regions [35]. Br2 transcripts are expressed in heart and brain, although only a shorter transcript has been described in heart. Br1 and Kc1 are not expressed in heart. Although the promoter regions for feline NCX have been reported in the literature [39], very little is currently known about what regulatory factors (cis and/or trans) might play a role in the control of the NCX transcriptional activity during development or during cardiac hypertrophy and failure or how tissue restricted promoters may regulate its expression.
Since cardiac hypertrophy and heart failure in rodent are known to involve re-expression of a number of gene products that are normally only seen during embryonic and fetal life, study of developmental aspects of gene expression provide essential evidence about potential regulatory mechanisms involved in cardiac hypertrophy and failure. The aim of this study was therefore to analyze the expression of this gene, the 5' and 3' splicing variants of the NCX1 gene products, and measure the transcriptional activity of the NCX1 gene during development. The results will then be compared with those reported here and by others in the senescent and pathophysiological myocardium.
| 2 Methods |
|---|
|
|
|---|
2.1 Animal models
Most of the studies were performed on Wistar rats (Charles Rivers, UK) except where noted in the text. For perinatal studies, timed pregnant rats were obtained and the fetuses taken from two to seven days before birth. Post-partum, neonatal rats were kept with their mothers until killed by decapitation at appropriate times after birth. Food and water were ad libitum. Five week old male Wistar rats were also obtained from Charles Rivers company where all visible thyroid-tissue had been removed surgically. The rats were then selected for (A) daily intraperitoneal injections with 0.1 mg/kg thyroxine or (B) daily intraperitoneal saline injections. Animal welfare was in accordance with regulations established by the Home Office, UK. Animal preparations used for the induction of cardiac hypertrophy and hyperthyroidism have been described elsewhere [43, 44].
For in situ hybridizations and immunostainings, rats were obtained from HSD Animal Farm, Zeist, The Netherlands. Embryos were obtained from pregnant decapitated rats after CO2 inhalation. Also obtained were 7 and 25 postnatal days rats. Food and water were ad libitum. Animal welfare was in accordance with institutional guidelines of the University of Amsterdam.
2.2 RNA
Total RNA was isolated from rat left ventricles or whole heart for perinatal developmental studies according to the methods of Chomczynski and Sacchi [45]. RNA quality was checked by electrophoresis and quantities were determined by absorbance at 260 and 280 nm in a cuvette with a 1 cm light path. Poly(A)+ RNA was isolated using the PolyATract IV system (Promega) and the integrity and quantity checked by Northern blots. Cardiac RNA obtained from Wistar rats for the study of senescence were also kindly provided by Dr. E. Lakatta.
For Northern blots, 100 ng of poly(A)+ RNA or 20 µg of total RNA were separated on a 1% denaturing formaldehyde gel and transferred to Hybond N+ (Amersham) in 10xSSC (sodium chloride, sodium citrate) overnight [46]. After fixing, the blot was prehybridized for 20 min in Express HybTM-solution (Clontech), hybridized for 1 h at 68°C with random labelled probe (pRCNCX10), sequentially washed to a final stringency of 0.1xSSC, 0.05% SDS at 50°C and exposed to film. NCX mRNA levels were determined by Northern blotting to ensure hybridization to a single band of appropriate molecular weight [46].
2.3 NCX clones
2.3.1 cDNA library screening
cDNA clones to rat NCX were isolated and characterized as previously described [47]. Briefly, about 5x106 phages of a rat cDNA library were plated, plaque lifts prepared and screened with a 32P-labelled cDNA probe generously provided by Thomas Eschenhagen (Hamburg). Following washes with 1xSSPE (180 mM NaCl, 10 mM sodium phosphate, and 1 mM EDTA), 0.1% sodium dodecyl sulfate (SDS) at 65°C, 12 plaque forming units (pfu) were identified and further analyzed. All of the clones turned out to be identical and were sequenced to completion by use of the Sequenase kit (Amersham, Little Chalfont, UK) and as primers oligonucleotides corresponding to the KS and SK sequences of pBluescript and internal sequences constructed for this purpose.
2.3.2 Genomic screening
After infection of LE392 cells, a rat genomic
Dash library (Stratagene) was plated at a density of 300 pfu/cm2 (total: 106 pfu). Double filter lifts (Hybond N+) were taken, denatured, neutralized and fixed according to standard procedures. The filters were prehybridized over night at 65°C in 5xSSPE, 0.5% SDS, 5xDenhardt's solution and 100 µg/ml denatured herrings sperm DNA. A random labelled probe (PstI/RsaI digestion of clone M16) was prepared using the Random Priming Kit (Amersham), added to a concentration of 7.5x106 counts/filter and hybridized for 24 h at 65°C. The filters were extensively washed in 3xSSPE, 0.1% SDS at RT and 2xSSPE, 0.1% SDS at 40°C and exposed to film for up to 2 days at –70°C. Only double positive signals were subjected to two additional rounds of screening, which resulted in isolated plaques for 5 positive clones. Phage DNA was prepared following a standard protocol [48].
Approximately 2 µg of phage were digested with EcoRI and shot-gun subcloned into EcoRI linearized and phosphatase treated pBluescript SK vector. Positive clones were identified by colony-lifts using end-labelled NCE57 (see below) as probe. DNA was prepared using kits from either Qiagen Ltd. (Maxipreps) or Promega (Wizard Minipreps) and sequenced. The resulting sequence was screened for transcription-factor consensus binding sequences using on-line MatInspector and TESS.
2.4 Western blots and immunostaining
Protein preparation and Western blots were performed essentially as previously described [28]. Briefly, 50–150 mg of frozen tissue was homogenized three times for 10 s in 7 volumes of lysis buffer (20 mM Hepes, 4 EGTA, 1 mM DTT, pH 7.5 containing freshly added 1 mM PMSF and 0.3 mM Leupeptin) using a Polytron (Kinematica, Luzern). The samples were mixed for 1 h at 4°C and subsequently centrifuged at 3°C for 1 h at 100 000xg in a Sorvall OTD Combi. The supernatant was removed and the samples redissolved in 7 volumes of lysis buffer and homogenized with a hand homogenizer. Aliquots were frozen at –80°C. To determine protein concentration the soluble and particulate fraction was solubilized and diluted 1:10 in 1% SDS. The BCA assay (Pierce) was performed in quadruplicate.
For Western blotting 100 µg of total protein, solubilized for 5 min at 95°C in one volume of loading buffer (5% SDS, 13.3% sucrose, 0.8 M DTT, 33 mM Tris-HCl, 0.005% bromophenol blue) was loaded per lane onto a 7.5%/4% SDS-PAGE gel. Proteins were transferred onto Hybond-C super for 2.5 h at 1.2 A in a 20% methanol containing standard-buffer. The filters were blocked for 2 h in 5% nonfat milk/TBS (20 mM Tris, 150 mM NaCl, pH 7.5), washed three times for 5 min in TBS and incubated with a 1:1000 dilution of the primary, polyclonal NCX
antibody (Swant, Switzerland) in 5% nonfat milk, TBS, 0.1% Tween 20 and 1% BSA for 90 min (TBS/milk). After three rinses and three 5 min washes in TBS, the horseradish-peroxidase coupled secondary antibody (donkey anti-rabbit, Amersham) was applied at a 1:15 000 dilution in TBS/milk for 60 min. Following extensive washes (three times 1 min and three times 10 min) in TBS, NCX was detected using ECL-reagent (Amersham) and exposed to ECL-film according to the manufacturer's instructions. To ensure protein loading, the filters were stained with amido black (0.05% in 45% methanol, 10% acetic acid) and scanned. The quantitation of the Western blots was carried out using the Image Analysis package (Alpha Innotech Corporation).
For immunohistochemistry the serial sections were prepared after deparaffination essentially as described by Wessels et al. [49–51]. Briefly, the sections were incubated for 30 min in H2O2 diluted to 3% (weight/vol) in PBS (pH 7.0) to block the endogenous peroxidase activity and subsequently in a buffer containing 10 mM Tris-HCl, 5 mM EDTA, 150 mM NaCl, 0.25% gelatin and 0.05% Tween-20 (final pH 8.0) to reduce background staining. Next, serial sections were incubated overnight alternately, with commercially obtained polyclonal antisera (
-antibody), against canine sarcolemmal Na+/Ca2+ exchanger (Swant, Switzerland) [52]. The antigene-antibody was visualized using the indirect unconjugated peroxidase-anti-peroxidase technique. Incubations were performed at room temperature as previously described [49]. Sections were studied with a light microscope, using bright-field illumination.
2.5 RNase protection assays (RPA)
Probe preparation: cRNA probes were synthesized in a reaction mix consisting of 40 mM Tris (pH 7.5), 6 mM MgCl2, 4 mM spermidine, 5 mM NaCl, 500 µM each of ATP, CTP, and GTP, 3.125 µM and 125 µM unlabelled UTP for pRCNCX10 and GAPDH, respectively, 1.85 MBq [
-32P]UTP, 37.5 mM DTT, 40 units of rRNasin (Promega), 0.5 to 1.0 µg of linearized plasmid and 40 units of RNA polymerase. cRNA probes were prepared using T7 RNA polymerase from the BamHI linearized plasmid, ClaI linearized clone M16 (5' specific NCX probe) and as control T7 from rat GAPDH by incubation at 37°C for 2 h. Reactions were stopped by addition of 2 units of RQ1 DNase and 40 units of rRNasin and incubation for a further 15 min. Bands were purified on a 7.5% denaturing polyacrylamide gel and eluted according to the instructions provided with the Ambion RPA II kit. When synthesized, the full-length probes were of 699 bp and 383 bp, respectively. The assays were performed on 5 µg of total RNA exactly as described by the manufacturer (Ambion, Inc) using 5x104 cpm NCX probe and (2–5)x104 GAPDH probe per reaction. For the 5' specific probe M16, the RPAs were performed with slight modifications. Hybridization was to approximately 100 ng of poly(A)+ RNA, 5 µg total heart RNA and 15 µg brain and kidney RNA using 105 cpm of probe. The RNA and probe were allowed to hybridize overnight, followed by RNase digestions in the presence of 1:100 dilution of the RNase A and RNase T1 mix provided in the RPAII kit, for 30 min. After separation on a 6% denaturing polyacrylamide gel, dried gels were exposed to X-ray film for between 2 h and 1 week or quantitated using a phosphoimager. For clone M16, RNase digested protected fragments were precipitated in ethanol after addition of carrier yeast tRNA, dissolved in loading buffer and separated on a 7.5% denaturing polyacrylamide gel.
2.6 Reverse transcriptase-polymerase chain reaction (RT-PCR)
2.6.1 Quantification of MHC iso-mRNAs: [53, 54]
Complimentary DNA was synthesized from 2 µg of total RNA using a first strand cDNA synthesis kit with oligo (dT)18 as primer, according to the manufacturer's instructions (Pharmacia). Once complete, 1 µl of the reverse transcriptase reaction was used for PCR amplification with forward (GAGGCGGTGCAGGAGTGTAG) and reverse (GTTGGCCTGTTCCTCCGCC) oligonucleotides identical to both
- and β-MHC, as previously described [53, 54]with slight modifications: 5 min 95°C, 2 cycles at 45 s 95°C, 30 s at 65°C and 35 s at 72°C and 18 cycles at 45 s 95°C, 30 s 63°C and 35 s 72°C. The amplified MHC iso-RNA's were distinguished by Tru 91 restriction enzyme digestion and the fragments separated on a 6% denaturing acrylamide gel, run for 4 h at 1700 V, dried and subjected to phosphoimaging, and ratios between complementary isoforms were calculated.
2.6.2 5' UTR RT-PCR (nested)
Complimentary DNA was synthesized as above from 1 µg of total RNA derived from different developmental stages of heart or other tissues. 2.5 µl of each transcription reaction and 20 pmol of each primer were used in a standard PCR-reaction (1 cycle at 5 min at 95°C, 45 s at 68°C, 30 s 72°C, 15 cycles at 45 s 95°C, 45 s at 65°C, 30 s at 72°C and 15 cycles at 45 s 95°C, 45 s 60°C and 30 s 72°C). The sense primer (NCE47: GCCAGCTATGCAGCCATGCTTAGAGAC) corresponds to –165 to –142 bp of the published Br2 clone [35]and the antisense primer (NCE56: CCACCAGAGTTACCAGACGAAATCCC) to +61 to +36 bp compared to the deduced start of translation. 1 µl of the first round of PCR served as template for the nested PCR using as sense primer either NCE21 (CAGCCATGCTTAGAGACC; –155 to –138 bp) or NCE20 (AGCCTTCGGAGCGAGTTGG; –91 to –73 bp), and as antisense primer NCE17 (GGTGGGAGACTTAGTCGA; +6 to +23 bp). The second round of PCR was performed under the following conditions: 1 cycle for 5 min at 95°C, 45 s at 56°C, 30 s 72°C, 10 cycles at 45 s 95°C, 45 s at 54°C, 30 s at 72°C and 15 cycles at 45 s 95°C, 45 s 52°C and 30 s 72°C. Products from both rounds of PCR were separated via a 2% agarose gel, resulting bands cut out, eluted via spincolumns (Sigma) and subcloned into T-tailed EcoRV digested pBluescript SK vector. Positive clones were identified by colony-lifts, grown and DNA prepared and sequenced. Cardiac clone M16, derived from the first round of PCR, displays a sequence so far only detected in brain (Br2), and was mainly used for subsequent experiments (RPA, Genoblot and genomic screening). Cardiac clone M'T', derived from the nested PCR, contained a 5' UTR exon of 130 bp not previously described.
2.6.3 Loop splicing RT-PCR
Complimentary DNA was synthesized as above from 0.5, 3 or 2 µg of total heart, brain and kidney RNA, respectively, or 50 ng of poly(A)+ RNA. The primers correspond to nucleotide 1651–1674 (NCE51: GGCATCATGGAGGTGAAGGTGCTG) and 2064–2041 (NCE55: GCTGGTCAGTGGCTGCTTGTCATC) according to the deduced translation start in the rat heart cDNA (accession No. X68191
[GenBank]
) and following amplification generating a 414 bp fragment from rat heart RNA. Three µl of the transcription reaction, 0.1 mM each dNTP and 15 pmol of each primer total, including 2 pmol of end-labelled NCE55, were used in a reaction volume of 50 µl. The PCR was carried out under stringent conditions: 5 min 95°C, 8 cycles at 45 s 95°C, 30 s at 70°C and 30 s at 72°C, 14 cycles at 45 s 95°C, 30 s 68°C and 30 s 72°C. Twenty µl of the PCR reaction were separated on an 8% denaturing acrylamide gel, the gel dried, exposed to film and phosphoimaged.
2.7 Genomic clonal analysis and DNA blotting
2.7.1 Genomic blot
A rat Genoblot was purchased from Clontech Inc. After 6 h of prehybridization at 65°C in 5xSSPE, 10xDenhardt's, 2% SDS and 40 µg/ml denatured herrings sperm DNA, 106 cpm/ml probe was added. The probe was generated from a M16/PstI/RsaI gel-purified (–165 to –51 bp and MCS) fragment. [
-32P]dATP was incorporated using the specific, end-labelled primers NCE47 and NCE57 (CCGTCTCTGTCTGCAGGGGCTGGATGAGAAAC, –41 to –73 bp) in a standard Klenow reaction. The Genoblot was hybridized for 24 h at 65°C and washed up to a stringency of 2x SSPE, 0.1% SDS at 50°C.
2.7.2 Phage Southern blots
Phage DNA was digested with EcoRI and SacI and fractioned over a 0.8% agarose gel. The gel was depurinated, denatured, neutralized and dry blotted onto two (mirror-image) nylon membranes. The membranes were then hybridized according to established protocols at 65°C with the M16/PstI/RsaI fragment or at 55°C using labelled NCE56, washed at moderate stringency and exposed to film.
2.8 Tissue processing
Fetal and neonatal tissue was fixed in a freshly prepared formaldehyde (FA) solution (4% paraformaldehyde (weight/volume) in sterile PBS, pH 7.4) for 4–5 h at 4°C. The tissues were left overnight in 70% alcohol at room temperature. The specimens were dehydrated in a graded alcohol series at room temperature and were left overnight in 1-butanol or chloroform. During fixation and dehydration tissue specimens were placed on a shaking platform. Subsequently the specimens were embedded in Paraplast Plus (Sherwood Medical Co., St. Louis, MO, USA), sectioned (7 µm thick) and mounted onto 3-aminopropyltriethoxysilane (Sigma)-coated slides for in situ hybridization.
2.9 In situ hybridization
Pretreatment, hybridization, processing of autoradiography of sections and preparation of probes were performed as described elsewhere [55, 56]. Per section, approximately 6 µl of hybridization mixture was applied. After hybridization the sections were rinsed with 1xSSC and washed twice at 52°C in 1xSSC/50% formamide for 10 min in RNaseA (10 mg/ml) for 30 min at 37°C, twice in 1xSSC for 10 min and finally in 0.1xSSC for 10 min. Hereafter, sections were dehydrated, air-dried, covered with photographic emulsion (Nuclear Research Emulsion G5, UK) and exposed for 7–10 days. After development for 4–8-min sections were slightly stained with nuclear fast red, dehydrated, mounted in Malinol and studied, using bright-field microscopy.
35S-labelled cRNA probes to SERCA2 and NCX mRNA were made by in vitro transcription as previously described [56], using pBS as a vector containing the 2200 bp EcoR1 cDNA fragment of the 3' end of rat cardiac SERCA2 generated from clone pRH39 [57]and the 500 bp EcoR1 cDNA fragment of rat brain NCX clone pC4E3 (generously provided by Dr. K.D. Philipson, Los Angeles, USA). To allow efficient hybridization, RNA transcripts longer than 200 nucleotides were subjected to alkaline hydrolysis to yield fragments with a mean size of approximately 100 nts [55]. Control reactions included hybridization with sense probes of each of the cRNAs tested and pretreatment with RNaseA (20 µg/ml, 30 min, 37°C).
2.10 Nuclear run-ons
2.10.1 Isolation of myocardial nuclei
Total cardiac nuclei were isolated using a modification of the techniques of Long et al. [58]. Briefly, ventricles obtained from 1 to 7 litters of embryonic rats or from 5 to 20 pups of postnatal animals were rinsed in ice-cold saline. All subsequent steps were performed at 4°C. After rinsing, approximately 0.75–1.0 g of tissue was homogenized in 12.5 ml of buffer NA (300 mM sucrose, 10 mM Tris (pH 8.0), 2.5 mM Mg acetate, 0.5 mM dithiothreitol (DTT), 0.25% Triton X-100, 0.1 mM phenylmethylsulfonyl fluoride (PMSF), 15 units/ml recombinant RNasin (Promega Biotec)) with 5–10 strokes of a Teflon homogenizer. The homogenate was filtered through a nylon membrane and diluted in 12.5 ml of buffer NB (2.4 M sucrose, 10 mM Tris (pH 8.0), 2.5 mM Mg acetate, 0.5 mM DTT 0.1% Triton X-100, 0.1 mM PMSF, 15 units/ml rRNasin). This mixture was layered onto a 15 ml cushion of buffer NB and centrifuged in a SW 28 Beckman rotor at 25 000 rpm for 1 h at 4°C. After centrifugation, all but 2.5 ml of the supernatant was removed, to which was added 20 ml NA without Triton X-100. After mixing, this was centrifuged at 2000xg for 20 min, the supernatant discarded and the resulting pellet resuspended in 1.5 ml of NA buffer (without Triton X-100), a fraction of which was analyzed to determine the number of nuclei isolated [59]. The remainder of the nuclei/Buffer NA was centrifuged at 5000 rpm in an Eppendorf microcentrifuge for 5 min, the supernatant discarded, the pellet resuspended in Keller storage buffer [59], frozen in liquid nitrogen and stored at –80°C.
2.10.2 In vitro transcription
Nuclear transcription assays and hybridizations were performed with minor modifications as previously described [59]Briefly, isolated nuclei (5x106 to 1x107) were added to a mix containing 40 mM Tris-HCl (pH 8.3), 150 mM NH4Cl, 7.5 mM MgCl2, 0.625 mM ATP, 0.313 mM each of GTP and CTP, and 0.5 mCi [32P]UTP (800 Ci/mmol, Du Pont) and 1200 units/ml recombinant RNasin (rRNasin) (Promega). Reactions were incubated at 27°C for 20 min. At times 0, 5 min, 10 min and 20 min, the reaction was mixed by gentle trituration and 2 µl taken for measurement of radionucleotide incorporation by DE-81 filter washes. At the end of the 20-min incubation period, the reaction was stopped by addition of 75 units RQ1 DNase (Promega) and 40 units of rRNasin by incubation at 27°C for 15 min. The reaction was then centrifuged for 2 min at 5000 rpm in an Eppendorf microcentrifuge, the supernatant discarded and the pellet resuspended in 500 µl of guanidinium thiocyanate denaturing solution (GuSCN) (4 M guanidinium thiocyanate, 25 mM Na citrate, pH 7.0, 0.5% N-lauroylsarcosine, 0.1 M β-mercaptoethanol). To this was added 50 µl 2 M Na acetate, 500 µl of water saturated phenol, and 100 µl chloroform/isoamyl alcohol (49:1). The tube was vortexed after each addition, left on ice for 20 min, and centrifuged at 12 000 rpm for 20 min at room temperature. The aqueous phase was precipitated with an equal volume of isopropanol, centrifuged and the resulting pellet washed with 70% ethanol. Subsequently the pellet was resuspended in 100 µl of GuSCN solution, re-precipitated with an equal volume of isopropanol overnight, centrifuged as above, and the pellet resuspended in 100 µl of TE (10 mM Tris, 1 mM EDTA (pH 8.0)).
A Bio-Dot SF (Bio-Rad Laboratories) apparatus was used to prepare the slot blots containing the denatured plasmid pRCNCX8/10, pFIN (
-cardiac actin specific plasmid) [59], pGAPDH and as a negative control the plasmid pBluescript (Stratagene). Five micrograms of each plasmid were made up to a final volume of 50 µl with water and 3 µl of 5 M NaOH added. This was incubated at 95°C for 10 min and allowed to cool for 5 min. Fifty µl of 4 M ammonium acetate was added to the mix, vortexed and 50 µl added to each slot of hybond N+ nylon membranes (Amersham). Once added, the slot was rinsed 2 times with 50 µl of 1 M ammonium acetate and then rinsed with 2xSSC. The membrane was dried and UV fixed with a Stratalinker (Stratagene).
Probe annealing to the nylon membranes containing specific sequences for NCX was performed by addition of 5x105 cpm/ml labelled transcripts to 10 ml of a pre-hybridization solution containing 50% deionized formamide, 0.1% SDS, 5xSSC, 10 mM EDTA, 10 mM Tris-HCl (pH 7.5), 2.5xDenhardt's solution, 40 mg/ml herring sperm DNA (Promega), 40 ng/ml polyA (Pharmacia) and 20 ng/ml polyG (Pharmacia) at 55°C for >40 h. Membrane washes were for 3 h as previously described with the exception that the RNase wash was supplemented with 1.5 µl RNase T 1(100 Units/µl, Boehringer) in addition to the 10 µl of RNase A per 200 ml wash solution [59, 60]. Hybridization efficiencies were as previously described [60]and found to be comparable to that reported for other cDNA probes.
2.11 Statistical analysis
All data were expressed as means±S.E.M. In the statistical analyses, the data groups were compared using either a two-way analysis of variance or an unpaired Student's t-test for single comparisons with the control. Significance was taken at P<0.05.
| 3 Results |
|---|
|
|
|---|
3.1 RNA abundance in pathophysiological hearts
NCX transcripts have been shown to have an altered abundance in cardiac hypertrophy and in hypothyroid animals. To ensure that the RNase Protection Assays examining NCX transcripts and normalized to GAPDH transcripts gave similar results to those previously published, labelled cRNA probes were hybridized to 5 µg of total cardiac RNA isolated from rats with aortic constriction or which were hypothyroid. In rats subjected to an ascending aortic constriction and with a cardiac hypertrophy of between 40 and 80%, a 100% increase in NCX transcripts could be demonstrated 3 weeks after aortic constriction (Fig. 1A, P<0.05), similar to that reported by others [28, 29]. Two groups of hypothyroid rats were also studied. The first group had severe hypothyroidism characterized by a pure β-MHC mRNA expression in heart and the second had mild hypothyroidism having both β- and
-MHC gene expression (data not shown). In the group of severely hypothyroid Sprague–Dawley rats, NCX expression was elevated relative to age matched controls by more than 2-fold (P<0.05) (Fig. 1B). In mildly hypothyroid Wistar rats treated with thyroxine, no significant change in NCX expression could be seen during the first 4 days following thyroxine injection but after seven days of thyroxine injection a decrease in NCX transcripts of almost 30% (Table 1) was seen (P<0.05, ANOVA). In the mildly hypothyroid controls, β-MHC mRNA expression was elevated relative to euthyroid controls and
-MHC transcripts remained in abundance. The expression of β-MHC was rapidly reduced following thyroxine injections. These results demonstrate that thyroxine injections (0.1 mg/kg) returned MHC gene expression towards that seen in euthyroid animals and could modify the abundance of NCX transcripts. The effects on NCX abundance, however, seem to be slower indicating a latent or a potentially indirect effect of thyroid hormone on NCX gene expression. As these results are consistent with those previously published [61, 62], we conclude that the RPA assay system is appropriate for measuring changes in NCX expression with development and aging, and that NCX mRNA expression can be modified by pressure overload or by thyroid hormone status.
|
|
3.2 Analysis of NCX expression in development and with senescence
3.2.1 RNA transcripts
To have a more complete profile of NCX RNA expression with development, we investigated the perinatal expression of cardiac NCX mRNA from 15 ED onwards, the results of which are shown in Fig. 2. In the late fetal rat myocardium, NCX mRNA is always expressed at levels >2-fold above those seen in 13 week old adults (P<0.05, ANOVA). Maximal expression occurs at 18 embryonic days (4.6-fold above adult levels). No statistically significant difference could be demonstrated between any of the fetal time points examined and the 1 day old neonates. After birth NCX expression decreases rapidly, and by 20 ND there is no statistically significant difference in the presence of this RNA with that of 13 week old adult.
|
To study the effects of aging, NCX mRNA expression was also examined in 2, 6, 18 and 24 month old rats (Fig. 3). Between 2 and 6 or 2 and 18 months, a 20% decrease in NCX expression can be demonstrated (P>0.05). In fact the lowest levels of NCX RNA were seen in these two groups. At 24 months of age, NCX expression increases by almost 50% above that seen at 6 or 18 months (P<0.05 for both age groups, ANOVA) and is fully 20% greater than that seen at 2 months of age (P>0.05). When compared with the perinatal period at 20 ED or 15 ND, NCX expression is significantly reduced in 2, 6 and 18 month old animals but is not different from that seen at 24 months of age. These data demonstrate an increased abundance of NCX transcripts with senescence.
|
To examine the spatial distribution of NCX transcripts with development, in situ hybridizations were performed on serial sections of samples prepared from embryonic, fetal and postnatal rats (Fig. 4). As negative controls, sections were RNase treated (Fig. 4). Specific NCX expression was seen from the 10 embryonic day (ED) looping heart stage onward. Hybridization was almost homogenous throughout the heart in all stages studied. In the post natal rat heart, NCX transcripts are still detectable at 7 days after birth, but by 25 neonatal days, virtually no expression is detectable in the myocardium. In contrast, SERCA2a shows a gradient of expression from 10 EDs, being higher in the inflow tract and atrial regions that persists even into adult myocardium (data not shown). The signal intensity for SERCA2 transcripts increases in late fetal and in neonatal rat hearts, in contrast to that seen for NCX. The distinct SERCA2 expression as compared to the NCX expression underscores the specificity of the hybridization. RNase treatment resulted in the disappearance of the hybridization signal.
|
3.2.2 Protein
Western blots were performed to examine the protein abundance in late fetal and postnatal rat hearts. The antibody
was used to examine membrane preparations of cardiac tissue isolated from day 17 embryonic to 18 week old adults. As can be seen in Fig. 5A and Fig. 5B, exchanger protein is most prominent at 19 ED. Postnatally, the abundance decreases to adult levels sometime between 3 and 18 weeks of age. Adult myocardium contains 6.5-fold less exchanger than late embryonic heart (P<0.05). The pattern of expression is very reminiscent to that seen for RNA, suggesting that the regulation of Na–Ca exchanger protein abundance is pre-translational.
|
To examine the spatial distribution of NCX proteins with development, immunostaining of cardiac tissue sections were performed. As with the in situ hybridizations, embryonic, fetal and postnatal hearts were examined. As shown in Fig. 6, each of the sections showed a homogenously positive signal. No compartmentalized loss of protein was detected by this method in either fetal or adult atria or ventricles. In the absence of primary antibody, no signal could be detected. Unlike the loss of RNA signal in 25 day old rats, the protein is still strongly positive, suggesting that the protein has a longer half-life than that of the RNA. These data are in agreement with those found by Western analyses.
|
3.3 Transcriptional regulation
The RNA and protein results presented above indicate a pretranslational level of control for NCX1 gene products. Nuclear run-on assays were therefore used to distinguish between transcriptional or post-transcriptional mechanisms (nuclear processing, export from the nucleus, or half-life in the cytoplasm). The radioactive incorporation into total neonascent RNA transcripts did not differ between any of the time points, although a downward trend (P>0.05) in the overall incorporation occurred between 1 and 20 NDs (data not shown). The results of one set of nuclear run-on experiments are shown in Fig. 7. In late fetal hearts the incorporation into NCX transcripts as expressed in parts per million (ppm) was, in general, lower than that seen in the 1 ND rat heart, where the highest incorporation was seen. At 5 ND, one sample had a very high level of expression comparable to that seen in the 1 ND animals, but the other samples had almost no detectable activity. By 20 ND, neo-nascent transcripts for NCX could not be detected in any of the run-on assays, indicating a strong decrease in its transcriptional activity in the postnatal period (P<0.05 compared to all other time points measured). By comparison, both cardiac
-actin and GAPDH were actively transcribed at each time point examined, including at 20 neonatal days. These data conclusively show that NCX transcription decreases after birth. No significant difference in the transcriptional activity of cardiac
-actin could be demonstrated between any of the time points examined (Table 2); however, the level of GAPDH transcription found the post-partum rat heart was less than that measured in the fetal rat heart.
|
|
3.4 Transcription start sites
NCX has been shown to use different, tissue specific 5' untranslated exons, leading to the hypothesis that multiple, tissue specific promoters may exist. We wished to examine the possibility that these different mRNA variants and recently discovered splice sites might be regulated during development. Subcloning and sequencing of a rare cardiac RT-PCR product (M16, –165 to +61) revealed that the brain-specific Br2 exon is also transcribed in heart. Using this PCR amplified product (M16), further RPA analyses were performed. After hybridization, at least five transcription start sites were seen in heart tissue. Four predominant fragments were seen with sizes of 180, 175, 171 and 162 bases (Fig. 8). The major transcription site corresponded to the 162 base fragment (–101 bases relative to translation start site) and to a somewhat lesser extent the 171 base fragment (–110 bp). These sites were used 56–63% and 18–20% of the time, respectively. The two other minor bands were used to a lesser extent, but never more than 6% of the time. Each of the four bands were detected in ventricle and atria, and there was no apparent transition in the relative abundance of the sites used to initiate transcription during the course of development. A fifth protected fragment was also identified that had a length of 226 nucleotides (–165 bp), but was probably longer and was limited by the length of the M16 probe. This potential upstream start site of transcription had not been reported previously in the heart and corresponded to a mRNA variant that is present in brain (–178 bp). This transcript was expressed at all time points examined. It was, however, slightly more abundant in the adult myocardium (1.6–1.8% in embryonic heart versus 3.0–3.8% in adult), suggesting that use of this transcription start site was developmentally regulated. These data were further confirmed by primer extension analyses and sequencing of the fragment as well as 5' RACE (data not shown).
|
3.5 Splicing at the 5' end and at the carboxy-terminus of the loop with development
We have detected the presence of an alternatively spliced mRNA variant in the 5' untranslated region of cardiac NCX transcripts. A 92 base pair protected fragment in the RPA, which is present in heart in addition to brain and kidney, suggested the existence of at least one 5' alternatively spliced cardiac product. This variant arises from a novel 130 bp 5' untranslated exon (Fig. 8), which is located between the first coding exon and the upstream Br2 exon (clone M'T'). The intron/exon boundary of this spliced fragment is located correctly at position –31. The usage of this site (approximately 10%) was detected in fetal and adult heart, but no developmental regulation could be demonstrated.
The carboxy-terminus of the cytosolic loop has been reported to have tissue restricted patterns of splicing. This region is of particular interest since it occurs in the coding region of the mRNA. We therefore examined this region for any developmental changes in the usage of the various exons. The major known cardiac PCR product should have a length of 414 nucleotides according to the rat cardiac cDNA (accession No. X68191 [GenBank] ), or 411 bases according to Lee et al. [35], the latter size corresponding to our finding. Although only two cardiac splice variants had been previously identified in heart [35, 37], we report the existence of at least six differentially spliced isoforms in rat heart. The results are shown in Fig. 9 and Table 3. The largest isoform generated a band of 411 (414) bp which accounted for about 45 to 65% of the transcripts. From sequence analysis, two new splicing patterns using known splicing cassettes were identified (Table 3), and three others have yet to be sequenced. At least one of these variants may be expressed in brain, suggesting that their origins may be within the cells innervating the heart. With development, no change in the overall expression pattern of these transcripts could be detected.
|
|
3.6 Genomic clones
Since NCX expression is transcriptionally regulated during the perinatal period, isolation of the cardiac-restricted promoter elements was essential. The screening of the rat genomic
Dash library resulted in five positive clones. Southern blotting and subsequent hybridization of the extracted phage DNA revealed four overlapping and two identical clones, ranging in size from 9 to 18 kb. All phages contain a 3.7 kb EcoRI fragment or a 6.2 kb SacI fragment that strongly hybridized to the 5' end of clone M16 and oligonuceotide NCE57 but did not show a positive signal with any of the probes complimentary to the first coding exon or the 5' untranslated kidney exon (Kc1). Hybridization of the rat genoblot with the very 5' M16/PstI/RsaI fragment resulted in positive bands at 3.7 kb for EcoRI, 2.7 kb for PstI and 3.4 kb for BglII (data not shown). These clones are very similar to those recently described by J. Lyttons lab [63]. Subcloning of the phage EcoRI digest has allowed us to sequence and analyze this NCX promoter region (Fig. 10). As can be seen in this figure, we have identified one consensus thyroid hormone responsive elements half site and a number of GATA consensus sequences. Three GATA sequences are located in the proximal promoter. Four additional GATA sites are of further interest because of their close proximity to NKX2.5 binding sites (GATA: –1966, –1985, –2287, –2366; NKX2.5: –1985, –1992, –2061, –2349, –2358). In preliminary experiments, a 2.8 kb PstI fragment has also been cloned into pGL3 Basic vector (Promega) and when transfected into cardiomyocytes shows a 7-fold increase in luciferase activity over controls. This promoter is therefore sufficient for driving cardiac transcription in vitro.
|
| 4 Discussion |
|---|
|
|
|---|
We have examined rat cardiac Na–Ca exchanger mRNA and protein expression, both temporally and spatially during fetal and neonatal cardiac development. The exchanger is already abundant in the looping embryonic heart, throughout late embryonic and fetal cardiac development and at birth; it then rapidly declines in the postnatal myocardium. RNA abundance increases again in senescence. Developmentally, its expression appears to be regulated transcriptionally (nuclear run-on assays); however, the half-life of the protein appears to be much longer than that for the message, accounting for the continued immunostaining of NCX in 25 day old neonates when neither transcription nor abundant levels of message can be measured.
We have employed the techniques of run-on assays using cardiac nuclei prepared from the same litters as those used in the perinatal study of NCX mRNA expression; however, due to the difficulty of these experiments, fewer time points were analyzed. During the late fetal and early postnatal period, no significant difference in the transcriptional activity of the NCX gene could be detected, but by 20 ND, no transcriptional activity could be detected. These results are very similar to the pattern of expression seen for NCX mRNA accumulation: as the transcription decreases, NCX transcripts decrease in abundance albeit more slowly; however, in 3 month old rat hearts, NCX transcripts are detectable whereas no transcription from the gene can be demonstrated at 20 neonatal days. The apparent difference in the results are probably due to the sensitivity of the two methods, where RPA is a liquid based hybridization technique versus the less efficient membrane hybridization system employed for the run-on assays. This finding is supported by data from in situ hybridizations where the transcripts for NCX are easily detectable in sections of fetal and early neonatal rat hearts, but which are almost undetectable in the 25 ND rat hearts. As such, the measured decrease in transcriptional activity appears to be predictive of a subsequent decrease in mRNA expression. Alternatively, the results could be interpreted to mean that in the late perinatal period when the transcriptional activity is very low, the maintenance of this transcript's accumulation might be due to post-transcriptional regulatory mechanisms, perhaps affecting the half-life of the mRNA. We can not, however, prove this possibility since we have not actually measured the half-life of this transcript in vivo. We can, however, conclude unequivocally that NCX transcriptional activity decreases after birth accounting for some of the altered abundance seen perinatally.
Changes in SR Ca-ATPase and Na–Ca exchanger protein abundance provide a molecular basis for why adult rat ventricle is more SR reliant than neonatal rat ventricle and why atria are generally more dependent on SR Ca release than ventricle [2]. In the fetal myocardium, NCX protein abundance is 6.5-fold greater than that in the adult myocardium, and the exchanger is evenly distributed throughout the embryonic and early fetal heart, unlike the SR Ca-ATPase which is more abundant in atria than ventricle [56, 64]. After birth the decline in exchanger protein is paralleled by an increase in SERCA2 expression throughout the heart [31]. The contribution of the exchanger in determining relaxation rate correspondingly diminishes as the SR Ca-ATPase becomes more abundant [2, 18]. Given the importance of the exchanger in maintaining intracellular calcium homeostasis, these results also predict that when Na–Ca exchanger is abundant relative to the amount of SR Ca-ATPase, extracellular calcium should play a relatively more important role in initiating myocardial contraction. In the embryonic heart, for example, initiation of contraction should be less dependent upon calcium-induced calcium release from SR stores. A greater proportion of the calcium should enter across the sarcolemmal membrane. In support of this are preliminary experiments from an in vitro model of cardiocyte differentiation from embryonic stem and embryonic carcinoma cells. In immature cardiomyocytes isolated from this system, excitation-contraction coupling does in fact appear to be much less SR dependent than those from adult cells (unpublished).
Transcription of the cardiac NCX gene starts from at least 5 different points spaced over about 80 nucleotides. The structure of the cardiac NCX promoter may explain the variety of start sites of transcription seen by 5' RPA. No consensus TATA or CAAT box have been found in the proximal promoter. The major transcription start site has the consensus sequence of an initiator element (Py-Py-A-N-T/A-Py-Py) and the two adjacent transcription sites resemble this consensus sequence very closely. In general, the regulation of the use of these start sites remains unclear, however, a number of potential cis-regulatory elements have been identified, including binding sites for GATA, NKX2.5, a TRE half-site (–2203), and a SRE (–102) that may play an important role in the transcriptional regulation of this gene. At least 13 GATA consensus sequences (G/T-GATA-A/G) can be found in the –2800 bp upstream region, three of which are located in the –200 bp proximal promoter region. Members of the GATA family of transcription factors have already been shown to play an important role in cardiac development. GATA4 is expressed solely in cardiac muscle and some endodermally-derived tissues. Although only seen in the most caudal part of the heart at first, GATA4 expression eventually involves the whole heart tube. Since GATA4 regulates the expression of other cardiac genes, including
-MHC and Troponin C [65], the presence of GATA sequences and their close proximity to NKX2.5 consensus elements implies an involvement of these transcription factors in the regulation of cardiac isoform(s) of NCX1.
Potential splicing variants in the 5' untranslated region and the cytosolic loop with development were also examined [63, 66]. No major changes in the ratio of the different transcripts were found. We do, however, report the sequence of a previously unreported 5' splice variant in rat heart as well as the existence of at least six different isoforms in the cytosolic loop. The migration of these loop PCR products as well as the use of the very 5' brain transcription start site in heart suggests that, at least between brain and heart, there is not an exclusive tissue-restricted expression of different isoforms, but a mixture of isoforms which are preferentially expressed in particular tissues. This may help to explain some of the different functions the exchanger fulfills in any one particular tissue (like extrusion and reabsorption) [15, 35–37]. Alternatively, some of the variants may arise from nerve tissues within the myocardium.
Although very few specific changes were seen in the transcription start sites or splicing with development and aging, certain aspects of NCX expression are noteworthy. First with advanced age, the abundance of NCX transcripts increase. This result is in disagreement with those published by Vetter et al. [31]and Assayag et al. [67], who reported finding no significant increase in NCX RNA expression in 24 month old versus 4 month old rats. We explain this discrepancy based on their use of a much less sensitive dot blot assay, and a difference in time points examined. We found a significant increase at 24 months only when compared to 6 and 18 month old animals, not to animals of 2 or 3 months of age. What could account for the increase? With aging, a number of genes have been shown to have altered expression including depressed expression of
-MHC and SERCA2 and an increased expression of β-MHC. Each of these genes is known to have thryoid hormone responsive elements, acting either positively or negatively, respectively. Circulating thyroid hormone is also known to be greatest at or around birth, and to decrease with age. Since hypothyroidism leads to increased NCX transcript abundance, it is possible that the circulating levels of thyroid hormone may be involved in this process.
Finally, our results predict the following scenarios. First, exchanger expression will be regulated primarily through transcriptional mechanisms, perhaps through involvement of thyroid hormone, and other trans-activating factors such as GATA4 and/or NKX2.5. We have not yet identified any known hypertrophic responsive elements, such as those for TEF-1 binding [68, 69]in the rat NCX1 cardiac-restricted promoter, but exhaustive promoter studies will be necessary to elucidate this point. Second, there are no substantial changes in the start sites of transcription nor are there any major changes in the splicing pattern of NCX transcripts throughout development. This is an important point, for if gene transfer to the diseased myocardium is to become reality, it is important to know in advance which isoforms should be introduced into the myocardium. Finally, and perhaps, most importantly, we have now identified a potential cardiac-restricted promoter that may also be responsive to stimuli for cardiac hypertrophy. As in the cases of atrial natriuretic factor, β-myosin heavy chain and myosin light chain 2 V promoter studies, this promoter should represent a fruitful avenue of research that will further our understanding of the underlying mechanisms responsible for cardiac hypertrophy. As we understand more about the molecular aspects that underlie NCX expression in the myocardium, it is hoped that this information will help us to develop new approaches towards the treatment of heart failure.
Time for primary review 31 days.
| Acknowledgements |
|---|
This study was supported by British Heart Foundation Project Grants (PG/93148, PG/96155) to Dr. K.R. Boheler, BMFT grant (01ZZ9105-1.23) and by the Department of Cardiothoracic Surgery, ICSM. The authors would also like to thank Dr. Hend Farza for valuable discussions and help in the data analysis, Gerry T.M. Wagenaar and Marry W.M. Markman for in situ hybridizations and photographic help, Antoine Ribadeau-Dumas for β-imager quantitations, Drs. Hal Spurgeon and Dylan G. Wynne for help in preparing figures, and to Drs. Kit Wong and Edward G. Lakatta for furnishing RNA samples.
| References |
|---|
|
|
|---|
- Schulze D, Kofuji P, Hadley R, Kirby M.S, Kieval R.S, Doering A, Niggli E, Lederer W.J. Sodium/calcium exchanger in heart muscle: molecular biology, cellular function, and its special role in excitation-contraction coupling. Cardiovasc. Res. (1993) 27:1726–1734.
[Free Full Text] - Bers D. Excitation-contraction coupling and cardiac contractile force. Boston: Kluwer Academic Publishers, 1991.
- Reeves J.P. Molecular aspects of sodium–calcium exchange. Arch. Biochem. Biophys. (1992) 292:329–334.[CrossRef][Web of Science][Medline]
- Wynne DG, Koban MU, Boheler KR. Molecular biology of relaxation. In: Yacoub M, Pepper J, editors. Annual of Cardiac Surgery. London: Current Science Ltd. 1995:29–37.
- Nicoll D.A, Longoni S, Philipson K.D. Molecular cloning and functional expression of the cardiac sarcolemmal Na–Ca exchanger. Science (1990) 250:562–565.
[Abstract/Free Full Text] - Li Z, Matsuoka S, Hryshko L.V, Nicoll D.A, Bersohn M.M, Burke E.P, Lifton R.P, Philipson K.D. Cloning of the NCX2 isoform of the plasma membrane Na+–Ca2+ exchanger. J. Biol. Chem. (1994) 269:17434–17439.
[Abstract/Free Full Text] - Nicholl D.A, Quednau F.D, Qui Z, Xia Y, Lusis A.J, Philipson K.D. Cloning of a third mammalian Na–Ca exchanger, NCX3. J. Biol. Chem. (1996) 271(40):24914–24921.
[Abstract/Free Full Text] - Aceto J.F, Condrescu M, Kroupis C, Nelson H, Nelson N, Nicoll D, Philipson K.D, Reeves J.P. Cloning and expression of the bovine cardiac sodium–calcium exchanger. Arch. Biochem. Biophys. (1992) 298:553–560.[CrossRef][Web of Science][Medline]
- Kofuji P, Hadley R.W, Kieval R.S, Lederer W.J, Schulze D.H. Expression of the Na–Ca exchanger in diverse tissues: a study using the cloned human cardiac Na–Ca exchanger. Am. J. Physiol. (1992) 263:C1241–C1249.[Web of Science][Medline]
- Reilly R.F, Shugrue C.A. cDNA cloning of a renal Na+–Ca2+ exchanger. Am. J. Physiol. (1992) 262:F1105–F1109.[Web of Science][Medline]
- Kofuji P, Lederer W.J, Schulze D.H. Na/Ca exchanger isoforms expressed in kidney. Am. J. Physiol. (1993) 265:F598–F603.[Web of Science][Medline]
- McDaniel L.D, Lederer W.J, Kofuji P, Schulze D.H, Kieval R, Schultz R.A. Mapping of the human cardiac Na+/Ca2+ exchanger gene (NCX1) by fluorescent in situ hybridization to chromosome region 2p22
p23. Cytogenet. Cell Genet. (1993) 63:192–193.[Web of Science][Medline] - Furman I, Cook O, Kasir J, Rahamimoff H. Cloning of two isoforms of the rat brain Na+–Ca2+ exchanger gene and their functional expression in HeLa cells. FEBS Lett. (1993) 319:105–109.[CrossRef][Web of Science][Medline]
- Komuro I, Wenninger K.E, Philipson K.D, Izumo S. Molecular cloning and characterization of the human cardiac Na+/Ca2+ exchanger cDNA. Proc. Natl. Acad. Sci. USA (1992) 89:4769–4773.
[Abstract/Free Full Text] - Low W, Kasir J, Rahamimoff H. Cloning of the rat heart Na+–Ca2+ exchanger and its functional expression in HeLa cells. FEBS Lett. (1993) 316:63–67.[CrossRef][Web of Science][Medline]
- Philipson K.D, Nicoll D.A. Sodium–calcium exchange. Curr. Opin. Cell. Biol. (1992) 4:678–683.[CrossRef][Medline]
- Dunn MJ. The analysis of two-dimensional polyacrylamide gels for the construction of protein databases. In: Dunn MJ, editor. Microcomputers in Biochemistry. Oxford: IRL Press, 1992:215–242.
- Hryshko L.V, Stiffel V, Bers D.M. Rapid cooling contractures as an index of sarcoplasmic reticulum calcium content in rabbit ventricular myocytes. Am. J. Physiol. (1989) 257:H1369–H1377.[Web of Science][Medline]
- Banijamali H.S, Gao W.D, MacIntosh B.R, ter Keurs H.E. Force-interval relations of twitches and cold contractures in rat cardiac trabeculae. Effect of ryanodine. Circ. Res. (1991) 69:937–948.
[Abstract/Free Full Text] - Wier W.G. Sodium–calcium exchange in intact cardiac cells: Exchange currents and intracellular calcium transients. Ann. N.Y. Acad. Sci. (1991) 639:366–374.[Web of Science][Medline]
- Bridge J.H, Smolley J.R, Spitzer K.W. The relationship between charge movements associated with ICa and INa-Ca in cardiac myocytes [see comments]. Science (1990) 248:376–378.
[Abstract/Free Full Text] - Kohmoto O, Levi A.J, Bridge J.H.B. Relation between reverse sodium–calcium exchange and sarcoplasmic reticulum calcium release in guinea pig ventricular cells. Circ. Res. (1994) 74:550–554.
[Abstract/Free Full Text] - Levesque P.C, Leblanc N, Hume J.R. Release of calcium from guinea pig cardiac sarcoplasmic reticulum induced by sodium–calcium exchange. Cardiovasc. Res. (1994) 28:370–378.
[Abstract/Free Full Text] - Leblanc N, Hume J.R. Sodium current-induced release of calcium from cardiac sarcoplasmic reticulum. Science (1990) 248:372–376.
[Abstract/Free Full Text] - Nakanishi H, Makino N, Hata T, Matsui H, Yano K, Yanaga T. Sarcolemmal Ca2+ transport activities in cardiac hypertrophy caused by pressure overload. Am. J. Physiol. (1989) 257:H349–H356.[Web of Science][Medline]
- Naqvi R.U, MacLeod K.T. Effect of hypertrophy on mechanisms of relaxation in isolated cardiac myocytes from guinea pig. Am. J. Physiol. (1994) 267(36):H1851–H1861.[Web of Science][Medline]
- Hanf R, Drubaix I, Marotte F, Lelievre L.G. Rat cardiac hypertrophy: Altered sodium–calcium exchange activity in sarcolemmal vesicles. FEBS Lett. (1988) 236:145–149.[CrossRef][Web of Science][Medline]
- Studer R, Reinecke H, Rilger I, Eschenhagen T, Bohm M, Hasenfuss G, Holtz J, Drexler H. Gene expression of the cardiac Na+–Ca2+ exchanger in end-stage human heart failure. Circ. Res. (1994) 75:443–453.
[Abstract/Free Full Text] - Kent R.L, Vozich J.D, McCollam P.L, McDermott D.E, Thacker U.F, Menick D.R, McDermott P.J, Cooper G. Rapid expression of the Na–Ca exchanger in response to cardiac pressure overload. Am. J. Physiol. (1993) 265:H1024–H1029.[Web of Science][Medline]
- Boerth S.R, Zimmer D.B, Artman M. Steady-state mRNA levels of the sarcolemal Na+/Ca2+ exchanger peak near birth in developing rabbit and rat hearts. Circ. Res. (1994) 74:354–359.
[Abstract/Free Full Text] - Vetter R, Studer R, Reinecke H, Kolar F, Ostádalová I, Drexler H. Reciprocal changes in the postnatal expression of the sarcolemmal Na–Ca exchanger and SERCA2 in rat heart. J. Mol. Cell. Cardiol. (1995) 27:1689–1701.[CrossRef][Web of Science][Medline]
- Boerth S.R, Artman M. Thyroid hormone status affects cardiac Na+–Ca2+-exchanger mRNA levels in immature rabbit ventricles. [Abstract]. J. Mol. Cell. Cardiol. (1995) 27:A80.
- Magyar C.E, Wang J, Azuma K.K, McDonough A.A. Reciprocal regulation of cardiac Na-K-ATPase and Na/Ca exchanger: hypertension, thyroid hormone, development. Am. J. Physiol. (1995) 269:C675–C682.[Web of Science][Medline]
- Boerth S.R, Artman M. Thyroid hormone regulates Na–Ca exchanger expression during postnatal maturation and in adult rabbit ventricular myocardium. Cardiovasc. Res. (1996) 31:E145–E152.
[Abstract/Free Full Text] - Lee S.L, Yu A.S, Lytton J. Tissue-specific expression of Na–Ca exchanger isoforms. J. Biol. Chem. (1995) 269:14849–14852.[Web of Science]
- Kofuji P, Lederer W.J, Schulze D.H. Mutually exclusive and cassette exons underlie alternatively spliced isoforms of the Na/Ca exchanger. J. Biol. Chem. (1994) 269:5145–5149.
[Abstract/Free Full Text] - Reilly RF, Lattanzi D. Identification of a novel alternatively spliced isoform of the Na+–Ca2+ exchanger (NACA8) in heart. In: Hilgeman DW, Philipson KD, Vassort G, editors. Sodium–Calcium Exchange. Proceedings of the Third International Conference. New York: New York Academy of Science, 1996:129–131.
- Matsuoka S, Nicoll D.A, Reilly R.F, Hilgeman D.W, Philipson K.D. Initial localization of regulatory regions of the cardiac sarcolemmal Na+–Ca2+ exchanger. Proc. Natl. Acad. Sci. USA (1993) 90:3870–3874.
[Abstract/Free Full Text] - Barnes K.V, Cheng G, Dawson M.M, Menick D.R. Cloning of the cardiac, kidney, and brain promoters of the feline ncx1 gene. J. Biol. Chem. (1997) 272(17):11510–11517.
[Abstract/Free Full Text] - Reynolds P.J, Lesley J, Trotter J, Schulte R, Hyman R, Sefton B.M. Changes in the relative abundance of type I and type II lck mRNA transcripts suggest differential promoter usage during T-cell development. Mol. Cell. Biol. (1990) 10:4266–4270.
[Abstract/Free Full Text] - Voronova A.F, Adler H.T, Sefton B.M. Two lck transcripts containing different 5' untranslated regions are present in T cells. Mol. Cell. Biol. (1987) 7:4407–4413.
[Abstract/Free Full Text] - Kilpatrick D.L, Zinn S.A, Fitzgerald M, Higuchi H, Sabol S.L, Meyerhardt J. Transcription of the rat and mouse proenkephalin genes is initiated at distinct sites in spermatogenic and somatic cells. Mol. Cell. Biol. (1990) 10:3717–3726.
[Abstract/Free Full Text] - Wong K, Boheler KR, Bishop J, Petrou M, Yacoub M. Clenbuterol induces cardiac hypertrophy with normal functional, morphological and molecular features. Cardiovasc. Res. 1998;37:115–122.
- Wong K, Boheler KR, Petrou M, Yacoub MH. Pharmacological modulation of pressure-overload cardiac hypertrophy: Changes in ventricular function, extracellular matrix and gene expression. Circulation 1997;96:2239–2246.
- Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. (1987) 162:156–159.[Web of Science][Medline]
- Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: A laboratory manual. 2nd ed. Cold Spring Harbor: Cold Spring Harbor Laboratory Press, 1989.
- Martin X.J, Schwartz K, Boheler K.R. Characterization of a novel transcript of retroviral origin expressed in rat heart and liver. J. Mol. Cell. Cardiol. (1995) 27:589–597.[Web of Science][Medline]
- Wankerl M, Boheler K.R, Fiszman M.Y, Schwartz K. Molecular cloning and analysis of the human cardiac sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA2) gene promoter. J. Mol. Cell. Cardiol. (1996) 28:2139–2150.[CrossRef][Web of Science][Medline]
- Wessels A, Vermeulen J.L.M, Verbeek F.J, Virágh S, Kálmán F, Lamers W.H, Moorman A.F.M. Spatial distribution of tissue-specific antigens in the developing human heart and skeletal muscle. III. An immunohistochemical analysis of the distribution of the neural tissue antigen G1N2 in the embryonic heart; implications for the development of the atrioventricular conduction system. Anat. Rec. (1992) 232:97–111.[CrossRef][Medline]
- Wessels A, Vermeulen J.L.M, Virágh S, Kalman F, Lamers W.H, Moorman A.F.M. Spatial distribution of tissue-specific antigens in the developing human heart and skeletal muscle. II. An immunocytochemical analysis of myosin heavy chain isoform expression patterns in the embryonic heart. Anat. Rec. (1991) 229:355–368.[CrossRef][Medline]
- Wessels A, Vermeulen J.L.M, Virágh S, Kalman F, Morris G.E, Man G.E, Lamers W.H, Moorman A.F.M. Spatial distribution of tissue-specific antigens in the developing human heart and skeletal muscle. I. An immunocytochemical analysis of creatine kinase isoenzyme patterns. Anat. Rec. (1990) 228:163–176.[CrossRef][Medline]
- Philipson K.D, Longoni S, Ward R. Purification of the cardiac Na+–Ca2+ exchange protein. Biochim. Biophys. Acta (1988) 945:298–306.[Medline]
- Kaddoura S, Firth J.D, Boheler K.R, Sugden P.H, Poole-Wilson P.A. Endothelin-1 is involved in norepinephrine-induced ventricular hypertrophy in vivo: Acute effects of Bosentan, an orally-active mixed endothelin ET-A and ET-B receptor antagonist. Circulation (1996) 93:2068–2079.
[Abstract/Free Full Text] - Petrou M, Wynne D.G, Boheler K.R, Yacoub M.H. Clenbuterol induces hypertrophy of the latissimus dorsi muscle and heart in the rat with molecular and phenotypic changes. Circulation (1995) 92(Suppl_II):483–489.
[Abstract/Free Full Text] - Moorman A.F.M, de Boer P.A.J, Vermeulen J.L.M, Lamers W.H. Practical aspects of radio-isotopic in situ hybridization on RNA. Histochem. J. (1993) 25:251–266.[CrossRef][Web of Science][Medline]
- Moorman A.F.M, Vermeulen J.L.M, Koban M.U, Schwartz K, Lamers W.H, Boheler K.R. Patterns of expression of sarcoplasmic reticulum Ca2+-ATPase and phospholamban mRNAs during rat heart development. Circ. Res. (1995) 76:616–625.
[Abstract/Free Full Text] - Lompré A, de la Bastie D, Boheler K.R, Schwartz K. Characterization and expression of the rat heart sarcoplasmic reticulum Ca2+-ATPase mRNA. FEBS Lett. (1989) 249:35–41.[CrossRef][Web of Science][Medline]
- Long C.S, Ordahl C.P, Simpson P.C.
1-Adrenergic receptor stimulation of sarcomeric actin isogene transcription in hypertrophy of cultured rat heart muscle cells. J. Clin. Invest. (1989) 83:1078–1082.[Web of Science][Medline] - Boheler K.R, Chassagne C, Martin X, Wisnewsky C, Schwartz K. Cardiac expressions of
- and β-myosin heavy chains and sarcomeric
-actins are regulated through transcriptional mechanisms. J. Biol. Chem. (1992) 267:12979–12985.[Abstract/Free Full Text] - Muller F.U, Boheler K.R, Eschenhagen T, Schmitz W, Scholz H. Isoprenaline stimulates gene transcription of the inhibitory G protein
-subunit Gi
-2 in rat heart. Circ. Res. (1993) 72:696–700.[Abstract/Free Full Text] - Leinwand L.A, Leiden J.M. Gene transfer into cardiac myocytes in vivo. Trends Cardiovasc. Med. (1991) 1:271–276.[CrossRef][Web of Science]
- Kass-Eisler A, Falck-Pedersen E, Alvira M, Rivera J, Buttrick P.M, Wittenberg B.A, Cipriani L, Leinwand L.A. Quantitative determination of adenovirus-mediated gene delivery to rat cardiac myocytes in vitro and in vivo. Proc. Natl. Acad. Sci. USA (1993) 90:11498–11502.
[Abstract/Free Full Text] - Lytton J, Lee SL, Lee WS, van Baal J, Bindels RJM, Kilav R, Naveh-Many T, Silver J. Sodium–Calcium Exchange. Proceedings of the Third International Conference. New York: New York Academy of Science, 1997:58–72.
- Koban MU, Boateng SY, Boheler KR. The role of the sarcoplasmic reticulum calcium ATPase and its regulatory protein phospholamban in the developing myocardium. In: Ostadal B, Nagano M, Takeda N, Dhalla NS, editors. The Developing Heart. New York: Lippincott-Ravens Publishers, 1997:143–164.
- Barton PJR, Boheler KR, Brand NJ, et al. Molecular Biology of Cardiac Development and Growth. Austin TX: R.G. Landes, 1995:272 pp.
- Menick DR, Barnes KV, Thacker UF, Dawson MM, McDermott D, Rozich JD, Kent RL, CooperIV G. The Exchanger and Cardiac Hypertrophy. In: Hilgeman DW, Philipson KD, Vassort G, editors. Sodium–Calcium Exchange. Proceedings of the Third International Conference. New York: New York Academy of Science, 1996:489–501.
- Assasyag P, Charlemagne D, de Leiris J, Boucher F, Valere P, Lortet S, Swynghedauw B, Besse S. Senecent heart compared with pressure overload-induced hypertrophy. Hypertension (1997) 29(1):15–21.
[Abstract/Free Full Text] - Kariya K, Farrance I.K, Simpson P.C. Transcriptional enhancer factor-1 in cardiac myocytes interacts with an alpha 1-adrenergic- and beta-protein kinase C-inducible element in the rat beta-myosin heavy chain promoter. J. Biol. Chem. (1993) 268:26658–26662.
[Abstract/Free Full Text] - Kariya K, Karns L.R, Simpson P.C. An enhancer core element mediates stimulation of the rat β-myosin heavy chain promoter by an
1-adrenergic agonist and activated β-protein kinase C in hypertrophy of cardiac myocytes. J. Biol. Chem. (1994) 269:3775–3782.[Abstract/Free Full Text] - Quednau B.D, Nicoll D.A, Philipson K.D. Tissue specificity and alternative splicing of the Na+/Ca2+ exchanger isoforms NCX1, NCX2, and NCX3 in rat. Am. J. Physiol. (1997) 272:C1250–C1261.[Web of Science][Medline]
This article has been cited by other articles:
![]() |
R. Rapila, T. Korhonen, and P. Tavi Excitation-Contraction Coupling of the Mouse Embryonic Cardiomyocyte J. Gen. Physiol., September 29, 2008; 132(4): 397 - 405. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










