© 1998 by European Society of Cardiology
Copyright © 1998, European Society of Cardiology
Thyroid status and postnatal changes in subsarcolemmal distribution and isoform expression of rat cardiac dihydropyridine receptors
aLaboratoire de Pharmacologie, Université Catholique de Louvain, Avenue Hippocrate 54, B-1200 Brussels, Belgium
bInstitute of Physiology, Academy of Sciences of the Czech Republic, Videnska 1083, CZ-142 20 Prague, Czech Republic
* Corresponding author. Tel. +32-2-7645417; Fax +32-2-7645460; E-mail: wibo@farl.ucl.ac.be
Received 18 February 1997; accepted 27 August 1997
| Abstract |
|---|
|
|
|---|
Objective: The aim was to analyze the early postnatal changes in myocardial density, subsarcolemmal localization and isoform expression of dihydropyridine receptors in rat ventricle and the influence of thyroid status on these changes. Methods: Newborn rats were treated from postnatal day 2 with L-triiodothyronine (T3) or 6-n-propyl-2-thiouracil (PTU) and ventricles were collected on day 1, 7 and 14. Radioligand binding and cell fractionation (density gradient centrifugation) techniques were used to determine the tissue density of various receptors and their subcellular localization. To analyze dihydropyridine receptor
1 subunit isoform expression, cDNA fragments corresponding to a large portion of motif IV were amplified by reverse transcriptase-polymerase chain reaction and treated with appropriate restriction endonucleases to determine the frequency of splicing events at the level of motif IV. Results: The myocardial density of dihydropyridine receptors increased 3-fold from day 1 to day 14 in control rats, and this increase occurred predominantly in membrane entities equilibrating at high densities in sucrose gradient, that is, presumably, in junctional structures (dyadic couplings). This maturation was delayed after PTU-treatment, and somewhat accelerated by excess T3. The proportion of mRNA variants typical of foetal heart (IVS3A variant and deleted variant, showing a 33-nucleotide deletion at the level of the extracellular loop between IVS3 and IVS4) decreased with age in control rats. This reduction was delayed after treatment with PTU but was not influenced by excess T3. Conclusion: Hypothyroidism impaired the early postnatal maturation of dihydropyridine receptors as regards both their concentration into junctional structures and the decrease in the relative expression of
1-subunit mRNA variants typical of foetal heart.
KEYWORDS Rat heart; Development; Thyroid hormone; Junctional structures; Calcium channel; Dihydropyridine receptor;
1 subunit; Ryanodine
| 1 Introduction |
|---|
|
|
|---|
Early postnatal growth of mammalian heart is accompanied by marked changes in excitation-contraction coupling and Ca2+ handling (reviewed in [1]), supported by important modifications in gene expression of major Ca2+ transport systems [2–5]. In particular, the sarcoplasmic reticulum (SR) progressively assumes a predominant role in the Ca2+ transient that is responsible for activation of contractile proteins. Ca2+ release from SR occurs through ryanodine-sensitive channels and is driven by a local increase of the Ca2+ concentration, which results predominantly from Ca2+ entry through the dihydropyridine-sensitive voltage-dependent Ca2+ channels of the sarcolemma. During maturation of ventricular tissue, most dihydropyridine receptors appear to concentrate into specialized areas of the sarcolemma that are physically associated with SR structures containing the ryanodine receptors [6–8]. This junctional localization favors the process of Ca2+-induced Ca2+ release from the SR and is consistent with a local control model of excitation-contraction coupling, in which one L-type channel triggers a regenerative cluster of a few SR release channels [6, 9]. Refilling of the SR Ca2+ stores is ensured by the SERCA2 ATPase, which is up-regulated during postnatal maturation, while the sarcolemmal Na+–Ca2+ exchanger is down-regulated in a reciprocal manner [10].
Thyroid hormone modulates postnatal changes of cardiac excitation-contraction coupling at the level of contractile function and calcium handling [11]. In particular, hypothyroidism induced after birth resulted in decreased calcium uptake by the sarcoplasmic reticulum and increased sensitivity to the negative inotropic effect of verapamil, suggesting that hypothyroid heart remains more dependent on trans-sarcolemmal Ca fluxes than age-matched euthyroid heart. We have observed recently that, in ventricular tissue from rats made hypothyroid after birth, concurrently with impaired development of SR Ca2+ transport systems, a large proportion of dihydropyridine receptors remain associated with peripheral, nonjunctional sarcolemma at the age of 21 days, whereas they are mostly concentrated in junctional structures in control animals [12]. It is widely accepted that thyroid hormone acts predominantly at the level of gene transcription. Thyroid hormone directly controls in this manner the perinatal maturation of cardiac myosin isoform expression in rodent heart (reviewed in [13]) and modulates, perhaps indirectly, the postnatal changes in isoform expression of some other cardiac proteins, e.g.
-actin and troponin I [14], and, possibly, Na+,K+-ATPase [12, 15, 16]. Two splicing events at the level of motif IV of the
1 subunit of the dihydropyridine receptor coded by the CaCh2 gene have been previously characterized and shown to be regulated during myocardial development [17, 18]: a mutually exclusive alternative splicing event at the level of the third membrane-spanning segment, IVS3, leading to either IVS3A or IVS3B, and a 33-nucleotide deletion in the extracellular loop between IVS3 and IVS4. As the junctional localization of the dihydropyridine receptor might be favoured by a particular primary structure of the
1 subunit, we decided to investigate in parallel the influence of thyroid status on these splicing processes and on the subsarcolemmal localization of the dihydropyridine receptor. We found that hypothyroidism impaired the early postnatal maturation of dihydropyridine receptors, not only by delaying the association of these receptors with junctional structures, but also by slowing down the decrease in the relative expression of
1-subunit mRNA variants typical of foetal heart.
| 2 Methods |
|---|
|
|
|---|
2.1 Animal model
Newborn male Wistar rats (SPF strain) were made either hyper- or hypothyroid as reported previously [11]. Hyperthyroidism was induced by subcutaneous injections of T3, at a dose of 10 µg per 100 g body weight, on days 2–14 postpartum. Hypothyroidism was induced by the inclusion of 0.05% PTU in the drinking water supplied to mothers for the same period of time. Control (euthyroid) pups received no treatment. On days 1, 7 and 14, the animals were decapitated, and the hearts were dissected free of atrial tissue and large blood vessels. The ventricles were rinsed in cold (5°C) saline, weighed, and frozen in liquid nitrogen. Total T3 and T4 (thyroxine) levels in blood plasma were measured by radioimmunoassay (Immunotech, Prague, Czech Republic). The investigation conforms with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1985).
2.2 Receptor binding studies
2.2.1 Subcellular fractionation
Finely minced ventricular tissue (1–1.5 g, 5–50 hearts) was homogenized with 10–12 ml of a chilled solution containing (mM): sucrose 250, imidazole 5, dithioerythritol 2, phenylmethylsulfonyl fluoride 0.2 and EDTA 0.2, pH 7.3, by means of an Ultra-Turrax homogenizer (Janke and Kunkel; three 5 s bursts at 13 500 rpm). The suspension was centrifuged at 110 000 gav for 35 min (at 2°C) in a TFT 50.38 rotor (Kontron). The pellet was resuspended in buffered sucrose (mM: sucrose 250, imidazole 3 and phenylmethylsulfonyl fluoride 0.1, pH 7.4), by means of a Dounce-type homogenizer, and recentrifuged under the same conditions. The washed pellet, resuspended in buffered sucrose, was designated total particulate fraction. Protein was measured by the Lowry method [19].
The microsomal fraction (110 000 gav, 35 min) was obtained essentially as reported previously [6], after removing the nuclear (1000 gav, 10 min) and mitochondrial (10 000 gav, 20 min) fractions. After resuspension in buffered sucrose, the microsomal fraction was subfractionated by isopycnic centrifugation in sucrose gradient [12]. Thirteen subfractions were collected from the gradient and their density was determined from their sucrose concentration, measured by refractometry.
2.2.2 Binding assays
Specific bindings of [3H](+)-PN200-110, [3H]ryanodine and [3H]ouabain were measured as reported previously [12]. [3H](–)-CGP-12177 binding was determined as described [12], except that binding to β1-adrenoceptors was estimated by subtracting from total binding the binding obtained in the presence of 0.5 µM CGP-20712A (kindly provided by Ciba-Geigy), a highly selective β1 ligand [20]. [3H]Prazosin binding was measured by incubating tissue fractions with the radioligand (73 Ci/mmol; Amersham International plc) for 30 min at 37°C, in 50 mM Tris-HCl (pH 7.5) supplemented with bovine serum albumin (50 mg/l); nonspecific binding was estimated in the presence of 10 µM phentolamine (Sigma Chemical Co). At the end of incubation, membranes were trapped by vacuum filtration onto Whatman GF/F filters, which were then washed twice with 10 ml of chilled buffer (50 mM Tris-HCl, pH 7.5) and counted by liquid scintillation spectrometry.
2.2.3 Presentation of results of isopycnic centrifugation
Total and nonspecific bindings were determined in triplicate at a single concentration of radioligand, in each of the 13 subfractions, as well as in the total microsomal fraction that was loaded on the gradient. Specific binding in each subfraction was converted in maximal number of sites (Bmax, pmol/g tissue), using the equilibrium dissociation constant (KD) obtained from saturation experiments carried out on total particulate fractions. To construct density distribution histograms, the density at the boundary between adjacent subfractions was estimated as the weighted average of their measured densities [21]. To allow averaging results from separate experiments, normalized density histograms were reconstructed after subdividing the density scale (extending from 1.05 to 1.25) into 15 identical increments, as described by Beaufay and Amar-Costesec [21].
2.3 Molecular biology
2.3.1 Synthesis of cDNA
Total RNA was extracted from ventricular tissue (0.1–0.2 g) by the guanidinium thiocyanate procedure [22]and its integrity was checked by agarose gel electrophoresis and ethidium bromide staining. First strand cDNA was synthesized in a volume of 25 µl, using Superscript RNase H- Reverse Transcriptase (Life Technologies) and the reverse primer used in polymerase chain reaction (PCR, see below), according to the manufacturer's recommendations; a ribonuclease inhibitor (RNasin, Promega) was added to the reaction mixture.
2.3.2 Oligonucleotides used as primers in PCR
To analyze mRNA variants in relation with the fourth motif of the
1 subunit of the dihydropyridine receptor, the cDNA region encoding the major portion of motif IV was amplified by PCR, using as forward primer an oligonucleotide (TGCCTCTTCAAAATCGCCATGAATA) corresponding to part of the linker sequence between IVS1 and IVS2 (nucleotides 16–40 in exon U1 of Diebold et al. [17]), and as reverse primer an oligonucleotide (AACACCTGCATCCCGATCACAGC) corresponding to part of the IVS5 transmembrane segment [18]. Purified oligonucleotides were obtained from Pharmacia Biotech. For quantitative analysis of the PCR products, the reverse primer was 5' end-labelled with
using T4 polynucleotide kinase (Life Technologies) and
-[32P]-ATP (5000 Ci/mmol). The labelled oligonucleotide was purified by G50-Sephadex chromatography.
2.3.3 PCR
The amplification reaction mixture (100 µl) contained 4 µl of the first strand cDNA mixture, 40 nmol of deoxynucleoside triphosphates, 0.2 µg of each primer, 2.5 U of Taq DNA polymerase (AmpliTaq, Cetus) and 10 µl of 10x buffer (100 mM Tris-HCl, pH 8.3, 500 mM KCl, 15 mM MgCl2, 0.1% gelatin). Before adding DNA polymerase, separation of first strand cDNA from mRNA was first achieved by heating at 94°C for 10 min and then chilling on ice. The total reaction mixture, overlaid with mineral oil, was then submitted to 25 PCR cycles, each cycle comprising 1 min denaturation at 94°C, 2 min of annealing at 55°C and 3 min extension at 72°C. With the selected number of cycles, amplification of the PCR products was still in the exponential phase (data not shown).
2.3.4 Analysis of PCR products
We used a previously described strategy, based on the use of restriction endonucleases (e.g. [23]), to quantify the cDNA variants corresponding to motif IV in the PCR amplification products (see Introduction). According to sequencing data [17, 18], NsiI was expected to act on IVS3B, but not on IVS3A, which did not contain its restriction site, while PvuII was expected to act selectively on undeleted variants, since its only restriction site was associated with the 33-bp sequence that was absent in deleted variants. Samples from PCR (8 µl) were digested for 2 h at 37°C with either NsiI or PvuII (1 µl, 10 U; Life Technologies) in the appropriate buffer supplied by the manufacturer (1 µl of 10x buffer) and then analyzed on 2% agarose gels in the presence of ethidium bromide. The size of the DNA fragments was estimated by reference to standard bands of 100–1500 bp. Dried gels were autoradiographed on Kodak XAR film and bands were quantified using a camera coupled to an image analysis program (Image 1.37, NIH, Bethesda).
2.4 Statistical analysis
The effect of age or thyroid status was assessed by variance analysis; whenever significant effects were disclosed (P<0.05), differences between groups were assessed by the Dunnett t-test. In equilibrium binding studies, parameters were estimated by a non-linear curve fitting program (Ligand [24]).
| 3 Results |
|---|
|
|
|---|
3.1 Heart weight and plasma level of thyroid hormones
As shown in Table 1, treatment of rats with PTU significantly reduced heart weight and the ratio heart to body weight at postnatal days 7 and 14, whereas treatment with T3 had the opposite effect. The levels of circulating thyroid hormones increased markedly with age in control rats. Treatment with PTU induced a reduction of T4 at days 7 and 14. Administration of T3 markedly increased its plasma level at days 7 and 14, but did not affect T4 level at day 7 and even reduced this level at day 14 in comparison with controls.
|
3.2 Binding parameters in total particulate fractions
The amount of protein per g of ventricular tissue increased with age in total particulate fractions (n = 4) from control animals, from 64.4±1.9 on day 1, to 85.2±2.2 on day 7, and 101.5±2.9 mg/g on day 14. The protein content (mg/g tissue) was not appreciably influenced by the thyroid status (PTU, day 7: 86.9±4.1, day 14: 96.0±2.6; T3, day 7: 80.5±2.5, day 14: 108.2±3.4).
Saturation experiments were carried out to characterize equilibrium binding parameters, that is dissociation constants (KD) and maximal binding capacities (Bmax) of dihydropyridine, ryanodine and adrenergic (
1 and β1) receptors. β1-Adrenoceptors were included in this analysis because their myocardial density is known to be closely dependent on thyroid status [25];
1 adrenoceptors were used as plasma membrane markers in density gradient experiments (see below). Under our assay conditions, only one class of binding sites was detected with each radioligand. KD values (Table 2) showed little variation with age and thyroid status. As shown in Fig. 1, Bmax values in control hearts, expressed in pmol per g tissue, were multiplied by a factor of about 3 between day 1 and day 14; the increase was less, that is about 2-fold, when expressed in pmol per mg protein (not shown). After treatment with PTU, the Bmax value decreased moderately with respect to control samples for [3H](+)-PN200-110 (day 14: –21%) and [3H]ryanodine (day 14: –28%), more markedly for [3H](–)-CGP-12177 (day 7: –33%; day 14: –58%), but did not change for [3H]prazosin. After treatment with T3, the Bmax value did not change for [3H](+)-PN200-110 and [3H]prazosin, but increased slightly for [3H]ryanodine (day 14: +14%) and moderately for [3H](–)-CGP-12177 (day 7: +40%; day 14: +27%).
|
|
3.3 Density distribution of binding sites in microsomal fractions
To investigate the influence of age and thyroid hormones on the subsarcolemmal distribution of dihydropyridine receptors, we used microsomal fractions, in which those receptors were purified 2.5- to 4-fold with respect to total particulate fractions. Microsomal fractions contained 25–45% of the various binding sites and 7–16% of the protein found in total particulate fractions; percentage yields of protein and binding sites in microsomal fractions increased somewhat with age, whichever the thyroid status. Two microsomal fractions from each group, each of which had been prepared from 9 to 50 hearts, were subfractionated by density equilibration in sucrose gradient. As shown in Fig. 2Fig. 3, distribution patterns obtained in duplicate gradient experiments (vertical bars) coincided fairly well. The amounts of binding sites recovered in gradient subfractions, expressed in percentage of amount in the microsomal fraction layered on the gradient, were (mean±s.e.m., 14 expts.): [3H](+)-PN200-110, 95.4±2.1; [3H]ryanodine, 107.3±1.7; [3H]prazosin, 101.7±2.7.
|
|
Fig. 2 shows results obtained after subfractionation by density gradient centrifugation of microsomal fractions from control rats, at postnatal day 1, 7 and 14. As expected from Bmax data measured in total particulate fractions, the total area of histograms increased markedly from day 1 to day 14. The distribution pattern of [3H]prazosin binding (Fig. 2A) was characterized by an asymmetrical shape which did not change appreciably with age, with a mode remaining at 1.12–1.13, and a tail extending towards high densities. (Not shown, the distribution pattern of [3H]ouabain binding was always superimposable to that of [3H]prazosin binding.) The [3H]ryanodine distribution (Fig. 2C) remained symmetrical from day 1 to day 14, with a mode at high densities; as [3H]ryanodine binding increased more markedly with age at densities higher than 1.17, the mode shifted from about 1.17 at day 1 to 1.19 at day 14. In contrast with the other distributions, that of [3H](+)-PN200-110 binding (Fig. 2B) changed markedly in shape from day 1 to day 14. At day 1, the histogram was rather symmetrical, with a mode at 1.14–1.15. Already at day 7, but more obviously at day 14, the number of [3H](+)-PN200-110 binding sites increased predominantly in high density subfractions; as a result, the distribution at day 14 became highly asymmetrical, with a prominent peak at 1.18, close to that of [3H]ryanodine binding, and a marked shoulder at low densities (1.10–1.15), where the peak of [3H]prazosin binding was also found.
In Fig. 3 are shown distributions obtained with microsomal fractions from hypo- and hyperthyroid rats at day 14, which are compared to those from control rats. (Data from 7-day old rats are not illustrated, differences between groups being less pronounced than at day 14.) The thyroid status had little influence on the distribution pattern of [3H]prazosin binding (Fig. 3A). Hypothyroidism reduced the number of [3H](+)-PN200-110 (Fig. 3B) and [3H]ryanodine (Fig. 3C) binding sites recovered at high densities, while hyperthyroidism had opposite effects. As a consequence, the proportion of [3H](+)-PN200-110 binding recovered at low densities (<1.15) was two-fold higher in hypothyroid rats compared to hyperthyroid rats (Percentages recovered at densities less than 1.15 in the two gradient experiments: control: 32.3 and 29.9; hypothyroid: 46.6 and 45.1; hyperthyroid: 23.7 and 21.7).
3.4 Isoform expression of the dihydropyridine receptor
We analyzed the influence of age and thyroid status on two splicing events in relation with the fourth motif of the
1 subunit of the dihydropyridine receptor, which had previously been shown to be subjected to developmental regulation [17, 18]: a mutually exclusive alternative splicing event at the level of IVS3, leading to either IVS3A or IVS3B, and a 33-nucleotide deletion in the extracellular loop between IVS3 and IVS4. Amplified (RT-PCR) cDNA fragments corresponding to a large portion of motif IV were treated with restriction endonucleases, either NsiI, which acted only on IVS3B, or PvuII, which did not cleave the deleted variant (see Methods). As illustrated in Fig. 4, amplified cDNA fragments (ND: 413 bp) were extensively cleaved by both restriction enzymes, yielding mainly one kind of shorter labelled fragments (NsiI: 299 bp; PvuII: 229 bp), derived from IVS3B and the undeleted variant, respectively. The amounts of IVS3A and deleted variant were estimated by subtracting the amounts of, respectively, IVS3B and undeleted variant from the corresponding initial amounts of nondigested cDNA (ND), and their proportions are listed in Table 3. This subtraction method was found to be more reliable than the direct measurement of IVS3A and deleted variants since the optical density at the level of undigested 413-bp PCR product following incubation with restriction enzyme was often low and less suitable for quantitation. Both IVS3A and deleted variant decreased with postnatal age in control hearts, becoming undetectable by day 14. In samples from PTU-treated rats, the proportions of IVS3A variant were significantly higher at days 7 and 14 than in age-matched controls, while the proportion of deleted variant was higher only at day 7. On day 7, the percentage of IVS3A in PTU-treated rats (31.8±4.8) was even higher than at day 1 in control (15.4±2.8). No difference was observed between T3-treated rats and age-matched controls.
|
|
| 4 Discussion |
|---|
|
|
|---|
After subfractionation of microsomal fractions from rat ventricle by density gradient centrifugation, ryanodine receptors (SR Ca2+-release channels) are recovered in high-density gradient subfractions and their distribution pattern is clearly different from that of the thapsigargin-sensitive Ca2+-ATPase, a marker of longitudinal SR [12]. In adult ventricular tissue, most ryanodine receptors are associated with junctional SR, though a significant part is present in the corbular SR, which is not physically connected to T-tubules or peripheral sarcolemma [26]. These two varieties of SR entities (junctional and corbular) cannot be distinguished in our gradient experiments, which consistently show unimodal density distribution patterns of ryanodine receptors in adult and neonatal ventricular tissue [6, 12]. In adult ventricular tissue, the majority of dihydropyridine receptors (dihydropyridine-sensitive L-type Ca2+ channels, mostly associated with cardiomyocytes [27]), is also recovered in high-density subfractions, together with ryanodine receptors [6, 28]. Immunofluorescence labelling studies on tissue sections from adult rabbit ventricle [7]have shown that the staining patterns of the dihydropyridine and ryanodine receptors overlap completely, suggesting that, in that tissue, most dihydropyridine receptors are closely associated with ryanodine receptors at or near dyadic couplings that are formed where the SR is apposed to the surface membrane or its infoldings (T-tubules).
From day 1 to day 14 after birth, the number of dihydropyridine receptors per g of rat ventricular tissue increased markedly, and their distribution pattern after equilibration in sucrose gradient changed strikingly, a progressively larger proportion of these receptors being recovered in high-density subfractions. This behaviour of dihydropyridine receptors differed from that of other plasma membrane constituents, as exemplified here by
1-adrenergic receptors, which, though increasing also in number per g tissue, remained largely in the low-density subfractions. As discussed previously [6, 12], and in line with the immunofluorescence labelling data [7], the postnatal change in the density distribution of dihydropyridine receptors may be taken as reflecting an increase in the proportion of these receptors associated with the specialized sarcolemmal domains that are physically connected to junctional SR elements containing ryanodine receptors. On the other hand, the persistence of
1-adrenergic receptors in low-density subfractions indicates that they remain mostly associated with nonjunctional plasma membrane domains, a behaviour shared by β-adrenergic [12]and muscarinic receptors [6], as well as by the various isoforms of Na+,K+-ATPase [29].
The 3-fold increase in the number of dihydropyridine receptors per g tissue from day 1 to day 14 is in fair agreement with binding data reported previously [30, 31]. Since the myocyte surface-to-volume ratio remains similar despite the postnatal increase in cell volume [32], it may be concluded that the average number of dihydropyridine receptors per unit surface area of sarcolemmal membrane (including nascent T-tubules) should also increase by a factor of about 3 from day 1 to day 14. However, over the same period, the (L-type) Ca2+ current density (pA/pF) has been reported to vary little in rat ventricular cells [33, 34]. This paradox might be resolved if the developmental increase in Ca2+ channel number is offset by a concomitant decrease in Ca2+ influx through individual channels. This decrease might result from subtle changes in channel structure, at the level of the
1 subunit or of an associated subunit, but this is not supported by the available single-channel current data [33]. Alternatively, the postulated decrease in Ca2+ influx through individual channels might be due, at least partly, to a more pronounced Ca2+-dependent channel inactivation [34, 35], brought about by the progressive concentration of L-type channels and SR Ca2+ release channels in junctional structures and by the development of a functional SR.
Postnatal maturation of myocardial tissue is greatly influenced by thyroid hormone, the level of which increases markedly after birth [36]. Treatment with PTU, which was started on postnatal day 2, did not abolish, but rather slowed down the increase in plasma concentrations of T3 and T4: in PTU-treated rats, these concentrations were similar at day 14 to those measured at day 7 in control animals. Interestingly, heart weights, numbers of ryanodine receptors per g tissue and density gradient distribution patterns of dihydropyridine and ryanodine receptors were also similar in PTU/day 14 and control/day 7 rats. However, PTU/day 14 rats possessed higher numbers of ventricular dihydropyridine and
1-adrenoceptors than control/day 7 rats, indicating that thyroid hormone was not the only determinant of postnatal maturation of those receptors. In agreement with this view, administration of T3 did not influence the myocardial density of dihydropyridine and
1-adrenoceptors. The levels of β1-adrenoceptors remained very low at days 7 and 14 in PTU-treated rats, in line with the view that thyroid hormone plays a permissive role in their postnatal development in heart [25]. Administration of T3 accelerated somewhat the postnatal increase in β1-adrenoceptor and ryanodine receptor numbers per g tissue, as well as the evolution of the subsarcolemmal localization of dihydropyridine receptors towards an adult pattern. These effects of T3 administration had not been detected previously at postnatal day 21 [12], probably because normal levels of thyroid hormone were sufficient to ensure optimal maturation of cardiac excitation-contraction coupling at that age.
In agreement with our interpretation of the influence of thyroid status on the distribution pattern in density gradient of dihydropyridine receptors, electron microscopic examination by Jarkovska et al. [37]revealed that, in ventricular myocytes from PTU-treated rats, T-tubules were extremely rare at day 14 and the SR profiles were sparse and formed couplings largely with the peripheral sarcolemma; in contrast, treatment with T3 resulted in an acceleration of the development of SR and T-tubules, which displayed large junctional areas. It may be concluded, therefore, that postnatal hypothyroidism delays the structural maturation of Ca2+ handling systems, as shown by both electron microscopy and cell fractionation analysis, and that these alterations in hypothyroid ventricles are consistent with a more pronounced dependence of contractile activity on trans-sarcolemmal Ca fluxes [11]. The opposite alterations induced by postnatal hyperthyroidism are in line with the view that thyroid hormone accelerates the maturation of myocardial excitation-contraction coupling towards an increased dependence of contractile activity on trans-SR Ca fluxes.
The increase in myocardial levels of dihydropyridine and ryanodine receptors that occurs after birth is induced by a corresponding upregulation of the expression of their genes [3, 5], which is probably controlled, or modulated, by thyroid hormone [38]. In view of the previous reports indicating that two splicing events at the level of the fourth motif of the
1 subunit of the dihydropyridine receptor were subjected to developmental regulation [17, 18], we analyzed the influence of thyroid status on these processes, to search for a possible correlation between isoform expression and subsarcolemmal localization. In fair agreement with results obtained previously by different methods [17, 18], the proportion of mRNA variants typical of foetal heart (IVS3A, deleted variant) was found to be rather low in newborn heart and to decrease further with postnatal age. Treatment with PTU slowed down this postnatal reduction of foetal mRNA variants. The proportions of these variants were similar in PTU/day 14 and control/day 7 rats, as were the density gradient distributions patterns of dihydropyridine and ryanodine receptors. The percentage of IVS3A in PTU-treated rats on day 7 was higher than at day 1 in control, suggesting a transient return to a foetal pattern of isoform expression. A similar phenomenon has been recently reported by Gidh-Jain et al. [39]in noninfarcted hypertrophied ventricular myocardium 21 days post myocardial infarction. In conclusion, our results are largely consistent with the hypothesis that the junctional localization of the cardiac dihydropyridine receptor is favoured by a particular primary structure of the
1 subunit, that is the presence of the IVS3B sequence and/or the absence of deletion of a 11-aminoacid sequence in the extracellular loop between IVS3 and IVS4. However, relative levels of protein isoforms are not always strictly correlated with those of the corresponding mRNA variants, and further studies are thus needed to address this question in a more direct manner.
Time for primary review 34 days.
| Acknowledgements |
|---|
This work was supported by Fonds de Développement Scientifique U.C.L., Fonds de la Recherche Scientifique Médicale (grant FRSM no. 3-4546-92), Ministère de l'Education et de la Recherche Scientifique (grants ARC no. 89/95–135 and 96/01–199) and Grant Agency of the Czech Ministry of Health (grant Z192). The authors thank Anne Lebbe and Marie-Christine Hamaide for their skillful technical assistance.
| References |
|---|
|
|
|---|
- Mahony L. Regulation of intracellular calcium concentration in the developing heart. Cardiovasc Res (1996) 31:E61–E67.
[Free Full Text] - Lompré A.M, Lambert F, Lakatta E.G, Schwartz K. Expression of sarcoplasmic reticulum Ca2+-ATPase and calsequestrin genes in rat heart during ontogenic development and aging. Circ Res (1991) 69:1380–1388.
[Abstract/Free Full Text] - Arai M, Otsu K, MacLennan D.H, Periasamy M. Regulation of sarcoplasmic reticulum gene expression during cardiac and skeletal muscle development. Am J Physiol (1992) 262:C614–C620.[Web of Science][Medline]
- Boerth S.R, Zimmer D.B, Artman M. Steady-state mRNA levels of the sarcolemmal Na+-Ca2+ exchanger peak near birth in developing rabbit and rat hearts. Circ Res (1994) 74:354–359.
[Abstract/Free Full Text] - Brillantes A.-M.B, Besprozvannaya S, Marks A.R. Developmental and tissue-specific regulation of rabbit skeletal and cardiac muscle calcium channels involved in excitation-contraction coupling. Circ Res (1994) 75:503–510.
[Abstract/Free Full Text] - Wibo M, Bravo G, Godfraind T. Postnatal maturation of excitation-contraction coupling in rat ventricle in relation to the subcellular localization and surface density of 1,4-dihydropyridine and ryanodine receptors. Circ Res (1991) 68:662–673.
[Abstract/Free Full Text] - Lewis Carl S, Kelly F, Caswell A.H, Brandt N.R, Ball W.J Jr., Vaghy P.L, Meissner G, Ferguson D.G. Immunolocalization of sarcolemmal dihydropyridine receptor and sarcoplasmic reticular triadin and ryanodine receptor in rabbit ventricle and atrium. J Cell Biol (1995) 129:673–682.
[Abstract/Free Full Text] - Sun X.-H, Protasi F, Takahashi M, Takeshima H, Ferguson D.G, Franzini-Armstrong C. Molecular architecture of membranes involved in excitation-contraction coupling of cardiac muscle. J Cell Biol (1995) 129:659–671.
[Abstract/Free Full Text] - Stern M.D, Lakatta E.G. Excitation-contraction coupling in the heart: the state of the question. FASEB J (1992) 6:3092–3100.[Abstract]
- Vetter R, Studer R, Reinecke H, Kolar F, Ostadalova I, Drexler H. Reciprocal changes in the postnatal expression of the sarcolemmal Na+-Ca2+-exchanger and SERCA2 in rat heart. J Mol Cell Cardiol (1995) 27:1689–1701.[CrossRef][Web of Science][Medline]
- Kolar F, Seppet E.K, Vetter R, Prochazka J, Grünermel J, Zilmer K, Ostadal B. Thyroid control of contractile function and calcium handling in neonatal rat heart. Pflügers Arch (1992) 421:26–31.[CrossRef][Web of Science][Medline]
- Wibo M, Kolar F, Zheng L, Godfraind T. Influence of thyroid status on postnatal maturation of calcium channels, β-adrenoceptors and calcium transport ATPases in rat ventricular tissue. J Mol Cell Cardiol (1995) 27:1731–1743.[CrossRef][Web of Science][Medline]
- Wade R, Kedes L. Developmental regulation of contractile protein genes. Ann Rev Physiol (1989) 51:179–188.[CrossRef][Web of Science][Medline]
- Averyhart-Fullard V, Fraker L.D, Murphy A.M, Solaro R.J. Differential regulation of slow-skeletal and cardiac troponin I mRNA during development and by thyroid hormone in rat heart. J Mol Cell Cardiol (1994) 26:609–616.[CrossRef][Web of Science][Medline]
- Orlowski J, Lingrel J.B. Thyroid and glucocorticoid hormones regulate the expression of multiple Na,K-ATPase genes in cultured neonatal rat cardiac myocytes. J Biol Chem (1990) 265:3462–3470.
[Abstract/Free Full Text] - Sweadner K.J, McGrail K.M, Khaw B.-A. Discoordinate regulation of isoforms of Na,K-ATPase and myosin heavy chain in the hypothyroid postnatal rat heart and skeletal muscle. J Biol Chem (1992) 267:769–773.
[Abstract/Free Full Text] - Diebold R.J, Koch W.J, Ellinor P.T, Wang J.-J, Mutuchamy M, Wieczorek D.F, Schwartz A. Mutually exclusive exon splicing of the cardiac calcium channel
1 subunit gene generates developmentally regulated isoforms in the rat heart. Proc Natl Acad Sci USA (1992) 89:1497–1501.[Abstract/Free Full Text] - Feron O, Octave J.-N, Christen M.-O, Godfraind T. Quantification of two splicing events in the L-type calcium channel
-1 subunit of intestinal smooth muscle and other tissues. Eur J Biochem (1994) 222:195–202.[Web of Science][Medline] - Lowry O.H, Rosebrough N.J, Farr A.L, Randall R.J. Protein measurement with the Folin phenol reagent. J Biol Chem (1951) 193:265–275.
[Free Full Text] - Dooley D.J, Bittiger H, Reymann N.C. CGP 20712A: A useful tool for quantitating β1- and β2-adrenoceptors. Eur J Pharmacol (1986) 130:137–139.[CrossRef][Web of Science][Medline]
- Beaufay H, Amar-Costesec A. Cell fractionation techniques. In: Korn ED, editor. Methods in Membrane Biology. New York: Plenum Press, 1976; 6:1-100.
- Chirgwin J.M, Przybyla A.E, MacDonald R.J, Rutter W.J. Isolation of biologically active ribonucleic acid from sources enriched in ribonucleases. Biochemistry (1979) 18:5294–5299.[CrossRef][Web of Science][Medline]
- Wuytack F, Papp B, Verboomen H, Raeymaekers L, Dode L, Bobe R, Enouf J, Bokkala S, Authi K.S, Casteels R. A sarco/endoplasmic reticulum Ca2+-ATPase 3-type Ca2+ pump is expressed in platelets, in lymphoid cells, and in mast cells. J Biol Chem (1994) 269:1410–1416.
[Abstract/Free Full Text] - McPherson G.A. Analysis of radioligand binding experiments: A collection of computer programs for the IBM PC. J Pharmacol Meth (1985) 14:213–228.[CrossRef][Web of Science][Medline]
- Pracyk J.B, Slotkin T.A. Thyroid hormone regulates ontogeny of beta adrenergic receptors and adenylate cyclase in rat heart and kidney: effects of propylthiouracil-induced perinatal hypothyroidism. J Pharmacol Exp Ther (1992) 261:951–958.
[Abstract/Free Full Text] - Jorgensen A.O, Shen A.C, Arnold W, McPherson P.S, Campbell K.P. The Ca2+-release channel/ryanodine receptor is localized in junctional and corbular sarcoplasmic reticulum in cardiac muscle. J Cell Biol (1993) 120:969–980.
[Abstract/Free Full Text] - Lew W.Y.W, Hryshko L.V, Bers D.M. Dihydropyridine receptors are primarily functional L-type calcium channels in rabbit ventricular myocytes. Circ Res (1991) 69:1139–1145.
[Abstract/Free Full Text] - Brandt N.R, Caswell A.H, Lewis C.S.A, Ferguson D.G, Brandt T, Brunschwig J.-P, Bassett A.L. Detection and localization of triadin in rat ventricular muscle. J Membrane Biol (1993) 131:219–228.[CrossRef][Web of Science][Medline]
- Noël F, Wibo M, Godfraind T. Distribution of
1 and
2 (Na+,K+)-ATPase isoforms between the junctional (t-tubular) and non-junctional sarcolemmal domains of rat ventricle. Biochem Pharmacol (1991) 41:313–315.[CrossRef][Web of Science][Medline] - Kazazoglou T, Schmid A, Renaud J.-F, Lazdunski M. Ontogenic appearance of Ca2+ channels characterized as binding sites for nitrendipine during development of nervous, skeletal and cardiac muscle systems in the rat. FEBS Lett (1983) 164:75–79.[CrossRef][Web of Science][Medline]
- Kojima M, Ishima T, Taniguchi N, Kimura K, Sada H, Sperelakis N. Developmental changes in β-adrenoceptors, muscarinic cholinoceptors and Ca2+ channels in rat ventricular muscles. Br J Pharmacol (1990) 99:334–339.[Web of Science][Medline]
- Olivetti G, Anversa P, Loud A.V. Morphometric study of early postnatal development in the left and right ventricular myocardium of the rat. II. Tissue composition, capillary growth, and sarcoplasmic alterations. Circ Res (1980) 46:503–512.
[Free Full Text] - Masuda H, Sumii K, Sperelakis N. Long openings of calcium channels in fetal rat ventricular cardiomyocytes. Pflügers Arch (1995) 429:595–597.[CrossRef][Web of Science][Medline]
- Vornanen M. Contribution of sarcolemmal calcium current to total cellular calcium in postnatally developing rat heart. Cardiovasc Res (1996) 32:400–410.
[Abstract/Free Full Text] - Cohen N.M, Lederer W.J. Changes in the calcium current of rat heart ventricular myocytes during development. J Physiol (1988) 406:115–146.
[Abstract/Free Full Text] - Vigouroux E. Dynamic study of postnatal thyroid function in the rat. Acta Endocrinol (Copenhagen) (1976) 83:752–762.[Medline]
- Jarkovska D, Kolar F, Prochazka J, Ostadal B. Structural maturation of the newborn rat myocardium: The influence of thyroid hormones. Funct Develop Morphol (1994) 4:167–168.
- Arai M, Otsu K, MacLennan D.H, Alpert N.R, Periasamy M. Effect of thyroid hormone on the expression of mRNA encoding sarcoplasmic reticulum proteins. Circ Res (1991) 69:266–276.
[Abstract/Free Full Text] - Gidh-Jain M, Huang B, Jain P, Battula V, El-Sherif N. Reemergence of the fetal pattern of L-type calcium channel gene expression in noninfarcted myocardium during left ventricular remodeling. Biochem Biophys Res Commun (1995) 216:892–897.[CrossRef][Web of Science][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

), P<0.01.

