Skip Navigation

Cardiovascular Research 1998 37(1):123-129; doi:10.1016/S0008-6363(97)00217-4
© 1998 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Pauschinger, M.
Right arrow Articles by Schultheiss, H.-P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pauschinger, M.
Right arrow Articles by Schultheiss, H.-P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 1998, European Society of Cardiology

Differential myocardial abundance of collagen type I and type III mRNA in dilated cardiomyopathy: effects of myocardial inflammation

Matthias Pauschingera,*, Andrea Doernera, Andrew Remppisb, Roman Tannhäusera, Uwe Kühla and Heinz-Peter Schultheissa

aDepartment of Cardiology, Universitätsklinikum Benjamin Franklin der Freien Universität Berlin, Hindenburgdamm 30, D-12200 Berlin, Germany
bDepartment of Cardiology, Medizinische Klinik II, University Lübeck, Ratzeburger Allee 160, D-23538 Lübeck, Germany

* Corresponding author. Fax +49-30-8445-3565.

Received 27 March 1997; accepted 15 July 1997


    Abstract
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
Objective: The collagen subtypes I (Col I) and III (Col III) are essential components of the cardiac extracellular matrix (ECM) maintaining the functional integrity of the heart. Histological, immunohistological, and biochemical studies, however, demonstrate characteristical changes of the ECM in dilated cardiomyopathy, myocarditis, ischemic cardiomyopathy, and hypertensive heart disease. Methods: In order to investigate possible effects of inflammatory processes on mRNA abundance of Col I and Col III, we examined 24 patients with the presumptive clinical diagnosis of dilated cardiomyopathy (EF=30±11%). 12 Patients were classified as idiopathic dilated cardiomyopathy without any evidence of myocardial inflammation; the remaining 12 patients were classified as inflammatory cardiomyopathy due to the immunohistologically documented inflammatory myocardial process. Results: Quantification of reverse transcription polymerase chain reaction (RT–PCR) products revealed significant differences as to the mRNA abundance ratio Col III/Col I between subgroups of patients with inflammatory cardiomyopathy (1.16±0.18) and idiopathic dilated cardiomyopathy (2.77±0.65) regardless of left ventricular dysfunction (p≤0.05). Conclusion: It is not yet known, whether different Col III/Col I ratios differentially influence diastolic compliance. Our data suggest that inflammatory mechanisms seen in inflammatory cardiomyopathy influence the mRNA abundance of collagen subtypes I and III.

KEYWORDS Dilated cardiomyopathy; Inflammatory cardiomyopathy; Collagen mRNA abundance; Extracellular matrix


    1 Introduction
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
The myocardial connective tissue maintaining the functional integrity of the heart [1]mainly consists of collagen type I (Col I) (80%) and collagen type III (Col III) (20%). While fibrosis is a nonspecific adaptional process due to different etiologies, histological, immunohistological, and biochemical studies demonstrate characteristic changes of the ECM in dilated cardiomyopathy, myocarditis, ischemic cardiomyopathy and hypertensive heart disease [1–8]. Using electron microscopic and immunohistological methods Yoshikane et al. [5]documented an increase in the number and thickness of the weavy collagen in end stage dilated cardiomyopathy. Using biochemical analysis Bishop et al. found that the increase in collagen content is attributable to an increase in absolute concentrations of both collagen subtypes (Col I and Col III) [6]. Weber et al., however, demonstrated a significant decrease in the portion of type I collagen in explanted hearts of patients with end stage dilated cardiomyopathy [8]. The discrepancy of results is possibly explained by different methodical approaches in these studies. Furthermore, according to the task force on definition and classification of cardiomyopathies 1995 [9], different subtypes of dilated cardiomyopathy were possibly analyzed in these studies.

In a previously published study of our group, immunohistological examinations revealed lymphocytic infiltrates and an increased HLA class I and II antigen expression on endothelial as well as on interstitial cells in 78 of 161 patients (48%) with a clinically suspected diagnosis of dilated cardiomyopathy and negative histological findings (Dallas classification) [10–13]. This is indicative of an ongoing chronic inflammatory (autoimmunological) process in about half of the patients with a clinically suspected diagnosis of dilated cardiomyopathy. Previously published studies, though, did not use immunohistological analyses in combination with standard histological criteria for the classification of dilated cardiomyopathy. Therefore chronic inflammatory processes of the myocardium might have been missed in about half of the patients with the presumptive clinical diagnosis of dilated cardiomyopathy.

The purpose of this study was to clarify whether an inflammatory process in the myocardium is linked to an altered mRNA abundance of Col I and Col III in patients with inflammatory cardiomyopathy compared to patients with idiopathic dilated cardiomyopathy.


    2 Methods
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
2.1 Patients
Twenty-four patients, age 45±10 (range 26 to 61) with the presumptive clinical diagnosis of dilated cardiomyopathy were examined; 9 out of these patients were female and 15 male. All patients had symptoms for more than six months. All had a cross-sectional echocardiography and electrocardiography. Before taking cardiac muscle biopsies, left and right cardiac catheterization was carried out in all patients, including coronary angiography, ventriculography, and assessment of left and right ventricular hemodynamic function. Angiographically, all patients had left ventricular dysfunction which could neither be explained by a coronary or hypertensive heart disease, nor by valvular defects or secondary causes. For further diagnostic workup at least 8 endomyocardial biopsies from the right ventricular septum were taken in all patients. These endomyocardial biopsies were analyzed using histological, immunohistological and molecular biological techniques. All procedures were performed in accordance with ethical standards and with the Helsinki Declaration of 1975. In addition, all patients gave informed consent for all of the invasive studies performed.

2.2 Hemodynamic evaluation
The hemodynamic function of the left ventricle was studied by using the AVD-program (Angiographic Ventricular Dynamics). The ventricular volume was calculated according to Dodge et al. [14]. The following variables were analyzed: left ventricular end-diastolic volume index (EDVI ml3/body surface area (BSA)), ejection fraction (EF %), cardiac output (CO l/min), cardiac index (CI l/min/BSA), pulmonary capillary wedge pressure (PCP mmHg), and mean pulmonary artery pressure (mPA mmHg). The left ventricular end-diastolic pressure (LVEDP mmHg) was measured by using a tip catheter.

2.3 Histology
Haematoxilin-eosin staining was carried out with paraffin sections according to standardized methods. After staining, the histological sections were analyzed according to the Dallas classification [10].

2.4 Immunohistology
Endomyocardial biopsies were immediately frozen at –70°C. Then biopsies were cut into 5 µm thick sections and 6–9 serial sections were analyzed for each antibody. Each biopsy was evaluated by two different examiners blinded to the diagnosis.

Antibodies: Lymphocytes were detected by anti-CD3 antibodies (Dakopatts) and activated macrophages by 27 E 10 antibodies (Dianova; Hamburg, Germany) [11–13].

Immunohistological staining: The cryotome sections were preincubated with 20% fetal calf serum (FCS) in order to block non-specific immunoglobulin binding sites. Specific monoclonal mouse anti-human antibodies in previously tested dilutions were then incubated for 45 min at room temperature. The unbound antibodies were removed by three washing steps with phosphate buffered saline (PBS). To identify specifically bound primary antibodies, peroxidase-conjugated rabbit-anti-mouse immunoglobulin (Dianova), diluted at 1:200 in PBS containing 10% FCS (30 min, room temperature) was used. The staining was carried out with 3-amino-9-ethylcarbazole as a chromogene against a haematoxylin counter stain [11–13].

2.4.1 Light microscopic evaluation
Histology: The histological diagnosis of acute myocarditis and borderline myocarditis was based on the Dallas classification [10]. Acute myocarditis was diagnosed histologically if light microscopy showed infiltrating interstitial cells (leucocytes, lymphocytes, or macrophages) associated with myocardial injury. The diagnosis of borderline myocarditis required the presence of infiltrating lymphocytes with or without interstitial or reparative fibrosis but with no cell necrosis.

Immunohistology: Using immunohistological techniques, the number of stained T-lymphocytes (CD3) per visual field with x400 magnification were counted in one entire specimen. The numbers of cells were given as the mean value of at least ten counted high power fields (HPF, x400 magnification). The diagnosis of an ongoing inflammatory process was made if an average of more than two lymphocytes (CD3) per HPF (7 cells per mm2) could be documented. Pathologically increased infiltrating macrophages were defined as being present in cell counts >1.5 cells per HPF (5 cells per mm2) [11–13].

2.5 Molecular biological methods
RNA isolation: Isolation of RNA was carried out using the lithium chloride–urea method modified according to Auffray [15]. The endomyocardial biopsies were homogenized through a polytron for 30 s in lithium chloride urea buffer (3 M lithium chloride, 6 M urea, 10 mM sodium acetate pH 5.0, 200 µg/ml heparin, 0.1% SDS). Subsequently, phenolization was carried out followed by alcohol precipitation.

Reverse transcription: 300 ng total RNA of every single biopsy was transcribed into the corresponding cDNA by using random primer (100 µg/ml) and MMLV-reverse transcriptase (BRL) according to the manufacturer's instructions (Boehringer Mannheim Biochemicals, Mannheim, Germany).

Oligonucleotides: The primers used for RT–PCR were located at the C-terminal end of the propeptides. In this region, the sequences are highly conserved. To differentiate between amplified DNA and reverse transcribed RNA, the primer regions of Col I and Col III are located on exon 1 and 2 or exon 3 and 4, respectively [16–18]. The exact primer sequences are shown in Table 1. The RT–PCR products of Col I and Col III had different lengths (347 bp Col I, 376 bp Col III); therefore a differentiation by electrophoresis was possible. For hybridization of the RT–PCR products (Col I, Col III) by Southern blot, specific internal oligonucleotides were used (Col I hyb.: 5'AACCTCAAGAAGGCCCTGCT3'; Col III hyb.: 5'AGAAACTGCAGAGACCTGAA3').


View this table:
[in this window]
[in a new window]

 
Table 1 Oligonucleotide sequences of 5' and 3' primers used for polymerase chain reaction

 
PCR gene amplification: The PCR procedure was modified according to Saiki [19]. The reaction volume consisted of 1.5 mM MgCl2, 50 mM KCl, 10 mM Tris–HCl ph 8.3, 0.01% gelatin, 0.4 µM primer (Col III 5', Col III 3', Col I 5', Col I 3'), 0.2 mM of dATP, dCTP, dGTP, dTTP and 4 IU taq-polymerase (Cetus Cooperation). To make quantitative assessments of the mRNA abundance of Col I and Col III, we coamplified the cDNA of both collagen subtypes (Col I and Col III) in a single PCR. So the PCR reactions of Col I and Col III were running simultaneously. Subsequently, electrophoresis and hybridization of the separated RT–PCR products with specially Formula labelled internal oligonucleotides (Col I hyb., Col III hyb.) was performed by Southern blot hybridization. We were able to demonstrate that the proportion of synthesized RT–PCR products of Col I and Col III remained constant with 25, 30, and 35 cycles of RT–PCR. Therefore, 30 cycles in the RT–PCR were chosen for further analysis.

Southern blot: The Southern blot hybridization was performed in standard fashion. Denaturation was achieved by treatment with 0.5 M NaOH and 1.5 M NaCl. The gel was neutralized by 3 M NaCl and 0.5 M Tris pH 7.4 and transferred to a nylon membrane (Amersham, Nylon Transfer Membrane Hybond N+) using an alkaline blot. Prehybridization (4 h) and hybridization were carried out at 50°C in a 6xSSC, 5x Denhardts-solution and 250 µg/ml sperm DNA using a 5' labelled internal oligonucleotide (Col I hyb., Col III hyb) (106 cpm/ml, 16 h). Subsequently, filters were washed twice in 6xSSC and 0.1% SDS at room temperature for 30 min with 0.1xSSC and 0.1%SDS at 50°C. Airdried filters were exposed to an X-ray film (Kodak Xomat AR) with intensifier screen (Kodak Xomat regular) at –80°C for 24–56 h. To obtain quantitative data, the different bands were quantified by using a video densitometer system (Biometra, Göttingen).

2.6 Statistical analysis
For statistical analysis the SPSS statistic software package was used. All values are expressed as the mean±standard deviation. Statistical analysis of differences observed between the ratio of Col III/Col I mRNA abundance in patients with inflammatory cardiomyopathy compared to patients with idiopathic dilated cardiomyopathy was performed using Student's t test for unpaired data. Statistical significance was accepted at the level of p<0.05.


    3 Results
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
3.1 Hemodynamic evaluation
All patients in this study had a left ventricular dysfunction (EF=30±11%). There was no significant difference in the left ventricular dysfunction in patients with histological and immunohistologically confirmed idiopathic dilated cardiomyopathy (EF=29±10%; n = 12) compared to patients with inflammatory cardiomyopathy (EF=31±12%; n = 12). Other hemodynamic parameters as EDVI or LVEDP also did not significantly differ in these two groups (Table 2).


View this table:
[in this window]
[in a new window]

 
Table 2 Hemodynamic parameters

 
3.2 Histology and immunohistology
Histological techniques revealed that none of the patients had an acute or borderline myocarditis according to the Dallas classification [10].

Using immunohistological techniques subgroups of patients with and without cellular infiltrates could be defined (Table 3). 12 Of the 24 patients in this study had more than 2 CD3 cells per HPF (2.6±1.1), respectively, and were therefore classified as inflammatory cardiomyopathy (WHO classification of cardiomyopathies 1995) [9].


View this table:
[in this window]
[in a new window]

 
Table 3 Immunohistologically evaluation of infiltrating cells

 
The other 12 patients had negative immunohistological results and therefore were classified as idiopathic dilated cardiomyopathy (Fig. 1) [9]. By this definition the mean cell count of lymphocytic infiltrates (CD3) differs significantly in patients classified as idiopathic dilated cardiomyopathy (CD3=0.8±0.3 cells/HPF) compared to patients classified as inflammatory cardiomyopathy (CD3=2.6±1.1 cells/HPF) in both groups of patients (Table 3).


Figure 1
View larger version (160K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Immunohistological staining of endomyocardial biopsies with antibodies directed against lymphocyte surface antigens. A shows lymphocytic infiltrates (staining anti-CD3). B shows noninflamed cardiac tissue after staining with anti-CD3.

 
A significantly increased number of macrophages was present in the group of patients classified as inflammatory cardiomyopathy (1.8±0.7 cells per HPF) as compared to those classified as idiopathic dilated cardiomyopathy (0.9±0.4 cells per HPF; p<0.01).

3.3 mRNA abundance of collagen
After Southern blotting the RT–PCR products of Col I and Col III were analyzed by a densitometric system (Scan pack Biometra, Göttingen, Germany). Using this system each band of the southern blots of Col I and Col III were exactly measured as a certain amount of pixels. Because of the different length of the RT–PCR products (Col I 347 bp; Col III 376 bp) it became possible to calculate the amount of pixels of the Col I and Col III bands for one specific endomyocardial biopsy on one lane of the Southern blot. Dividing the measured pixels of Col III by the measured pixels of Col I the ratio of the mRNA abundance of Col III/Col I can be calculated for each specific endomyocardial biopsy. Using this technique the evaluation of the mRNA abundance of Col I and Col III showed a ratio of Col III/Col I of 2.77±0.65 in patients with idiopathic cardiomyopathy. The densitometric data of the Southern data in patients with inflammatory cardiomyopathy showed a significantly different ratio of Col III/Col I (Col III/Col I=1.16±0.18; p<0.05) (Fig. 2Fig. 3).


Figure 2
View larger version (39K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Southern blot of RT–PCR products of collagen subtypes I and III in patients with inflammatory cardiomyopathy (lanes 1–4) and idiopathic dilated cardiomyopathy (lanes 5–8).

 

Figure 3
View larger version (12K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 The ratio of Col III/Col I mRNA abundance differs significantly (p<0.05) in endomyocardial biopsies of patients with inflammatory cardiomyopathy compared to patients with idiopathic dilated cardiomyopathy (DCM).

 

    4 Discussion
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 
Studies by Kuehl et al. demonstrated an ongoing inflammatory myocardial process in about half of the patients with the tentative diagnosis of dilated cardiomyopathy [11–13]. However none of the recently published studies on myocardial collagen metabolism in patients with dilated cardiomyopathy considered a classification of patients as having an inflammatory myocardial disease [1–8]. We therefore performed a subgroup analysis employing histological and immunohistological techniques. Given the influence of cytokines and growth factors on collagen metabolism [20–24], inflammatory myocardial processes in dilated cardiomyopathy might influence the composition of collagen matrix, which might represent an independent factor in the progression of interstitial fibrosis in this disease.

In our study 12 patients (50%) showing the presumptive clinical diagnosis of dilated cardiomyopathy revealed an increased count of lymphocytes and macrophages. None of the endomyocardial biopsies did show an acute or borderline myocarditis according to the Dallas classification [10]. Therefore these patients were classified as having inflammatory cardiomyopathy. 12 Patients had negative histological and immunohistological results and were therefore classified as having idiopathic dilated cardiomyopathy [9]. These data are in line with the subgroup analysis performed by Kuehl et al. [11–13]and allowed us to study the effect of inflammatory processes on the mRNA abundance of Col I and Col III. In this study, it could be demonstrated that the ratio of Col III/Col I mRNA abundance in myocardium with chronic inflammatory processes greatly differs from that in histologically and immunohistologically confirmed idiopathic dilated cardiomyopathy (Fig. 3; p<0.05). This finding is possibly explained by the factor that cytokines and growth hormones that mediate inflammatory processes also influence the metabolism of collagens [20–24]. Since Hinglais et al. [25]demonstrated the colocalization of myocardial fibrosis and inflammatory cells in spontaneously hypertensive rats, the expression of Col I mRNA by fibroblasts might be controlled by inflammatory cells that are predominantly T helper lymphocytes (CD3) and macrophages. It is however not known which growth hormones or cytokines represent the key factors in fibrogenesis.

Although the Col III/Col I mRNA abundance was not correlated with the degree of left ventricular EF, EDVI, and LVEDP (Table 2), different ratios might still influence myocardial contractility due to the different physical properties of Col III and Col I. Since an increased proportion of Col I is associated with a reduced distensibility as seen in hypertensive arteries the force-frequency and force volume relationships might be differentially affected in idiopathic dilated cardiomyopathy and inflammatory myocardial disease [26, 27].

Fibrogenesis in inflammatory myocardial disease is not fully understood on the molecular level. Macrophages, when activated by lymphokines, have been shown to produce highly fibrogenic growth factors such as platelet-derived growth factor and transforming growth factor-β (TGF-β) [28]. Interestingly, it has been demonstrated that a nuclear binding factor I binding site mediates the transcriptional activation of the {alpha}1(I) collagen promotor by TGF-β [20]. Furthermore, immunohistological stainings of endomyocardial biopsies from patients classified as inflammatory cardiomyopathy could show that various cytokines (interleukin-1, interleukin-2, interleukin-8, tumor necrosis factor-{alpha} and -β, interferon-{gamma}) were locally released from activated inflammatory cells causing a cytokine-rich micro-environment [29]. Several lines of evidence suggest that T-cells could play a role in the pathomechanism of fibrogenesis [22]. Therefore, inflammatory cells possibly act in concert with lymphokines and growth factors in fibrogenesis [25]with a differential effect on mRNA abundance of Col I and Col III in inflammatory myocardial disease and idiopathic dilated cardiomyopathy.

In summary, the present study indicates that chronic inflammation of the myocardium changes the ratio of the collagen subtypes I and III in patients with inflammatory cardiomyopathy as compared to patients with idiopathic dilated cardiomyopathy. Conceivable changes in contractile behaviour of chronically inflamed myocardium due to different physical properties of Col I and Col III are still to be eluciated.

Time for primary review 27 days.


    Acknowledgements
 
This study was supported from the Deutsche Forschungsgemeinschaft (DFG Pa 369/2–1, Pa 369/2–3). We are indebted to K. von der Mark, Professor at the Max Planck Institute, Erlangen (Germany), for his help in establishing these methods.


    References
 Top
 Abstract
 1 Introduction
 2 Methods
 3 Results
 4 Discussion
 References
 

  1. Weber K.T. Cardiac interstitium in health and disease: the fibrillar collagen network. J Am Coll Cardiol (1989) 13(7):1637–1652.[Abstract]
  2. Shaper J, Froede R, Hein S, Buck A, Hashizume H, Speiser B, Friedl A, Bleese N. Impairment of the myocardial ultrastructure and changes of the cytoskeleton in dilated cardiomyopathy. Circulation (1991) 83:504–514.[Abstract/Free Full Text]
  3. Mukherjee D, Sen S. Alteration of collagen phenotypes in ischemic cardiomyopathy. J Clin Invest (1991) 88(4):1141–1146.[Web of Science][Medline]
  4. Schwarz F, Mall G, Zebe H, Blickle J, Derks H, Manthey J, Kübler W. Quantitative morphologic findings of the myocardium in idiopathic dilated cardiomyopathy. Am J Cardiol (1983) 51:501–506.[CrossRef][Web of Science][Medline]
  5. Yoshikane H, Honda M, Goto Y, Morioka S, Ooshima A, Moriyama K. Collagen in dilated cardiomyopathy-scanning electron microscopic and immunohistochemical observations. Jpn Circ J (1992) 56:899–910.[Medline]
  6. Bishop J.E, Greenbaum R, Gibson D.G, Yacoub M, Laurent G.J. Enhanced deposition of predominantly type I collagen in myocardial disease. J Mol Cell Cardiol (1990) 22:1157–1165.[CrossRef][Web of Science][Medline]
  7. Marijianowski M.M.H, Teeling P, Mann J, Becker A.E. Dilated cardiomyopathy is associated with an increase in the type I/type III collagen ratio: a quantitative assessment. J Am Coll Cardiol (1995) 25:1263–1272.[Abstract]
  8. Weber K.T, Pick R, Janicki J.S, Gadodia G, Lakier J.B. Inadequate collagen tethers in dilated cardiopathy. Am Heart J (1988) 116:1641–1646.[CrossRef][Web of Science][Medline]
  9. Richardson P, McKenna W, Bristow M, Maisch B, Mautner B, O'Connel J, Olsen E, Thiene G, Goodwin J, Gyarfas I, Martin I, Nordet P. Report of the 1995 world health organization/international society and federation of cardiology task force on the definition and classification of cardiomyopathies. Circulation (1996) 93:841–842.[Free Full Text]
  10. Aretz H.T, Billingham M.E, Edwards W.D, Factor S.M, Fallon J.T, Fenoglio J.J, Olsen E.G.J, Schoen F.J. Myocarditis. A histopathologic definition and classification. Am J Cardiovasc Pathol (1987) 1:3–14.[Medline]
  11. Kühl U, Noutsias M, Seeberg B, Schultheiss H.P. Immunohistological evidence for a chronic intramyocardial inflammatory process in dilated cardiomyopathy. Heart (1996) 75:295–300.[Abstract/Free Full Text]
  12. Kühl U, Noutsias M, Seeberg B, Schannwell M, Welp L.B, Schultheiss H.P. Chronic inflammation in the myocardium of patients with clinically suspected dilated cardiomyopathy. J Cardiac Failure (1994) 1:13–25.[Medline]
  13. Kühl U, Noutsias M, Seeberg B, Schannwell M, Welp L.B, Schultheiss H.P. Immunhistological evaluation of myocardial biopsies from patients with dilated cardiomyopathy. Heart Failure (1994) 9:231–245.
  14. Dodge H.T, Sheehan F.H. Quantitative contrast angiography for assessment of ventricular performance in heart disease. J Am Coll Cardiol (1983) 1:73–81.[Abstract]
  15. Auffray C, Rougeon F. Purification of mouse immunoglobulin heavy-chain messenger RNAs from total myeloma tumor RNA. Eur J Biochem (1980) 107:303–314.[Web of Science][Medline]
  16. Ala-Kokko L, Kontusaari S, Baldwin C.T, Kuivaniemi H. Structure of cDNA clones coding for the entire prepro {alpha}1(III) chain of human type III procollagen. Differences in protein structure from type I procollagen and conservation of codon preferences. Biochem J (1989) 260(2):509–516.[Web of Science][Medline]
  17. Chu M.L, Weil D, Wet W, Bernard M, Sippola M, Ramirez F. Isolation of cDNA and genomic clones encoding human pro-{alpha}1(III) collagen. Partial characterization of the 3' end region of the gene. J Biol Chem (1985) 260:4357–4363.[Abstract/Free Full Text]
  18. D'Alessio M, Bernard M, Pretorius P.J, de Wet W, Ramirez F. Complete nucleotide sequence of the region encompassing the first twenty-five exons of the human pro alpha (I) collagen gene (COL1A1). Gene (1988) 67:105–115.[CrossRef][Web of Science][Medline]
  19. Saiki R.K, Gelfand D.H, Stoffel S, Scharf S.J, Higuchi R, Horn G.T, Mullis K.B, Erlich H.A. Primer-directed enzymatic amplification of DNA with thermostable DNA Polymerase. Science (1988) 239:487–491.[Abstract/Free Full Text]
  20. Rossi P, Karsenty G, Roberts A.B, Roche N.S, Sporn M.B, de Crombrugghe B. A nuclear factor 1 binding site mediates the transcriptional activation of a type I collagen promotor by transforming growth factor-beta. Cell (1988) 52:405–414.[CrossRef][Web of Science][Medline]
  21. Bornstein P, Sage H. Regulation of collagen gene expression. Prog Nucleic Acid Res Mol Biol (1989) 37:67–106.[Web of Science][Medline]
  22. Kovacs E.J. Fibrogenic cytokines: the role of immune mediators in the development of scar tissue. Immunol Today (1991) 12(1):17–23.[CrossRef][Web of Science][Medline]
  23. Nagaoka I, Trapnell B.C, Crystal R.G. Upregulation of platelet-derived growth factor-A and -B gene expression in alveolar macrophages of individuals with idiopathic pulmonary fibrosis. J Clin Invest (1990) 85:2023–2027.[Web of Science][Medline]
  24. Eghbali M, Tomek R, Sukhatme V.P, Woods C, Bhambi B. Differential effects of transforming growth factor-β1 and phorbol myristate acetate on cardiac fibroblasts. Regulation of fibrillar collagen mRNAs and expression of early transcription factors. Circ Res (1991) 69(2):483–490.[Abstract/Free Full Text]
  25. Hinglais N, Heudes D, Nicoletti A, Mandet C, Laurent M, Bariety J, Michel J.B. Colocalization of myocardial fibrosis and inflammatory cells in rats. Lab Invest (1994) 70(2):286–294.[Web of Science][Medline]
  26. Lapiere Ch.M, Nusgens B, Pierard G.E. Interaction between collagen type I and type III in conditioning bundles organization. Connect Tissue Res (1977) 5:21–29.[Web of Science][Medline]
  27. Pieske B, Kretschmann B, Meyer M, Holubarsch C, Weirich J, Posival H, Minami K, Just H, Hasenfuss G. Alterations in intracellular calcium handling associated with the inverse force-frequency relation in human dilated cardiomyopathy. Circulation (1995) 92:1169–1178.[Abstract/Free Full Text]
  28. Leibovich S.J, Ross R. The role of the macrophage in wound repair. Am J Pathol (1975) 78:71–100.[Abstract]
  29. Schwimmbeck P.L, Hohmann C, Holtkamp A, Schwimmbeck N.K. Cytokines in the peripheral blood of patients with myocarditis and their correlation with immunohistological findings in myocardial biopsies. Circulation (1994) 90(4):1177. abstract.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Pauschinger, M.
Right arrow Articles by Schultheiss, H.-P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pauschinger, M.
Right arrow Articles by Schultheiss, H.-P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?